Cell line (Homo sapiens) | HCT116 | ATCC | CCL-247/CVCL_0291 | Human colon cancer cells |
Strain, strain background (Escherichia coli) | Top 10 E. coli | Life Technologies GmbH | C404003 | Chemically competent cells |
Other | TransIT-LT1 | VWR | 731-0029 | Plasmid transfection reagent |
Other | Lipofectamine RNAiMax | Life technologies GmbH | 13778150 | siRNA transfection reagent |
Transfected construct (human) | siRNA:UBC | GE HealthcareDharmacon/Horizon | MU-019408-01-0002 | #1 GTGAAGACCCTGACTGGTA#2 AAGCAAAGATCCAGGACAA#3 GAAGATGGACGCACCCTGT#4 GTAAGACCATCACTCTCGA |
Transfected construct (human) | siRNA:Non targeting | GE HealthcareDharmacon/Horizon | D‐001810‐02 | UGGUUUACAUGUUGUGUGA |
Transfected construct (human) | siRNA:Control | Ambion | S29712 | |
Transfected construct (human) | siRNA:GFP | GE HealthcareDharmacon//Horizon | D-001300-01-05 | GCAAGCTGACCCTGAAGTTC |
Transfected construct (human) | siRNA:CTNNB1 | Ambion | S438 | CUGUUGGAUUGAUUCGAAAtt |
Transfected construct (human) | siRNA:Cherry | IDT | Custom design | rCrArU rGrGrC rCrArU rCrArU rCrArA rGrGrA rGrUrU rCrArU rG |
Antibody | Anti-β-actin HRP, (Rabbit polyclonal) | Santa Cruz Biotechnology | Cat#: 47778/ RRID:AB_2714189 | WB (1:20,000) |
Antibody | Anti-β-actin, (Rabbit polyclonal) | Santa Cruz Biotechnology | Cat#: 47778/ RRID:AB_2714189 | WB (1:40,000) |
Antibody | Anti-β-catenin, (Mouse monoclonal) | Dianova/Affinity BioReagent | Cat#: MA1-2001/ RRID:AB_326078 | WB (1:3000),IF (1:500) |
Antibody | Anti-Cherry, (Mouse monoclonal) | ClonTech | Cat#: 632543/ RRID:AB_2307319 | WB (1:1000) |
Antibody | Anti-GFP, (Mouse monoclonal) | Invitrogen | Cat#: 332600/ RRID:AB_2533111 | WB (1:1000) |
Antibody | Anti-GFP, (Rabbit polyclonal) | Invitrogen | Cat#: A6455/ RRID:AB_221570 | WB (1:1000) |
Antibody | Anti-E-Cadherin, (Mouse monoclonal) | BD Biosciences | Cat#: 610182/ RRID:AB_397581 | WB (1:1000) |
Antibody | Anti-V5, (Rabbit polyclonal) | Rockland | Cat#: 600-401−378/ RRID:AB_828437 | WB (1:2000) |
Antibody | Anti-V5, (Mouse monoclonal) | Thermo Fisher Scientific | Cat#: 15253/ RRID:AB_10977225 | WB (1:1000) |
Antibody | Anti-Flag, (Rabbit polyclonal) | Sigma-Aldrich | Cat#: F7425/ RRID:AB_439687 | WB (1:1000) |
Antibody | Anti-Flag, mouse (Mouse monoclonal) | Sigma-Aldrich | Cat#: F3165/ RRID:AB_259529 | WB (1:1000) |
Antibody | Anti-APC ALI 12–28, (Mouse monoclonal) | Santa Cruz Biotechnology | Cat#: sc-53165/ RRID:AB_628734 | WB (1:1000) |
Antibody | Anti-Axin1 C76H11, (Rabbit polyclonal) | Santa Cruz Biotechnology | Cat#: 2087/ RRID:AB_2274550 | WB (1:1000) |
Antibody | Anti-GSK3β D5C5Z, (Rabbit polyclonal) | Cell Signaling Technology | Cat#: 12456/ RRID:AB_2636978 | WB (1:1000) |
Antibody | Normal IgG, (Rabbit) | Cell Signaling Technology | Cat#: 2729/ RRID:AB_1031062 | WB (1:1000) |
Antibody | IgG1 K isotype control (Mouse) | eBioscience | Cat#: 16-4714-81/ RRID:AB_470160 | IP (1:1000) |
Antibody | Anti-mouse IgG-HRP (Goat) | Jackson ImmunoResearch | Cat#: 115-035-003/ RRID:AB_10015289 | WB (1:10,000) |
Antibody | Anti-rabbit IgG-HRP (Goat) | Jackson ImmunoResearch | Cat#: 111-035-003/ RRID:AB_2313567 | WB (1:10,000) |
Antibody | True Blot ULTRA Anti-mouse IgG-HRP | eBioscience | Cat#: 18-8817-33/ RRID:AB_2610851 | WB (1:5000) |
Recombinant DNA reagent | pRL actin-Renilla | Nickles et al., 2012 | | Renilla luciferase reporter |
Recombinant DNA reagent | pgl4.23 TCF4/Wnt-luciferase | Demir et al., 2013 | | TCF4/Wnt-Firefly Luciferase reporter |
Recombinant DNA reagent | px459 | Mali et al., 2013 | RRID:SCR_002037 | Cloning of the sgRNA |
Recombinant DNA reagent | px459sgCTNNB1 | This paper | | See Materials and methods, Figure 1—figure supplement 1– sgRNA:TGACCTGTAAATCATCCTTT |
Recombinant DNA reagent | px459sgAPC#b | This study | | See Materials and methods, Figure 7A sgRNA: TAGAACCAAATCCAGCAGA |
Recombinant DNA reagent | pSpCas9(BB)–2A-GFP (PX458) | Mali et al., 2013 | RRID:SCR_002037 | Control vector |
Recombinant DNA reagent | pMK-RQ HA-FLAG-mClover-PGK-HygRHA | This study | | Donor template, See Materials and methods, Figure 1—figure supplement 1 |
Recombinant DNA reagent | pMK-RQ HA-V5-mCherry-PGK-BRS-HA | This study | | Donor template, See Materials and methods, Figure 1—figure supplement 1 |
Chemical compound, drug | CHIR99021 | Merck Millipore | 361571 | GSK-3β inhibitor |
Chemical compound, drug | LGK974 | Hölzel Diagnostika | TRC-L397640-50mg | Porcupine inhibitor |
Peptide, recombinant protein | Mouse Wnt3a | PeproTech | 315-20-10 | |
Other | Triton X-100 | Sigma-Aldrich | T8787-250ml | |
Other | NP-40 | Sigma-Aldrich | NP40S-100ml | |
Other | GFP-(gta) magnetic beads/agarose | Chromotec | gtak-20gtma-20 | |
Other | RFP-Trap(rta) magnetic beads/agarose | Chromotec | rta-20rtma-20 | |
Commercial assay or kit | BCA Protein Assay Kit | Thermo Fisher Scientific | 23225 | |
Other | 4–12% NuPAGE Bis-Tris gels | Thermo Fisher Scientific | NW04122BOX;NW00120BOX | |
Other | 3–8% NuPAGE Tris acetate gels | Thermo Fisher Scientific | EA03752BOX | |
Other | Nitrocellulose membranes | GE Healthcare | GE10600002 | |
Commercial assay or kit | In-Fusion HD Cloning | Takara | 639650 | |
Other | Dynabeads Protein G magnetic beads | Thermo Fisher Scientific | 10004D | |
Other | ECL reagent | Merck Millipore | WBKLS0100 | |
Other | ECL reagent | BiozolDiagnostica | MBL-JM-K820-500 | |
Other | Hyperfilm ECL; 18×24 cm2 | Amersham/GE Healthcare | GE28-9068-36 | |
Other | Puromycin | Sigma-Aldrich | P9620 | |
Other | Hygromycin | Gibco/Thermo Fisher Scientific | 10687010 | |
Other | Blasticidin | Life Technologies GmbH | R21001 | |
Commercial assay or kit | DNeasy Blood & Tissue Kit | QIAGEN | 69504 | |
Commercial assay or kit | RevertAid H Minus First Strand cDNA Synthesis Kit | Thermo Fisher Scientific/VWR | K1632 | |
Commercial assay or kit | QIAfilter Plasmid Maxi Kit | QIAGEN | 12263 | |
Commercial assay or kit | Qiagen RNeasy Mini Kit | QIAGEN | 12571 | |
Other | McCoy | Life Technologies GmbH | 26600080 | |
Commercial assay or kit | Light Cycler 480 Probes Master Mix QPCR | Roche | 4887301001 | |
Other | Q5 Hot Start High-Fidelity DNA Polymerase | New England Biolabs | M0493S | |
Other | dNTP Set 100 mM | VWR/Fermentas/Thermo Fisher Scientific | R0182 | |
Commercial assay or kit | Light Cycler 480 Probes Master Mix QPCR | Roche | 4887301001 | |
Other | PFA/ paraformaldehyde | VWR | 43,368.9 L | |
Other | 4% paraformaldehyde in PBS | Santa Cruz Biotechnology | sc-281692 | |
Other | VectashieldDAPI solution | Biozol Diagnostica | C-H-1200 | |
Other | Hoechst 33342; trihydrochloride; trihydrate | Life Technologies GmbH | H1399 | |
Other | BSA | Gerbu | 5010500 | |
Other | PBS | Sigma-Aldrich | P3813-10PAK | |
Other | Goat serum | Cell Signaling Technology | 5425S | |
Other | Microscope slides 76×26 mm2 | Carl Roth GmbH | H868.1 | |
Other | µ-Slide eight well | Ibidi | 80826 | |
Sequence-based reagent | Universal probe library #011 | Roche/Sigma-Aldrich | 4685105001 | |
Sequence-based reagent | Universal probe library #148 | Roche/Sigma-Aldrich | 04685148001 | |
Sequence-based reagent | Universal probe library #152 | Roche/Sigma-Aldrich | 4694384001 | |
Sequence-based reagent | Universal probe library #088 | Roche/Sigma-Aldrich | 4689135001 | |
Sequence-based reagent | Universal probe library #060 | Roche/Sigma-Aldrich | 4688589001 | |
Sequence-based reagent | Universal probe library #021 | Roche/Sigma-Aldrich | 4686942001 | |
Sequence-based reagent | sgRNA used for targeting CTNNB1 (px459sgCTNNB1) | This paper | | TGACCTGTAAATCATCCTTT |
Sequence-based reagent | sgRNA used for targeting APC(px459sgAPC#b) | This paper | | TAGAACCAAATCCAGCAGA |
Software, algorithm | Adobe Photoshop CS6 | Adobe | RRID:SCR_014199 | |
Software, algorithm | Adobe Illustrator CS6 | Adobe | RRID:SCR_010279 | |
Software, algorithm | Adobe Affinity Designer | Adobe | RRID:SCR_016952 | |
Software, algorithm | Fiji | | PRID:SCR_002285 | |
Software, algorithm | ImageJ | | RRID:SCR_003070 | |
Software, algorithm | Biorender | | RRID:SCR_018361 | |
Software, algorithm | OriginPro | | RRID:SCR_014212 | |
Software, algorithm | MATLAB | | RRID:SCR_013499 | |
Other | Fibronectin | Sigma-Aldrich | F1141-5MG | |
Other | DPBS | Gibco (ThermoFisher Scientific) | 14190-144 | |
Other | 8-well Nunc Lab-Tek chambered cover glass | Thermo Fisher Scientific | 155411 (#1) | |
Other | McCoy’s 5A - w/ L-Gln, w/o Phenol RedMcCoy’s 5AMedium w/ L-Glutamine w/o Phenol red and Sodium bicarbonate | GE Lifesciences/HyClone (Thermo Fisher Scientific)HIMEDIA (NeoLab) | SH30270.01/10358633AT179-5L | Sodiumbicar-bonate was added before sterile filtration |
Other | Alexa 488 | Thermo Fisher Scientific | 10266262 | Reference dye |
Other | Alexa 546 | Thermo Fisher Scientific | 10534783 | Reference dye |
Other | Xfect | Takara ClonTech | 631318 | Transfection reagent |
Sequence-based reagents | Primers (Supplementary files 5 and 6) | Eurofins | | See Supplementary files 5 and 6 |