Allele-specific endogenous tagging and quantitative analysis of β-catenin in colorectal cancer cells

  1. Giulia Ambrosi
  2. Oksana Voloshanenko
  3. Antonia F Eckert
  4. Dominique Kranz
  5. G Ulrich Nienhaus  Is a corresponding author
  6. Michael Boutros  Is a corresponding author
  1. German Cancer Research Center (DKFZ), Division of Signaling and Functional Genomics and Heidelberg University, BioQuant and Medical Faculty Mannheim, Germany
  2. Institute of Applied Physics, Karlsruhe Institute of Technology, Germany
  3. Institute of Nanotechnology, Karlsruhe Institute of Technology, Germany
  4. Institute of Biological and Chemical Systems, Karlsruhe Institute of Technology, Germany
  5. Department of Physics, University of Illinois at Urbana-Champaign, United States

Abstract

Wnt signaling plays important roles in development, homeostasis, and tumorigenesis. Mutations in β-catenin that activate Wnt signaling have been found in colorectal and hepatocellular carcinomas. However, the dynamics of wild-type and mutant forms of β-catenin are not fully understood. Here, we genome-engineered fluorescently tagged alleles of endogenous β-catenin in a colorectal cancer cell line. Wild-type and oncogenic mutant alleles were tagged with different fluorescent proteins, enabling the analysis of both variants in the same cell. We analyzed the properties of both β-catenin alleles using immunoprecipitation, immunofluorescence, and fluorescence correlation spectroscopy approaches, revealing distinctly different biophysical properties. In addition, activation of Wnt signaling by treatment with a GSK3β inhibitor or a truncating APC mutation modulated the wild-type allele to mimic the properties of the mutant β-catenin allele. The one-step tagging strategy demonstrates how genome engineering can be employed for the parallel functional analysis of different genetic variants.

Editor's evaluation

The authors describe a fluorescent tagging strategy that allows them to knock in one copy each of differently tagged wild-type and a non-destructible β-catenin mutant, so that the behavior of the mutant can be directly compared to the wild-type protein under different activities of the β-catenin destruction complex. The differential tagging of a wild-type and mutant Wnt components offers the opportunity to compare directly their properties in a living cell, and the approach is likely to be useful for future mechanistic investigations by the Wnt and cancer communities.

https://doi.org/10.7554/eLife.64498.sa0

Introduction

Wnt signaling pathways play fundamental roles in many biological processes in development, stem cell maintenance, and disease (Clevers and Nusse, 2012; Zhan et al., 2017). A key regulator of “canonical” Wnt signaling is β-catenin (CTNNB1). When Wnt signaling is inactive, β-catenin forms part of the destruction complex, which consists of adenomatous polyposis coli (APC), axis inhibition protein 1 (Axin1) (Li et al., 2012), casein kinase 1α (CK1α), and glycogen synthase kinase 3β (GSK3β). In the destruction complex, β-catenin is N-terminally phosphorylated at Ser45 by CK1 kinase (Hagen and Vidal-Puig, 2002) and then sequentially phosphorylated at residues Ser33, Ser37, and Thr41 by GSK3β (Liu et al., 2002). Subsequently, phospho-β-catenin is targeted to proteasomal degradation by the SCFßTrCP E3-ligase complex (Wu et al., 2003).

Wnt signaling is activated when Wnt ligands bind to seven-pass transmembrane receptors of the Frizzled (Fzd) protein family and the transmembrane LRP5/6 (low-density lipoprotein receptor-related protein) co-receptor (Bilic et al., 2007; Cong et al., 2004). Fzd proteins then recruit the cytosolic adaptor protein Dishevelled (Dvl) to the cell membrane via its DEP domain, leading to polymerization of Dvl (Schwarz-Romond et al., 2007). Dvl facilitates membrane recruitment of Axin1 by a DIX-DIX domain heterotypic interaction (Cliffe et al., 2003), which in turn stimulates GSK3β- and CK1α-mediated phosphorylation of the LRP5/6 cytosolic tail in its five PPPSPxS motifs and its binding to LRP5/6 (Stamos et al., 2014). As a consequence, the destruction complex disassembles, β-catenin is no longer degraded and translocates into the nucleus. In the nucleus, β-catenin interacts with the T cell factor (TCF)/lymphoid enhancer-binding factor (LEF) family of transcription factors and activates target genes in a cell-type-dependent manner. In addition to its role in Wnt signaling, β-catenin is also found at cell-cell adherens junctions (AJs) mediating the interactions between the cytoplasmic domain of cadherins and the actin cytoskeleton (Aberle et al., 1994; Hoschuetzky et al., 1994; Huber and Weis, 2001).

The human β-catenin protein consists of 781 amino acids and contains three distinct structural domains. Crystal structure and NMR analysis of β-catenin have revealed that both N- and C-terminal domains are structurally flexible, whereas the central armadillo repeat has a rather rigid scaffold structure (Huber et al., 1997; Orsulic and Peifer, 1996; Xing et al., 2008). The N-terminus is crucial for its stability and for cell adhesion by interacting with α-catenin. This region also contains evolutionarily conserved serine and tyrosine residues (Valenta et al., 2012). Dysregulation of Wnt signaling components is associated with a variety of human diseases, ranging from growth-related pathologies to cancer (Clevers and Nusse, 2012; Zhan et al., 2017); however, overactive Wnt signaling has been difficult to target pharmacologically (Zhong and Virshup, 2020).

Mutations in CTNNB1/β-catenin in colorectal cancer are typically found in its N-terminal domain, particularly in exon 3 that carries multiple phosphorylation sites for CK1 and GSK3β, including amino acids Ser33, Ser37, Thr41, and Ser45 (Cancer Genome Atlas Network, 2012; Dar et al., 2017; Jamieson et al., 2011). Mutations or deletions of these sites, often in only one allele, prevent phosphorylation of β-catenin, leading to its accumulation and subsequent activation of Wnt pathway target genes. However, the biochemical and biophysical properties of different β-catenin alleles in their endogenous loci have remained largely unknown.

To functionally analyze proteins, the introduction of small immune epitopes or fluorescent tags in-frame of the genomic locus enables their visualization and quantitative biophysical analysis. In this study, we aimed to examine the behavior of wild-type and a mutant oncogenic β-catenin. We made use of the colon cancer cell line HCT116, which harbors one wild-type and one mutant ∆Ser45 β-catenin allele, to generate endogenously tagged β-catenin by CRISPR/Cas9 genome editing. We engineered an HCT116 clone with mClover-tagged wild-type β-catenin and mCherry-tagged mutant β-catenin. Tagging wild-type and mutant β-catenin in the same cell provided an opportunity to compare the function and behavior of both proteins in parallel in the same sample. Our results indicate that wild-type and mutant β-catenin exist in two separate pools differing in their physical properties. Moreover, treatment with a GSK3β inhibitor or introduction of a truncating mutation of APC changed the physical properties of wild-type β-catenin, phenocopying the ∆Ser45 mutant isoform.

Results

A strategy to generate endogenously tagged fluorescent β-catenin isoforms

Previously, the dynamics and biochemical properties of β-catenin in cells were investigated by using transiently or stably overexpressed fluorescent fusion proteins (Giannini et al., 2000; Jamieson et al., 2011; Kafri et al., 2016; Krieghoff et al., 2006). To study wild-type and mutant β-catenin at physiological expression levels, we utilized the diploid colon cancer cell line HCT116 that harbors both a wild-type and a ∆Ser45 mutant allele. This in-frame ∆Ser45 deletion results in a loss of phosphorylation at this position, leading to the stabilization of β-catenin and constant activation of Wnt downstream targets (Hagen and Vidal-Puig, 2002).

To generate endogenously tagged β-catenin, we applied a gene replacement strategy using CRISPR/Cas9 editing (Mali et al., 2013; Ran et al., 2013; Yang et al., 2014) to introduce different fluorescent tags in the two alleles of the β-catenin locus of HCT116 cells in one step (Figure 1, Figure 1—figure supplement 1A). To this end, we identified a suitable sgRNA sequence for targeting the C-terminal region of β-catenin. This target site was chosen because it has previously been shown that C-terminal tagging did not affect β-catenin function in overexpression experiments (Giannini et al., 2000; Jamieson et al., 2011; Kafri et al., 2016; Krieghoff et al., 2006). Then, two donor templates with 180 bp homology arms were designed close to the sgRNA PAM sequence (Elliott et al., 1998; Natsume et al., 2016) encoding two different fluorophores. We chose mClover3 and mCherry2 for their favorable biophysical properties such as spectral absorbance, brightness, photostability, and maturation time (Bajar et al., 2016; Shen et al., 2017; Thorn, 2017). In the following, for the sake of brevity, we will refer to these two fluorescent proteins as Clover and Cherry, respectively. Moreover, FLAG and V5-tags were integrated between the C-terminal domain of β-catenin and the flexible GS linker to enable biochemical experiments. To avoid steric hindrance of the different domains, a flexible GS linker consisting of three repeats of glycine and serine residues, (Gly-Gly-Gly-Gly-Ser)3, was inserted between the FLAG/V5 tags and the fluorescent proteins (Trinh et al., 2004; Figure 1, Figure 1—figure supplement 1A). Gene resistance cassettes flanked by loxP sites were also introduced after the fluorescent proteins for selection of edited cells after homology-directed repair (HDR) (Smirnikhina et al., 2019). Selection cassettes encoded for antibiotic resistance to hygromycin and blasticidin on the Clover and Cherry donor templates, respectively (Figure 1—figure supplement 1A). The loxP sites were included to allow resistance cassette removal upon expression of Cre recombinase.

Figure 1 with 4 supplements see all
Strategy and workflow for bi-allelic fluorescent tagging of β-catenin in colon cancer cells.

(Left panels) Schematic representation of CTNNB1/β-catenin tagging strategy, the CTNNB1/β-catenin locus and tagged β-catenin proteins. (Right panels) Workflow for the generation of endogenously tagged β-catenin in HCT116 colorectal cancer cells. See also Figure 1—figure supplement 1A for more details. bp, base pair; HA, homology arm; kDa, kilo Dalton; sgRNA, single guide RNA; UTR, untranslated region.

Generation and characterization of β-catenin tagged cells

To generate cell lines with endogenously allele-specific tagged β-catenin, we transfected HCT116 cells with plasmids encoding for both the sgRNA targeting β-catenin (sgCTNNB1) and Cas9 protein from Streptococcus pyogenes (Mali et al., 2013) and the donor template encoding either V5-mCherry BRS (blasticidinS) or FLAG-mClover HygR (hygromycin resistance) (Figure 1, Figure 1—figure supplement 1A). Transfected HCT116 cells were first selected with puromycin for 48 hr and subsequently with blasticidin/hygromycin for 5 days. Pooled edited cells were analyzed and sorted into single-cell clones by fluorescence-activated cell sorting (FACS) (Figure 1, Figure 1—figure supplement 1B). Infrequent fluorophore expression was observed, regardless of whether a single donor template was used (1.4% of Cherry- and 17.3% of Clover-labeled cells) or both donors were co-transfected simultaneously (0.9% of only Cherry-, 7.4% of only Clover-, and 0.1% of double-labeled cells) (Figure 1—figure supplement 1B).

In total, 44 single-cell clones were sorted by FACS and expanded for further characterization, which included double-positive and single-positive cells (Figure 1—figure supplement 1C). All 44 clones were analyzed by allele-specific PCR and most of them were sequenced from the 5′ junction of the integration cassette. Only one single clone (#37) appeared to have the correct insertion of both fluorophores in the β-catenin/CTNNB1 locus. In addition, 7 clones showed a heterozygous integration of the Cherry fluorophore in the β-catenin/CTNNB1 locus, and 24 clones were heterozygous for the Clover fluorophore-tagged allele. Moreover, six clones had an insertion of the donor cassette after the stop codon of β-catenin/CTNNB1. Two isogenic cell lines had partial integration of the Clover tag and four clones were wild-type indicating no editing events in the CTNNB1 locus (Figure 1—figure supplement 1C). Presumably, they were selected due to random integration or high background autofluorescence of these clones.

In the following, we focus on clones #24, #33, #37, and #45, as they were found to represent different integration events. To confirm the editing events, genomic DNA, mRNA, and protein lysates were analyzed and compared to the parental HCT116 (β-cateninWT/∆45) cell line and to an HCT116 isogenic cell line in which the ∆Ser45 allele was removed (β-cateninWT+/−) (Chan et al., 2002). To analyze them in depth, we used primers annealing upstream and downstream of the fluorophore tags (primers (a) in Figure 1—figure supplement 2A). While PCR amplicons of successfully tagged CTNNB1/β-catenin alleles are expected to be more than 3 kb in length, amplicons from the untagged locus would be approximately 1.2 kb. PCR from genomic DNA from clone #37 resulted in a single band of 3 kb, indicating that both alleles of CTNNB1 were edited. In contrast, genotyping of clones #33, #45, and #24 resulted in 3 kb and 1.2 kb amplicons, suggesting that only a single donor integrated in one allele (Figure 1—figure supplement 2A). Since genotyping with primers annealing within the donor construct cannot distinguish between homology-mediated integration at the target locus and non-targeted integration elsewhere in the genome, we next performed genotyping PCRs with one primer annealing in the CTNNB1 locus and the other one inside the integration cassette (Figure 1—figure supplement 2A). Separate PCRs were done for the 5′ and 3′ junction of the integration cassette; each confirmed correct integration at the target locus in all four clones. We also used primers that anneal selectively to either the Cherry or Clover donor construct or can be used to distinguish between these two donors by the size of their resistance gene (primers (b), (b’), (c), (e), and (e’) in Figure 1—figure supplement 2A). These PCRs revealed that clones #33, #37, and #24 harbor the Clover tag, while clones #37 and #45 have the Cherry tag integrated at the CTNNB1 locus (Figure 1—figure supplement 2A). Finally, we performed PCR with a primer pair annealing at either side of the donor cassette, with the resulting amplicon spanning the entire inserted exogenous sequence. PCR of genomic DNA from clone #37 gave rise to a single band of the expected size of approximately 3 kb, indicating correct insertion of the donor cassette in both alleles (Figure 1—figure supplement 2A). Taken together, these experiments indicate that single-cell clones #24 and #33 had the Clover donor construct inserted in one CTNNB1 allele, clone #45 had the Cherry tag inserted in one allele, and clone #37 had one allele tagged with Cherry and the other one tagged with Clover.

Next, we sequenced the amplicons from our genotyping PCRs (Figure 1—figure supplements 3 and 4). This revealed correct in-frame integration of the fluorophore sequences at the 3′ end of the CTNNB1/β-catenin coding sequence. We also confirmed that one CTNNB1 allele remained untagged in clones #24, #33, and #45. While the untagged allele was not altered at the sgRNA target site in clones #24 and #45, we detected a 40-bp mutation in clone #33, presumably from error-prone non-homologous end joining of a Cas9-induced double-strand break. This mutation results in four additional amino acids at the end of β-catenin. Importantly, sequencing of the bi-allelically tagged clone #37 revealed that both alleles had been modified without unintended mutations (Figure 1—figure supplements 3 and 4).

Subsequently, PCR was performed to determine which allele (wild-type or ∆Ser45) was tagged with Clover and which with Cherry using cDNA from reverse-transcribed mRNA of each isogenic cell line and specific reverse primers to Clover or Cherry. Sanger sequencing of cDNA templates revealed that both clones #37 and #45 carried the Cherry fluorophore in the ∆Ser45 allele (Figure 2A). In contrast, clones #33 and #37 harbored the Clover fluorophore in the wild-type allele, as indicated by the in-frame sequence with Ser45.

Figure 2 with 1 supplement see all
Identification and confirmation of tagged β-catenin alleles.

(A) Sanger sequencing confirms bi-allelic tagging of β-catenin. Sequencing results show clones #45 (β-cateninWT/∆45Cherry) and #37 (β-cateninWTClover/∆45Cherry) Cherry is in-frame with the mutant allele and clones #33 (β-cateninWTClover/∆45) and #37 (β-cateninWTClover/∆45Cherry) Clover is in-frame with wild-type allele (codon TCT). (B) Cell lysates of indicated HCT116 cell lines analyzed by Western blotting with a β-catenin antibody; β-actin served as a loading control. (C) HCT116 β-cateninWTClover/∆45Cherry (clone #37) immunoprecipitation with GFP, Cherry and control beads, or with a β-catenin antibody followed by immunoblotting with indicated antibodies. Representative results from three independent experiments are shown.

Figure 2—source data 1

Identification and confirmation of tagged β-catenin alleles.

(B) Cell lysates of indicated HCT116 cell lines analyzed by Western blotting with a β-catenin antibody; β-actin served as a loading control. (C) HCT116 β-cateninWTClover/∆45Cherry (clone #37) immunoprecipitation with GFP, Cherry and control beads, or with a β-catenin antibody followed by immunoblotting with indicated antibodies. Representative results from three independent experiments are shown. Figure 2—figure supplement 1: Validation of endogenously fluorescent-tagged β-catenin in HCT116 colon cancer cells. (A) HCT116 β-cateninWTClover/∆45Cherry (clone #37) cells express comparable amounts of β-catenin to the parental HCT116 WT cells. (B–D) Immunoprecipitation using HCT116 β-cateninWTClover/∆45 (clone #33 – left), β-cateninWT/∆45Cherry (clone #45 – middle), and β-cateninWTClover/∆45 (clone #24 – right) were performed with GFP/Cherry or control beads, followed by Western blotting with the indicated antibodies. Representative results from three independent experiments are shown.

https://cdn.elifesciences.org/articles/64498/elife-64498-fig2-data1-v1.zip

Next, total cell lysates of parental and isogenic knock-in cell lines were analyzed for β-catenin fusion proteins by Western blot (Figure 2B, Figure 2—figure supplement 1A). As shown in Figure 2B, clones #33 and #45 have one of the tagged variants of β-catenin, whereas clone #37 has two high molecular weight bands indicative of both tagged β-catenin variants. Furthermore, immunoprecipitations using either affinity beads for the Clover (GFP) and Cherry (RFP) fluorophores, or anti-β-catenin antibodies were performed and analyzed by Western blotting. GFP-immunoprecipitated lysates of clone #37 (Figure 2C), a β-catenin variant with molecular mass higher than 97 kDa was recognized by β-catenin, GFP, and Flag antibodies. By contrast, upon RFP/Cherry immunoprecipitation a band around 97 kDa was detected by β-catenin, Cherry and V5 antibodies. Pulldown with a β-catenin antibody demonstrated two different β-catenin variants that were either detected by GFP/Flag or Cherry/V5 antibodies. These results confirm the presence of two differently tagged β-catenin variants in clone #37 at the protein level. Similarly, we analyzed clones #33 and clone #45 by immunoprecipitation (Figure 2—figure supplement 1B,C). In clone #33, GFP-immunoprecipitated lysates showed a β-catenin variant higher than 97 kDa. By contrast, in clone #45 upon Cherry-immunoprecipitation β-catenin, Cherry and V5 antibodies recognized bands around 97 kDa.

Wild-type β-catenin-Clover protein runs higher than 97 kDa and it is recognized by both GFP and Flag antibodies (Figure 2B and C, Figure 2—figure supplement 1). Mutant β-catenin-Cherry protein runs around 97 kDa as a single band, as detected in the whole-cell lysate (Figure 2B and C). Upon immunoprecipitation, especially with RFP beads, several bands of mutant β-catenin-Cherry are frequently detected. To evaluate whether this is due to modifications of mutant β-catenin or due to the Cherry-tag itself, we analyzed clone #24 expressing a mutant β-catenin tagged with Clover. All three antibodies, β-catenin, GFP, and Flag, detected only one band representing the mutant β-catenin-Clover protein (Figure 2—figure supplement 1D), suggesting that the additional bands of mutant β-catenin-Cherry arise from the Cherry-tag. One possible explanation is that the mCherry protein undergoes chemical modification during sample preparation, for example, by TCEP in the loading dye (Cloin et al., 2017). Alternatively, mCherry might undergo backbone cleavage during chromophore maturation (Barondeau et al., 2006; Nienhaus et al., 2005; Wei et al., 2015). Importantly, such cleavage during maturation does not impair the fluorescence emission, as fragments remain tightly associated to form the fluorescent beta-barrel structure (Barondeau et al., 2006; Nienhaus et al., 2005).

Functional characterization of endogenously tagged β-catenin cell lines

To test whether the C-terminal fluorescent tags of β-catenin interfere with its physiological functions, we tested the novel cell lines in different assays. First, we compared cell proliferation of the clonal cell lines to the parental β-cateninWT/∆45 and the β-cateninWT+/− cell line, which only had a wild-type but not a mutant β-catenin allele. All three clones #33, #37, and #45 showed a similar growth behavior as the parental β-cateninWT/∆45 cells (Figure 3A), whereas the cell line carrying a single wild-type allele (β-cateninWT+/−) displayed impaired growth. Next, we tested the functionality and localization of the endogenously tagged β-catenin variants. We performed siRNA-mediated silencing of β-catenin and analyzed gene expression by RT-qPCR (Figure 3B, Figure 3—figure supplement 1A). We found that downregulation of β-catenin led to the reduction in fluorophore levels as well as the Wnt target gene AXIN2. Consistently, depletion of β-catenin resulted in a reduction of Cherry and Clover, as shown by immunofluorescence on the protein level (Figure 3C, Figure 3—figure supplement 1A).

Figure 3 with 1 supplement see all
Fluorescently tagged β-catenin variants are functional and localize to adherens junctions.

(A) Proliferation of the indicated HCT116 cell clones was monitored by live-cell imaging using an Incucyte instrument. (B) In HCT116 β-cateninWTClover/∆45Cherry, mRNA-levels of CTNNB1, AXIN2, Cherry, and Clover were determined by RT-qPCR in control conditions and upon depletion of CTNNB1/β-catenin by siRNA (n=5; mean ± SD). (C) Representative immunofluorescence images of HCT116 β-cateninWTClover/∆45Cherry after siRNA-mediated knockdown of CTNNB1 are shown (n=3; scale bars: 100 μm). (D) β-catenin accumulates at cell-cell junctions (arrow). Representative immunofluorescence images of HCT116 β-cateninWTClover/∆45Cherry and parental HCT116 β-cateninWT/Δ45 stained with a β-catenin antibody are shown (scale bars: 10 μm). (E) Immunoprecipitation of HCT116 clone β-cateninWTClover/∆45Cherry with E-cadherin confirms its interaction with β-catenin. Representative results from three independent experiments are shown.

Figure 3—source data 1

Fluorescently tagged β-catenin variants are functional and localize to adherens junctions.

(A) Proliferation of the indicated HCT116 cell clones was monitored by live-cell imaging using an Incucyte instrument. (B) In HCT116 β-cateninWTClover/∆45Cherry, mRNA-levels of CTNNB1, AXIN2, Cherry, and Clover were determined by RT-qPCR in control conditions and upon depletion of CTNNB1/β-catenin by siRNA (n=5; mean ± SD). Figure 3—figure supplement 1: Validation of the physiological function of fluorescently tagged β-catenin. (A) In HCT116 β-cateninWTClover/∆45 and β-cateninWT/∆45Cherry mRNA-levels of CTNNB1, AXIN2, CHERRY, and CLOVER were determined by RT-qPCR upon silencing of CTNNB1/β-catenin. Immunofluorescence analysis of HCT116 β-cateninWTClover/∆45 and β-cateninWT/∆45Cherry after siRNA-mediated knockdown of CTNNB1 is shown (n=3; mean ± SEM; scale bar: 100 μm).

https://cdn.elifesciences.org/articles/64498/elife-64498-fig3-data1-v1.xlsx
Figure 3—source data 2

Fluorescently tagged β-catenin variants are functional and localize to adherens junctions.

(E) Immunoprecipitation of HCT116 clone β-cateninWTClover/∆45Cherry with E-cadherin confirms its interaction with β-catenin. Representative results from three independent experiments are shown. Figure 3—figure supplement 1: Validation of the physiological function of fluorescently tagged β-catenin. (C) Immunoprecipitation of HCT116 β-cateninWTClover/∆45 and β-cateninWT/∆45Cherry with E-cadherin validates its interaction with β-catenin. A representative immunoblot is displayed.

https://cdn.elifesciences.org/articles/64498/elife-64498-fig3-data2-v1.zip

In addition to its functional role in Wnt signaling, β-catenin interacts with the cytoplasmic domains of E-cadherin and α-catenin to bridge the cell-adhesion complex and actin cytoskeleton inside the cells, thereby localizing it to the cell membrane (Aberle et al., 1994; Hoschuetzky et al., 1994). Immunofluorescence analysis confirmed the localization of the endogenously tagged β-catenin variants at the cell membrane as observed in the parental HCT116 cell line (Figure 3D, Figure 3—figure supplement 1B). Immunoprecipitation with an E-cadherin antibody demonstrated the interaction of β-catenin and E-cadherin in all clones (Figure 3E, Figure 3—figure supplement 1C). Taken together, these results indicate that endogenously tagging of β-catenin did neither affect its localization and adhesive function nor its ability to activate the Wnt pathway.

Wild-type and mutant β-catenin variants contribute both to canonical Wnt signaling output

We next investigated the impact of endogenously tagged β-catenin on the activation of Wnt signaling. Wnt activity was measured by TCF4/Wnt-dependent reporter assay and analyzing AXIN2 levels in the isogenic knock-in clones and parental cell line upon treatment with either the GSK3β inhibitor CHIR99021 or ICG001, an inhibitor of CBP/β-catenin interaction (Figure 4A). Upon CHIR99021 treatment, TCF4/Wnt-reporter activity was induced and AXIN2 gene expression levels were increased similarly in all isogenic cell lines. Treatment with the Wnt inhibitor ICG001 decreased Wnt reporter activity and AXIN2 expression levels in all cell lines, as expected (Figure 4A). In addition, immunofluorescence analysis demonstrated that after addition of CHIR99021, nuclear β-catenin was increased in all clones indicative of increased nuclear translocation of β-catenin upon Wnt activation (Figure 4B, Figure 4—figure supplements 1 and 2). Consistent with its mechanism of action, treatment with ICG001 did neither affect cytoplasmic nor nuclear β-catenin localization in the endogenously tagged or parental cell clones. Upon inhibition of Wnt secretion by addition of porcupine inhibitor LGK974, the signal of both, mutant as well as wild-type β-catenin allele, decreased but could be rescued by addition of recombinant Wnt3a (Figure 4C).

Figure 4 with 2 supplements see all
Tagging of β-catenin does not affect functionality in canonical Wnt signaling.

(A) Left: Scheme showing the mode of action of GSK3β inhibitor CHIR99021 and CBP inhibitor ICG-001. Right: Indicated HCT116 cell lines were treated with 10 μM CHIR99021 and 10 μM ICG-001 for 24 hr, then Wnt activity was determined by a luciferase-based TCF4/Wnt-reporter assay (upper panel) and quantification of AXIN2 mRNA-levels by RT-qPCR (n=3; mean ± SD). (B) Immunofluorescence analysis of HCT116 β-cateninWTClover/∆45Cherry after 24 hr treatment with 10 μM CHIR99021 and 10 μM ICG-001 is shown (scale bar: 10 μm). The graph on the right depicts the ratio of nuclear to cytoplasmic fluorescent signal intensity for Clover and Cherry in HCT116 β-cateninWTClover/∆45Cherry. Data from three independent experiments, each with at least 250 cells per condition, are shown as mean ± SEM. Every experiment includes at least 250 cells per condition. Enlarged representative images are shown in the Figure 4—figure supplement 2. (C) HCT116 β-cateninWTClover/∆45Cherry were treated with LGK974 for 80 hr then 200 ng/ml of recombinant Wnt3a was added for 16 hr. Intensities of the Clover or Cherry signals were measured per slide and normalized to the intensity of Hoechst staining and to the control. 10–20 slides were measured per condition in one experiment. Data of three independent experiments are shown as mean ± SEM. Each dot represents an independent experiment. WRE, Wnt responsive element. Scale bar: 10 μm.

Figure 4—source data 1

Tagging of β-catenin does not affect functionality in canonical Wnt signaling.

(A) Left: Scheme showing the mode of action of GSK3β inhibitor CHIR99021 and CBP inhibitor ICG-001. Right: Indicated HCT116 cell lines were treated with 10 μM CHIR99021 and 10 μM ICG-001 for 24 hr, then Wnt activity was determined by a luciferase-based TCF4/Wnt-reporter assay (upper panel) and quantification of AXIN2 mRNA-levels by RT-qPCR (n=3; mean ± SD). (B) Immunofluorescence analysis of HCT116 β-cateninWTClover/∆45Cherry after 24 hr treatment with 10 μM CHIR99021 and 10 μM ICG-001 is shown (scale bar: 10 μm). The graph on the right depicts the ratio of nuclear to cytoplasmic fluorescent signal intensity for Clover and Cherry in HCT116 β-cateninWTClover/∆45Cherry. Data from three independent experiments, each with at least 250 cells per condition, are shown as mean ± SEM. Every experiment includes at least 250 cells per condition. Enlarged representative images are shown in the Figure 4—figure supplement 2. (C) HCT116 β-cateninWTClover/∆45Cherry were treated with LGK974 for 80 hr then 200 ng/ml of recombinant Wnt3a was added for 16 hr. Intensities of the Clover or Cherry signals were measured per slide and normalized to the intensity of Hoechst staining and to the control. 10–20 slides were measured per condition in one experiment. Data of three independent experiments are shown as mean ± SEM. Each dot represents an independent experiment. Scale bar: 10 μm. Figure 4—figure supplement 1: Tagging of β-catenin does not affect its functionality in canonical Wnt signaling. Immunofluorescence analysis of HCT116 β-cateninWTClover/∆45 and β-cateninWT/∆45Cherry after 24 hr treatment with 10 μM CHIR99021 and 10 μM ICG-001 is shown. The graphs on the right show the ratio of nuclear to cytoplasmic fluorescence intensities for Clover and Cherry in β-cateninWTClover/∆45 and β-cateninWT/∆45Cherry, respectively (n=3 and 4; mean ± SEM). WRE, Wnt responsive element. Scale bar: 10 μm.

https://cdn.elifesciences.org/articles/64498/elife-64498-fig4-data1-v1.xlsx

To analyze the impact of both wild-type and mutant variants on Wnt signaling, we performed knockdown experiments with siRNAs targeting either Cherry or Clover, thereby depleting either mutant or wild-type β-catenin alleles. Silencing of either Clover or Cherry in clone #37 reduced β-catenin and AXIN2 expression levels in a similar manner, whereas combined knockdown of both had an additive effect comparable to siRNA β-catenin/CTNNB1 (Figure 5A). Results of mRNA expression are in line with the immunofluorescence staining. Silencing of Cherry or Clover led to a decrease in signal intensity of the corresponding β-catenin alleles (Figure 5B, Figure 5—figure supplement 1). These results indicate that both wild-type and mutant β-catenin alleles contribute to Wnt activity. This is also consistent with previous results in HCT116 cells demonstrating that Wnt secretion is essential for maintaining Wnt activity (Voloshanenko et al., 2013).

Figure 5 with 1 supplement see all
Wild-type and mutant β-catenin both contribute to Wnt pathway activation.

(A) Expression levels of AXIN2, CTNNB1/β-catenin, Cherry, and Clover were measured 72 hr after knockdown with siRNAs directed against Clover, Cherry or both in HCT116 β-cateninWTClover/∆45Cherry (n=4, mean ± SD). (B) Immunofluorescence analysis of HCT116 β-cateninWTClover/∆45Cherry upon transfection with siRNAs targeting CTNNB1, CLOVER, CHERRY, or a combination of CLOVER and CHERRY (scale bar: 25 μm). Intensities of the Clover or Cherry signals were measured per slide and normalized to the intensity of Hoechst staining. 5–10 slides were measured per condition and are shown as dots. Representative one from four independent experiments (Figure 5—figure supplement 1) is shown.

Figure 5—source data 1

Wild-type and mutant β-catenin both contribute to Wnt pathway activation.

(A) Expression levels of AXIN2, CTNNB1/β-catenin, Cherry, and Clover were measured 72 hr after knockdown with siRNAs directed against Clover, Cherry, or both in HCT116 β-cateninWTClover/∆45Cherry (n=4, mean ± SD). (B) Immunofluorescence analysis of HCT116 β-cateninWTClover/∆45Cherry upon transfection with siRNAs targeting CTNNB1, CLOVER, CHERRY, or a combination of CLOVER and CHERRY (scale bar: 25 μm). Intensities of the Clover or Cherry signals were measured per slide and normalized to the intensity of Hoechst staining. 5–10 slides were measured per condition and are shown as dots. Representative one from four independent experiments (Figure 5—figure supplement 1) is shown. Figure 5—figure supplement 1: Immunofluorescence analysis of HCT116 β-cateninWTClover/∆45Cherry upon transfection with siRNAs targeting CTNNB1, CLOVER, CHERRY, or a combination of CLOVER and CHERRY. Representative images from Figure 5. Scale bar: 25 μm. Immunofluorescence analysis of HCT116 β-cateninWTClover/∆45Cherry upon transfection with siRNAs targeting CTNNB1, CLOVER, CHERRY, or a combination of CLOVER and CHERRY (scale bar: 25 μm). Intensity of Clover or Cherry signal was measured per slide and normalized to the intensity of Hoechst staining and then normalized to control. 5–10 slides per condition were measured. Data of four independent experiments are shown as mean ± SEM. Each dot represents an independent experiment.

https://cdn.elifesciences.org/articles/64498/elife-64498-fig5-data1-v1.xlsx

Fluorescence correlation spectroscopy reveals differences in the dynamics of wild-type and mutant β-catenin

Fluorescence correlation spectroscopy (FCS) is a powerful quantitative microscopy method for measuring local concentrations and diffusional mobilities of fluorescent molecules in cells and tissues, for example, to determine Wnt ligand-receptor interactions in the cell membrane (Eckert et al., 2020). To simultaneously monitor the dynamics of wild-type Clover-tagged and mutant Cherry-tagged β-catenin of HCT116 cells clone #37, we used FCS with detection in two color channels. With this method, we recorded the fluorescence intensity emanating from a tiny observation volume (ca. 1 fL) as a function of time. For each cell studied, two measurements were performed, with the observation volume first positioned into the cytosol and then into the nucleus. Thus, we focused on the freely diffusing β-catenin fraction, which mediates Wnt signaling, and excluded the membrane-bound fraction, which is responsible for cell-cell adhesion and has been previously shown by FRAP to tightly interact with cadherins, which markedly reduces its mobility (Krieghoff et al., 2006).

From the intensity time traces in the two color channels, autocorrelation functions were calculated and fitted with model functions (Figure 6—figure supplement 1A) to extract two parameters, the diffusional correlation time, and the correlation amplitude (Zemanová et al., 2003). The correlation time is inversely proportional to the diffusion coefficient, D, of the fluorescent molecules. For this conversion, we performed calibration FCS experiments using fluorescent dye molecules with known D values as reference samples (see Materials and methods). According to the Stokes-Einstein law, the diffusion coefficient is inversely related to the linear extension of the diffusing entity and thus to the cube root of its volume/molecular mass. Thus, measurement of D values provides size information. The correlation amplitude is inversely proportional to the average number of molecules, N, in the observation volume. The calibration experiment with dye molecules mentioned above also allows us to determine the effective volume, Veff, from which the fluorescence emanates, so that the molecule concentration, c, in the observation volume can simply be calculated as c=N/Veff. In addition to autocorrelation analysis, we calculated cross-correlation functions to identify correlated intensity fluctuations in the two color channels. These will appear if the Clover and Cherry labeled β-catenin molecules co-diffuse, that is, bind to each other and migrate in concert through the observation volume. Cross-correlation amplitudes between wild-type Clover-tagged and mutant Cherry-tagged β-catenin were always found to be zero within the experimental error, implying that these two β-catenin variants diffuse independently and do not associate to any significant degree (Figure 6—figure supplement 1A).

On the basis of FCS experiments in the cytosol of more than 40 cells, we calculated a median D value of 10.6 ± 1.8 µm² s–1 for mutant Cherry-tagged β-catenin, which is significantly smaller than the one of wild-type Clover-tagged β-catenin (D=17.3 ± 6.1 µm² s–1, Figure 6A). The ratio of diffusion coefficients indicates that mutant Cherry-tagged β-catenin diffuses as part of a larger complex, with a more than fourfold larger volume/overall mass than wild-type Clover-tagged β-catenin. For Clover and Cherry overexpressed in HCT116 cells, we measured D=43 ± 8 µm² s–1 in the cytosol. Taking this number and dividing it by the cube root of the molecular mass ratio between wild-type Clover-tagged β-catenin and Clover (120 kDa:26 kDa), we obtain an estimated D=26 ± 5 µm² s–1 for the tagged β-catenin, which is on the high end of the distribution of D values of the respective ensemble (Figure 6A). Thus, Clover-tagged β-catenin may diffuse as an individual entity or as part of a smaller complex (compared to the one that mutant Cherry-tagged β-catenin is bound to).

Figure 6 with 1 supplement see all
FCS autocorrelation analyses reveal differences in the dynamics and concentrations of wild-type and mutant β-catenin.

(A) Concentrations (left) and diffusion coefficients (right) of Clover-tagged wild-type β-catenin and Cherry-tagged mutant β-catenin in the cytosol of HCT116 β-cateninWTClover/∆45Cherry. (B) Protein concentrations (medians of the distributions shown in panel (A)). (C) Concentrations (left) and diffusion coefficients (right) of Clover-tagged wild-type β-catenin and Cherry-tagged mutant β-catenin measured on HCT116 β-cateninWTClover/∆45Cherry cells that were treated for 14–26 hr with either 10 µM CHIR99021 or DMSO as control. (D) HCT116 β-cateninwtClover/∆45Cherry cells were treated with 5 µM of LGK974 for 96 hr. Sixteen hours before termination of the experiment, 200 ng/ml of recombinant Wnt3a was added. FCS analysis was performed in the cytosol (data shown here) and in the nucleus (data shown in Figure 6—figure supplement 1). Each data point represents a 120 s FCS measurement in a single cell. In total, more than 40 cells per condition were measured in three independent experiments per box plot. p-values were calculated with the Mann-Whitney test (*** <0.001; ** <0.01; * <0.05; NS – non-significant). See also Supplementary file 1. FCS, fluorescence correlation spectroscopy.

Figure 6—source data 1

FCS autocorrelation analyses reveal differences in the dynamics and concentrations of wild-type and mutant β-catenin.

(A) Concentrations (left) and diffusion coefficients (right) of Clover-tagged wild-type β-catenin and Cherry-tagged mutant β-catenin in the cytosol of HCT116 β-cateninWTClover/∆45Cherry. (C) Concentrations (left) and diffusion coefficients (right) of Clover-tagged wild-type β-catenin and Cherry-tagged mutant β-catenin measured on HCT116 β-cateninWTClover/∆45Cherry cells that were treated for 14–26 hr with either 10 µM CHIR99021 or DMSO as control. (D) HCT116 β-cateninwtClover/∆45Cherry cells were treated with 5 µM of LGK974 for 96 hr. Sixteen hours before termination of the experiment, 200 ng/ml of recombinant Wnt3a was added. FCS analysis was performed in the cytosol (data shown here) and in the nucleus (data shown in Figure 6—figure supplement 1). Each data point represents a 120 s FCS measurement in a single cell. In total, more than 40 cells per condition were measured in three independent experiments per box plot. p-values were calculated with the Mann-Whitney test (*** <0.001; ** <0.01; * <0.05; NS – non-significant). See also Supplementary file 1. Figure 6—figure supplement 1: Cross-correlation analysis reveals that the two β-catenin protein isoforms diffuse independently. (A) Shown are representative autocorrelation curves (green, red) and the cross-correlation (blue) from 120 s FCS measurements in the cytosol and the nucleus of HCT116 β-cateninWTClover/∆45Cherry. The non-zero amplitudes of the autocorrelation curves in the green and red color channels indicate the presence of both β-catenin isoforms in the cytosol and in the nucleus. Jagged lines: experimental data, smooth lines, fits with a model function, y-axis: amplitudes of the pair correlation functions. (B) HCT116 β-cateninWTClover/∆45Cherry cells were treated with 5 µM of LGK974 for 96 hr. Sixteen hours before termination of the experiment, 200 ng/ml of recombinant Wnt3a was added. Afterward, FCS measurements were performed in the cytosol (data shown in Figure 6) and in the nucleus (shown here). For each data point, a 120 s FCS measurement was carried out in a single cell. Per box plot, more than 40 cells were examined in three independent experiments. p-values were calculated with the Mann-Whitney test (*** <0.001; ** <0.01; * <0.05; NS – non-significant) The exact values are provided as the Supplementary file 1. FCS, fluorescence correlation spectroscopy.

https://cdn.elifesciences.org/articles/64498/elife-64498-fig6-data1-v1.xlsx

From the autocorrelation amplitudes in the green and red color channels, the concentrations of wild-type Clover-tagged β-catenin and mutant Cherry-tagged β-catenin were determined as 32 ± 9 nM and 75 ± 11 nM (medians of distributions over more than 40 cells, Figure 6A and B). These data agree well with previous measurements in the RKO cell line, which revealed β-catenin concentrations of ~52 nM upon Wnt3A stimulation (Hernández et al., 2012) and in HEK293T and colon cancer cell lines (Tan et al., 2012).

Next, we were interested in whether activation of the Wnt signaling pathway had an impact on the diffusional dynamics of wild-type and mutant β-catenin. Therefore, FCS measurements were performed in the presence of the GSK3β inhibitor CHIR99021, which induces canonical Wnt signaling, as depicted in Figure 4A. Under control conditions (DMSO), wild-type β-catenin was less abundant and diffused faster than mutant β-catenin in the cytosol (Figure 6C). Interestingly, treatment with CHIR99021 changed the diffusion coefficients and concentrations of wild-type β-catenin so that they became similar to the ones of mutant β-catenin, whereas smaller effects were observed for the mutant isoform. Essentially, the same effects were obtained for both isoforms in the nuclear fraction (Figure 6C). These observations suggest that, by applying the drug, wild-type β-catenin was also incorporated into a larger complex. The increased concentration suggests that complex formation reduces the probability of β-catenin degradation. Taken together, these results indicate that GSK3β inhibition renders the concentration and diffusional dynamics of wild-type β-catenin such that they are in the range of those of the mutant isoform.

The next question which we addressed was how inhibition of Wnt secretion influences concentration and dynamics of wild-type and mutant β-catenin. To this end, HCT116 β-cateninWTClover/∆45Cherry cells were treated with the porcupine inhibitor, LGK974, for 5–6 days before FCS measurements were performed (Figure 6D, Figure 6—figure supplement 1B). Upon this treatment, the concentration of wild-type β-catenin was found to be reduced, whereas the decrease of mutant β-catenin concentration was less pronounced. These concentration changes could be rescued by addition of recombinant Wnt3a, whereas addition of recombinant Wnt3a to cells without inhibitor treatment increased the wild-type β-catenin amount only slightly (Figure 6D, Figure 6—figure supplement 1B). Inhibition of Wnt secretion also affected the diffusional dynamics of Clover-tagged wild-type β-catenin (Figure 6D, Figure 6—figure supplement 1B). Upon LGK974 treatment, the diffusivity of the Clover-tagged β-catenin fraction was two times as large as for the control, DWT,LGK=24.0 ± 2.8 µm² s−1; however, the diffusivity of the mutant Cherry-tagged β-catenin fraction did not increase (Figure 6D, Figure 6—figure supplement 1B). Additional Wnt3a treatment reversed the effect of LGK974 treatment on the diffusivity of wild-type β-catenin. The FCS analysis yielded DWT,LGK+Wnt3a=11.6 ± 2.3 µm² s−1, which is essentially identical to that of the control.

APC truncation affects the dynamics of the wild-type β-catenin isoform

APC mutations are frequently found in colorectal cancer and define the onset of the transition from adenoma to carcinoma. The complete loss of APC is very rare; truncating mutations lacking the C-terminal domain are, however, frequently observed (Cancer Genome Atlas Network, 2012; Fearnhead et al., 2001). Hence, we engineered cell lines carrying mutant truncated APC using CRISPR/Cas9 editing in the biallelically tagged HCT116 clone #37, and quantitatively assessed the impact of APC truncations on wild-type and mutant β-catenin protein in the same cell.

A sgRNA (sgAPCb) was designed by E-CRISP to target the mutation cluster region (MCR) in exon 15 of APC (Heigwer et al., 2014; Zhan et al., 2019), introducing a premature stop codon (Figure 7A). Edited single-cell clone was verified by amplicon sequencing confirming the homozygous APC mutation (Figure 7A). Subsequently, FCS measurements were performed to study the cytosolic and nuclear fractions of both parental HCT116 β-cateninWTClover/∆45Cherry and HCT116 β-cateninWTClover/∆45Cherry APCLOF (sgAPC) cells. In the cytosol (Figure 7B) and in the nucleus (Figure 7—figure supplement 1A) of APCLOF cells, the concentration and diffusional dynamics of wild-type β-catenin were different in comparison to cells with wild-type APC.

Figure 7 with 1 supplement see all
Truncation of APC affects abundance and diffusional dynamics of wild-type but not mutant β-catenin in the cytosol.

(A) Schematic representation of the APC locus and target site of sgACP in the mutation cluster region (MCR) domain. (B) Concentrations (left) and diffusion coefficients (right) of Clover-tagged wild-type β-catenin and Cherry-tagged mutant β-catenin in the cytosol of HCT116 β-cateninWTClover/∆45Cherry and sgAPC targeted clone (APCLOF) cells that were treated for ~16 hr with either 10 µM CHIR9901 or DMSO as control. Subsequently, FCS measurements were performed in the cytosol (data shown here) and in the nucleus (data shown in Figure 7—figure supplement 1A). Each data point in the box plots represents a result from a 120 s FCS measurement in a single cell. Per box plot, more than 40 cells were investigated in three independent experiments. p-values were calculated with the Mann-Whitney test (*** <0.001; ** <0.01; * <0.05; NS – non-significant). The exact values are provided in the Supplementary file 1. FCS, fluorescence correlation spectroscopy.

Figure 7—source data 1

Truncation of APC affects abundance and diffusional dynamics of wild-type but not mutant β-catenin in the cytosol.

(B) HCT116 β-cateninWTClover/∆45Cherry and sgAPC targeted clone (APCLOF) cells were treated for ~16 hr with either 10 µM CHIR9901 or DMSO as control. Subsequently, FCS measurements were performed in the cytosol (data shown here) and in the nucleus (data shown in Figure 7—figure supplement 1A). Each data point in the box plots represents a result from a 120 s FCS measurement in a single cell. Per box plot, more than 40 cells were investigated in three independent experiments. p-values were calculated with the Mann-Whitney test (*** <0.001; ** <0.01; * <0.05; NS – non-significant). The exact values are provided in the Supplementary file 1. Figure 7—figure supplement 1: Truncation of APC affects abundance and diffusion of wild-type but not mutant β-catenin in the nucleus. (A) HCT116 β-cateninWTClover/∆45Cherry and sgAPC targeted clone (APCLOF) cells were treated for ~16 hr with either 10 µM CHIR9901 or DMSO as control. Afterward, FCS measurements were performed in the cytosol (data shown in Figure 7) and in the nucleus (shown here). For each data point, a 120 s FCS measurement was carried out in a single cell. Per box plot, more than 40 cells were examined in three independent experiments. p-values were calculated with the Mann-Whitney test (*** <0.001; ** <0.01; * <0.05; NS – non-significant). The exact values are provided as the Supplementary file 1. FCS, fluorescence correlation spectroscopy.

https://cdn.elifesciences.org/articles/64498/elife-64498-fig7-data1-v1.xlsx
Figure 7—source data 2

Truncation of APC affects abundance and diffusion of wild-type but not mutant β-catenin in the nucleus.

Figure 7—figure supplement 1: (B) Both β-catenin alleles of HCT116 cells bind to APC, GSK3β, and Axin1. IP with anti-APC antibody was performed GFP/Clover and Cherry were detected (left panel). IPs with RFP/Cherry and GFP/Clover beads were performed and β-catenin, Axin1, and GSK3β were detected (right panel). Representative experiments from three independent are shown.

https://cdn.elifesciences.org/articles/64498/elife-64498-fig7-data2-v1.zip

To investigate whether mutant β-catenin can still be found in the destruction complex, we performed immunoprecipitations with an APC antibody and with GFP/Clover and RFP/Cherry beads. Both wild-type β-catenin-Clover and mutant β-catenin-Cherry bind to APC, Axin1, and GSK3β (Figure 7—figure supplement 1B), indicating that both isoforms are part of the destruction complex. Both alleles of β-catenin can be regulated by the destruction complex but the level of regulation is different. Mutant β-catenin shows slight regulation upon inhibition of GSK3β or truncation of APC while the wild-type allele is more sensitive to these perturbations.

Discussion

How disease-causing genetic alleles affect protein function has remained a subject of intense research (Sahni et al., 2015). Mutations in β-catenin that activate the Wnt pathway occur in about 5% of colorectal and more than 25% of liver and uterine tumors (Hoadley et al., 2018; Sanchez-Vega et al., 2018). Nevertheless, the investigation of its biochemical properties has been hampered by the lack of suitable tools to study its function at a physiological level. Advances in genome editing methods such as CRISPR/Cas9 enable the modification of endogenous loci and the manipulations of genes for applications such as endogenous tagging of genes (Cong et al., 2013; Dambournet et al., 2014; Mali et al., 2013). Here, we generated genome engineered cell lines to simultaneously analyze wild-type and oncogenic mutant alleles of β-catenin. Using CRISPR/Cas9, we generated a bi-allelic endogenously tagged β-catenin cell model carrying Clover-tagged wild-type and Cherry-tagged mutant β-catenin. Recent reports described several approaches to increase the editing efficiency (Lackner et al., 2015; Martin et al., 2019; Yang et al., 2014). Based on these reports, we designed our two donor templates with 180 bp homology arms for the insert of around 3 kbp. Surprisingly, the efficiency of integration of the two donor templates was different, with Clover having about a 12-fold better integration efficiency than Cherry (Figure 1—figure supplement 1B). This might indicate that the efficiency of HDR depends not only on homology arms but also on the integrated sequence.

While tagging of proteins can interfere with protein functions, it can also lead to the accumulation of the protein and its potential overactivation. In line with our study, previous overexpression studies showed that C-terminal tagging of β-catenin did not affect its functions (Giannini et al., 2000; Jamieson et al., 2011; Kafri et al., 2016; Krieghoff et al., 2006; Orsulic and Peifer, 1996). We also show that all generated clonal cell lines with one or both tagged alleles had the same proliferation capacity (Figure 3A), indicating that the tag does not lead to a loss-of-function phenotype. In contrast, inactivation of β-catenin or canonical Wnt signaling in HCT116 cells has been previously shown to inhibit proliferation (Scholer-Dahirel et al., 2011; Voloshanenko et al., 2013). The region required for its adhesion function is within the central part of β-catenin and not at the C-terminus (Valenta et al., 2012; Xing et al., 2008). Therefore, the likelihood of C-terminal tagging affecting this function is rather small. Indeed, we found that β-catenin adhesive function was not affected (Figure 3D and E, Figure 3—figure supplement 1B, C). Previous studies used overexpression of fluorescently tagged β-catenin to analyze its kinetics (Jamieson et al., 2011; Kafri et al., 2016; Krieghoff et al., 2006). By contrast, here we studied the dynamics of endogenous wild-type and mutant β-catenin by leveraging genome engineering tools for endogenous tagging.

Using FCS, we analyzed mutant and wild-type proteins in the same cell. These measurements revealed that wild-type β-catenin diffuses faster than the mutant isoform in the cytoplasmic and the nuclear compartments, suggesting that wild-type protein is present as a monomer or as part of a smaller complex in the cell. In support of our data, a similar diffusion coefficient was recently determined by FCS for β-catenin endogenously tagged with monomeric SGFP2 in HAP1 cells (de Man et al., 2021). It appears that the mutant form of β-catenin binds more tightly to the destruction complex, resulting in slower diffusion in the cytoplasm. Consistent with this hypothesis, we found that the mutant protein physically interacts with APC, Axin, and GSK3β (Figure 7—figure supplement 1). Previous reports indicated that β-catenin mutants with deletion or mutation of Ser 45 retain signaling activity and are still responsive toward Wnt activation (Chan et al., 2002; Parker et al., 2020). We also found that mutant β-catenin is present at higher concentrations and diffuses more slowly than wild-type protein in the nucleus, suggesting increased nuclear import and binding to other proteins and DNA to form larger complexes.

Activation of Wnt signaling by inhibition of GSK3β or truncation of APC results in slower diffusion and higher abundance of wild-type β-catenin, indicating that β-catenin now becomes part of larger multi-protein complexes. This might—at least in part—be due to enhanced shuttling into the nucleus, where β-catenin interacts with the Wnt enhanceosome, a large transcriptional complex including TCF/LEF, PYGO, BCL9, and other proteins to activate transcription of Wnt target genes (Fiedler et al., 2015; van Tienen et al., 2017). Along this line, FRAP analysis demonstrated that TCF4, APC, Axin, and Axin2 reduced β-catenin mobility and nucleo-cytoplasmic shuttling suggesting that these interaction partners control the subcellular localization of β-catenin by sequestering it in the respective compartment (Krieghoff et al., 2006). Accordingly, Goentoro and Kirschner, 2009 demonstrated that structural changes of β-catenin rather than molecule numbers regulate Wnt signaling (Goentoro and Kirschner, 2009). Furthermore, a recent FCS-based study in HAP1 cells showed that Wnt pathway activation regulates the distribution of free β-catenin and β-catenin bound in multi-protein complexes between nucleus and cytosol by modulating β-catenin destruction, shuttling between cytoplasm and nucleus, and nuclear retention (de Man et al., 2021).

In the present work, we have used FCS to quantify the concentration and diffusional mobility of β-catenin in the nuclear and cytosolic compartments for the first time. The observed small diffusion coefficients indicate that β-catenin migrates as part of multi-protein complexes. Unraveling the protein composition of these complexes will require dual- or multicolor FCS experiments, which allow us to analyze co-diffusion of proteins via cross-correlation analysis (Eckert et al., 2020). Furthermore, we have performed FCS experiments at single locations within subcellular compartments. In the future, we will also adopt fluorescence microscopy-based fluctuation spectroscopy techniques for the analysis of intracellular protein dynamics in a spatially resolved fashion (Tetin, 2013). While these techniques are frequently used with conventional, diffraction-limited microscopy, super-resolution variants have also become available (Hedde et al., 2013; Gao et al., 2017).

β-catenin plays an important role not only in Wnt signaling but also in cell adhesion, in which it links the adhesion complex to the actin cytoskeleton via its interaction with the actin-binding protein α-catenin (Rimm et al., 1995). Since the different functions require distinct localization, β-catenin can be found in at least two distinct pools, one at the cell membrane and one that can shuttle between the cytosol and nucleus. Whether both pools originate from a common pool or from two independent pools, and how these reservoirs regulate each other is still a matter of debate. Accordingly, it was shown that it is possible to in vivo affect one function of β-catenin without interfering with the other (Orsulic and Peifer, 1996; Valenta et al., 2012; Valenta et al., 2011). Moreover, different molecular forms of β-catenin have been described, demonstrating that most cytosolic β-catenin exists in a monomeric form, whereas dimers of α-catenin and β-catenin interacted mainly with cadherin (Gottardi and Gumbiner, 2004). Interestingly, our immunoprecipitation and FCS analyses indicate that wild-type and mutant β-catenin are found in two separate pools. We observed that β-catenin is mobile in both compartments, with mutant β-catenin being found in higher molecular weight complexes.

In summary, we engineered, to our knowledge, the first biallelically tagged cell model carrying a different fluorescent fusion protein on each allele, demonstrating the feasibility of our one-step tagging strategy to analyze the consequences of genetic variants. β-catenin knock-in cell lines provide a powerful tool for investigating β-catenin’s role in the canonical Wnt signaling, and also in adhesion. Due to these properties of β-catenin, these cell models can serve to evaluate both functions in parallel on the endogenous level. Cell models of wild-type and mutant variants can also be used for drug discovery, identifying small molecules that only interfere with mutant, but not wild-type β-catenin, thereby circumventing side effects that are often associated with interfering with homeostatic levels of Wnt signaling. In general, bi-allelic tagging of genetic variants in their endogenous locus can open new avenues toward understanding and possibly targeting disease-causing variants in a broad spectrum of cellular and organismal phenotypes.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Homo sapiens)HCT116ATCCCCL-247/CVCL_0291Human colon cancer cells
Strain, strain background (Escherichia coli)Top 10 E. coliLife Technologies GmbHC404003Chemically competent cells
OtherTransIT-LT1VWR731-0029Plasmid transfection reagent
OtherLipofectamine RNAiMaxLife technologies GmbH13778150siRNA transfection reagent
Transfected construct (human)siRNA:UBCGE HealthcareDharmacon/HorizonMU-019408-01-0002#1 GTGAAGACCCTGACTGGTA#2 AAGCAAAGATCCAGGACAA#3 GAAGATGGACGCACCCTGT#4 GTAAGACCATCACTCTCGA
Transfected construct (human)siRNA:Non targetingGE HealthcareDharmacon/HorizonD‐001810‐02UGGUUUACAUGUUGUGUGA
Transfected construct (human)siRNA:ControlAmbionS29712
Transfected construct (human)siRNA:GFPGE HealthcareDharmacon//HorizonD-001300-01-05GCAAGCTGACCCTGAAGTTC
Transfected construct (human)siRNA:CTNNB1AmbionS438CUGUUGGAUUGAUUCGAAAtt
Transfected construct (human)siRNA:CherryIDTCustom designrCrArU rGrGrC rCrArU rCrArU rCrArA rGrGrA rGrUrU rCrArU rG
AntibodyAnti-β-actin HRP, (Rabbit polyclonal)Santa Cruz BiotechnologyCat#: 47778/ RRID:AB_2714189WB (1:20,000)
AntibodyAnti-β-actin, (Rabbit polyclonal)Santa Cruz BiotechnologyCat#: 47778/ RRID:AB_2714189WB (1:40,000)
AntibodyAnti-β-catenin, (Mouse monoclonal)Dianova/Affinity BioReagentCat#: MA1-2001/ RRID:AB_326078WB (1:3000),IF (1:500)
AntibodyAnti-Cherry, (Mouse monoclonal)ClonTechCat#: 632543/ RRID:AB_2307319WB (1:1000)
AntibodyAnti-GFP, (Mouse monoclonal)InvitrogenCat#: 332600/ RRID:AB_2533111WB (1:1000)
AntibodyAnti-GFP, (Rabbit polyclonal)InvitrogenCat#: A6455/ RRID:AB_221570WB (1:1000)
AntibodyAnti-E-Cadherin, (Mouse monoclonal)BD BiosciencesCat#: 610182/ RRID:AB_397581WB (1:1000)
AntibodyAnti-V5, (Rabbit polyclonal)RocklandCat#: 600-401−378/ RRID:AB_828437WB (1:2000)
AntibodyAnti-V5, (Mouse monoclonal)Thermo Fisher ScientificCat#: 15253/ RRID:AB_10977225WB (1:1000)
AntibodyAnti-Flag, (Rabbit polyclonal)Sigma-AldrichCat#: F7425/ RRID:AB_439687WB (1:1000)
AntibodyAnti-Flag, mouse (Mouse monoclonal)Sigma-AldrichCat#: F3165/ RRID:AB_259529WB (1:1000)
AntibodyAnti-APC ALI 12–28, (Mouse monoclonal)Santa Cruz BiotechnologyCat#: sc-53165/ RRID:AB_628734WB (1:1000)
AntibodyAnti-Axin1 C76H11, (Rabbit polyclonal)Santa Cruz BiotechnologyCat#: 2087/ RRID:AB_2274550WB (1:1000)
AntibodyAnti-GSK3β D5C5Z, (Rabbit polyclonal)Cell Signaling TechnologyCat#: 12456/ RRID:AB_2636978WB (1:1000)
AntibodyNormal IgG, (Rabbit)Cell Signaling TechnologyCat#: 2729/ RRID:AB_1031062WB (1:1000)
AntibodyIgG1 K isotype control (Mouse)eBioscienceCat#: 16-4714-81/ RRID:AB_470160IP (1:1000)
AntibodyAnti-mouse IgG-HRP (Goat)Jackson ImmunoResearchCat#: 115-035-003/ RRID:AB_10015289WB (1:10,000)
AntibodyAnti-rabbit IgG-HRP (Goat)Jackson ImmunoResearchCat#: 111-035-003/ RRID:AB_2313567WB (1:10,000)
AntibodyTrue Blot ULTRA Anti-mouse IgG-HRPeBioscienceCat#: 18-8817-33/ RRID:AB_2610851WB (1:5000)
Recombinant DNA reagentpRL actin-RenillaNickles et al., 2012Renilla luciferase reporter
Recombinant DNA reagentpgl4.23 TCF4/Wnt-luciferaseDemir et al., 2013TCF4/Wnt-Firefly Luciferase reporter
Recombinant DNA reagentpx459Mali et al., 2013RRID:SCR_002037Cloning of the sgRNA
Recombinant DNA reagentpx459sgCTNNB1This paperSee Materials and methods, Figure 1—figure supplement 1– sgRNA:TGACCTGTAAATCATCCTTT
Recombinant DNA reagentpx459sgAPC#bThis studySee Materials and methods, Figure 7A sgRNA: TAGAACCAAATCCAGCAGA
Recombinant DNA reagentpSpCas9(BB)–2A-GFP (PX458)Mali et al., 2013RRID:SCR_002037Control vector
Recombinant DNA reagentpMK-RQ HA-FLAG-mClover-PGK-HygRHAThis studyDonor template, See Materials and methods, Figure 1—figure supplement 1
Recombinant DNA reagentpMK-RQ HA-V5-mCherry-PGK-BRS-HAThis studyDonor template, See Materials and methods, Figure 1—figure supplement 1
Chemical compound, drugCHIR99021Merck Millipore361571GSK-3β inhibitor
Chemical compound, drugLGK974Hölzel DiagnostikaTRC-L397640-50mgPorcupine inhibitor
Peptide, recombinant proteinMouse Wnt3aPeproTech315-20-10
OtherTriton X-100Sigma-AldrichT8787-250ml
OtherNP-40Sigma-AldrichNP40S-100ml
OtherGFP-(gta) magnetic beads/agaroseChromotecgtak-20gtma-20
OtherRFP-Trap(rta) magnetic beads/agaroseChromotecrta-20rtma-20
Commercial assay or kitBCA Protein Assay KitThermo Fisher Scientific23225
Other4–12% NuPAGE Bis-Tris gelsThermo Fisher ScientificNW04122BOX;NW00120BOX
Other3–8% NuPAGE Tris acetate gelsThermo Fisher ScientificEA03752BOX
OtherNitrocellulose membranesGE HealthcareGE10600002
Commercial assay or kitIn-Fusion HD CloningTakara639650
OtherDynabeads Protein G magnetic beadsThermo Fisher Scientific10004D
OtherECL reagentMerck MilliporeWBKLS0100
OtherECL reagentBiozolDiagnosticaMBL-JM-K820-500
OtherHyperfilm ECL; 18×24 cm2Amersham/GE HealthcareGE28-9068-36
OtherPuromycinSigma-AldrichP9620
OtherHygromycinGibco/Thermo Fisher Scientific10687010
OtherBlasticidinLife Technologies GmbHR21001
Commercial assay or kitDNeasy Blood & Tissue KitQIAGEN69504
Commercial assay or kitRevertAid H Minus First Strand cDNA Synthesis KitThermo Fisher Scientific/VWRK1632
Commercial assay or kitQIAfilter Plasmid Maxi KitQIAGEN12263
Commercial assay or kitQiagen RNeasy Mini KitQIAGEN12571
OtherMcCoyLife Technologies GmbH26600080
Commercial assay or kitLight Cycler 480 Probes Master Mix QPCRRoche4887301001
OtherQ5 Hot Start High-Fidelity DNA PolymeraseNew England BiolabsM0493S
OtherdNTP Set 100 mMVWR/Fermentas/Thermo Fisher ScientificR0182
Commercial assay or kitLight Cycler 480 Probes Master Mix QPCRRoche4887301001
OtherPFA/ paraformaldehydeVWR43,368.9 L
Other4% paraformaldehyde in PBSSanta Cruz Biotechnologysc-281692
OtherVectashieldDAPI solutionBiozol DiagnosticaC-H-1200
OtherHoechst 33342; trihydrochloride; trihydrateLife Technologies GmbHH1399
OtherBSAGerbu5010500
OtherPBSSigma-AldrichP3813-10PAK
OtherGoat serumCell Signaling Technology5425S
OtherMicroscope slides 76×26 mm2Carl Roth GmbHH868.1
Otherµ-Slide eight wellIbidi80826
Sequence-based reagentUniversal probe library #011Roche/Sigma-Aldrich4685105001
Sequence-based reagentUniversal probe library #148Roche/Sigma-Aldrich04685148001
Sequence-based reagentUniversal probe library #152Roche/Sigma-Aldrich4694384001
Sequence-based reagentUniversal probe library #088Roche/Sigma-Aldrich4689135001
Sequence-based reagentUniversal probe library #060Roche/Sigma-Aldrich4688589001
Sequence-based reagentUniversal probe library #021Roche/Sigma-Aldrich4686942001
Sequence-based reagentsgRNA used for targeting CTNNB1 (px459sgCTNNB1)This paperTGACCTGTAAATCATCCTTT
Sequence-based reagentsgRNA used for targeting APC(px459sgAPC#b)This paperTAGAACCAAATCCAGCAGA
Software, algorithmAdobe Photoshop CS6AdobeRRID:SCR_014199
Software, algorithmAdobe Illustrator CS6AdobeRRID:SCR_010279
Software, algorithmAdobe Affinity DesignerAdobeRRID:SCR_016952
Software, algorithmFijiPRID:SCR_002285
Software, algorithmImageJRRID:SCR_003070
Software, algorithmBiorenderRRID:SCR_018361
Software, algorithmOriginProRRID:SCR_014212
Software, algorithmMATLABRRID:SCR_013499
OtherFibronectinSigma-AldrichF1141-5MG
OtherDPBSGibco (ThermoFisher Scientific)14190-144
Other8-well Nunc Lab-Tek chambered cover glassThermo Fisher Scientific155411 (#1)
OtherMcCoy’s 5A - w/ L-Gln, w/o Phenol RedMcCoy’s 5AMedium w/ L-Glutamine w/o Phenol red and Sodium bicarbonateGE Lifesciences/HyClone (Thermo Fisher Scientific)HIMEDIA (NeoLab)SH30270.01/10358633AT179-5LSodiumbicar-bonate was added before sterile filtration
OtherAlexa 488Thermo Fisher Scientific10266262Reference dye
OtherAlexa 546Thermo Fisher Scientific10534783Reference dye
OtherXfectTakara ClonTech631318Transfection reagent
Sequence-based reagentsPrimers (Supplementary files 5 and 6)EurofinsSee Supplementary files 5 and 6

Cell Culture

Request a detailed protocol

The parental colon cancer HCT116 (β-cateninWT/∆45) cell line was purchased from the American Type Culture Collection. HCT116 β-cateninWT+/− cells were obtained from Horizon Discovery. Cells were culture in McCoy’s medium (Gibco) supplemented with 10% fetal bovine serum (Biochrom GmbH). Cells were grown at 37°C and 10% CO2 in a humidified atmosphere. Cells were tested for cross-contamination using SNP profiling by a Multiplex human Cell Authentication (MCA) assay (Multiplexion) and regularly checked for Mycoplasma contamination.

Transfection

Request a detailed protocol

Transient transfections were performed using TransIT-LT1 Transfection Reagent (731-0029; VWR) for DNA plasmids and Lipofectamine RNAiMax (Thermo Fisher Scientific) for siRNAs according to the manufacturer’s protocol. 15–25 nM Dharmacon siRNAs (Horizon Discovery) and 5–10 nM Ambion siRNAs (Thermo Fisher Scientific) were used for reverse siRNA transfection (Supplementary file 2).

Small-molecule inhibitors

Request a detailed protocol

GSK-3β inhibitor CHIR99021 (Cat. no. 361571) was obtained from Merck Millipore. ICG001 (Cat. no. Cay16257-1) was obtained from Biomol. DMSO was used as the vehicle control. LGK974 (TRC-L397640-50mg) was synthesized by Hölzel Diagnostika.

Western blot and co-immunoprecipitations assays

Request a detailed protocol

Whole-cell lysates were extracted using a buffer containing non-ionic detergents such as Triton X-100 or NP-40, supplemented with protease inhibitors (Roche). Protein concentration was determined using BCA Protein Assay Kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Samples were loaded on 4–12% NuPAGE Bis-Tris gels or 3–8% NuPAGE Tris acetate gels (Thermo Fisher Scientific) and transferred to the nitrocellulose membranes (GE Healthcare, GE10600002) following standard Western blotting procedure. Antibodies and their dilutions are listed in Supplementary file 3. Clover- and Cherry-tagged proteins were immunoprecipitated by incubation with either GFP-(gta) or RFP-Trap(rta) magnetic beads/agarose (Chromotek) for 1 hr at 4°C with rotation. For E-cadherin and β-catenin IPs extracts were incubated with control or respective antibody (Supplementary file 3) together with Dynabeads Protein G magnetic beads (Thermo Fisher Scientific) for 14–16 hr at 4°C. For signal visualization, blots were incubated with ECL reagent (WBKLS0100; Merck Millipore). Full Western blot scans are provided in the Source Data files. Adobe Photoshop was used for equal adjustment of brightness and contrast across the whole image.

sgRNA design and cloning sgRNAs sequences targeting the CTNNB1 and APC genes were designed using E-CRISP (Heigwer et al., 2014), synthesized by Eurofins and cloned into the px459 plasmid (#62988, Addgene) (Supplementary file 4), according to a previously described protocol (Mali et al., 2013). To generate donor plasmids the desired homology arm’s regions and epitope tag (either V5 or FLAG) were synthetized by Invitrogen GeneArt Gene Synthesis and cloned into the vector backbone pMK-RQ. The Clover PGK-HygR and Cherry PGK-BRS were cloned from the published vectors pMK278 (Addgene #72794) and pMK282 (Addgene #72798), respectively (Natsume et al., 2016). PCR primers are listed in Supplementary file 6.

Generation and validation of allele-specific endogenously tagged β-catenin cell lines

Request a detailed protocol

HCT116 cells were transfected with px459sgCTNNB1 and the two donor template-encoding plasmids KOZAK_FLAG_mClover3 and KOZAK_V5_mCherry2 using TransIT (731-0029; VWR) according to manufacturer’s instructions. As controls, each donor template was also transfected alone together with px459sgCTNNB1 to generate single-tagged β-catenin cells and to adjust gates for FACS sorting. After 72 hr, cells were selected with 2 µg/ml puromycin (P9620, Sigma-Aldrich). After 48 h, 100 µg/ml hygromycin 10687010 (Gibco/Thermo Fisher Scientific) and 10 µg/ml blasticidin (R21001, Life Technologies GmbH) were added to select edited cells for 5 days. Subsequently, surviving cells were sorted as single-cell clones by FACS into 96-well plates for cultivating. To validate correctly endogenously tagged β-catenin clones genotyping was performed. Genomic DNA was extracted with phenol-chloroform or with DNeasy Blood & Tissue Kit (QIAGEN, 69504). Different primer pair combinations were designed for genotyping (Supplementary file 6). Primer pair (a) binds to the endogenous β-catenin locus flanking the donor cassette indicating homo- or heterozygous integration of the donor template. Primer pairs (b), (b’), and (c) bind outside and inside the donor indicating the correct in-frame integration. Primer pair (d) binds inside the donor indicating which fluorophore was integrated. PCR products were analyzed by agarose gel electrophoresis.

TCF4/Wnt-reporter activity assay

Request a detailed protocol

To determine Wnt signaling activity, the luciferase-based dual Wnt reporter assay was performed as described previously (Demir et al., 2013). Briefly, cells were transfected with plasmids encoding the TCF4/Wnt-driven firefly luciferase and actin-promoter driven Renilla luciferase as control (Supplementary file 4). Dual-luciferase readout was performed 48 hr after transfection using Mithras LB940 plate reader (Berthold Technologies). Wnt activity was calculated by normalization of the TCF4/Wnt-luciferase values to the actin-Renilla values.

RT-qPCR

Request a detailed protocol

Total RNA from cell pellets was isolated with the RNeasy Mini Kit (QIAGEN) according to the manufacturer’s protocol. RNA was reverse-transcribed into cDNA using the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). qPCR was performed using the Universal probe library (Roche) with the LightCycler 480 (Roche) instrument according to the manufacturer’s instructions. A list of primers used in this paper for qPCR is shown in Supplementary file 5.

Immunofluorescence assays

Request a detailed protocol

Sterile coverslips (Thermo Fisher Scientific) were placed into 12-well plates and cell suspension was added. After 1 day, cells were treated with the indicated drugs for 20–24 hr. Cells were fixed using 4% PFA (VWR) for 20 min at room temperature. For antibody staining, cells were permeabilized with 0.25% Triton/phosphate-buffered saline (PBS). After several washing steps, cells were blocked for 1 hr with 5% goat serum (v/v) and 5% BSA (v/v) in PBS at room temperature. After overnight incubation with the primary antibody at 4°C, cells were incubated with fluorescently labeled secondary antibodies (1:250) for 1 hr at room temperature in the dark. Antibodies were diluted in PBS with 5% goat serum (v/v) and 5% BSA (v/v). Finally, cover slips were gently transferred onto microscope slides (Carl Roth GmbH) and fixed with Vectashield mounting media containing DAPI solution (Biozol Diagnostica). Fluorescence images were acquired with a Leica TCS SP5 confocal microscope. For live-cell imaging, cells were added into μ-slide with a glass bottom (Ibidi) and staining was performed as described. For automated microscopy, cells were seeded into 384-well plates and subjected to fixation using the CybiWell Vario robotic system. Fluorescence images were acquired using InCell Analyzer 2200 microscope (GE Healthcare) at 20× magnification in three channels (DAPI, Cy3, and FITC) with four sites per well.

For LGK974 treatment, cells were seeded into wells of a six-well plate and treated with Control/DMSO or 5 µM LGK974 for 48/72 hr, then washed several times with PBS and split into the Ibidi µ-Slide (80826) and wells of a six-well plate. After an additional treatment with LGK974/Ctrl for 32 hr, cells were stimulated with 200 ng/ml of recombinant Wnt3a for 16 hr. Cells were fixed with 4% PFA for 10 min and stained with the Hoechst solution (1:2000 in PBS) for 30 min. Fluorescence images were acquired with a Leica TCS SP8 confocal microscope. 5–20 slides per condition were taken. The fluorescence intensities of Clover, Cherry, or Hoechst were analyzed with ImageJ without any additional manipulation of the images. The Clover and Cherry intensities were normalized to Hoechst and further to control.

In the silencing experiment, CTNNB1, CLOVER, and CHERRY were downregulated by applying siRNA directly on the Ibidi µ-Slide for 72 hr. Subsequently, the staining and analysis were performed similar to the LGK974 experiment.

Image analysis

Request a detailed protocol

Image analysis of automatic microscopy was performed using R package EBImage (Pau et al., 2010) and adapted based on previous analysis methods (Carpenter et al., 2006; Fuchs et al., 2010). Nuclei and cell body were segmented and features for intensity, shape, and texture were extracted for each cell based on the DAPI, actin, and tubulin staining. Features were then summarized per experiment by mean calculation over all cells. As a proxy for cell count, the number of segmented nuclei was used. Images were assembled using Affinity Designer, Biorender, and Adobe Illustrator.

Fluorescence correlation spectroscopy

Request a detailed protocol

To prepare fibronectin-coated sample chambers, fibronectin was diluted to 50 µg ml–1 in Dulbecco’s phosphate buffered saline (DPBS, no calcium, no magnesium, Sigma-Aldrich). Each well of a eight-well Nunc Lab-Tek chambered cover glass (Thermo Fisher Scientific) was incubated with 200 µl of the solution for at least 1 hr at room temperature. Afterward, the solution was removed by aspiration, and the wells were allowed to dry. These chambers were either used immediately or stored at 4°C for a maximum of 1–2 weeks and washed with DPBS directly before use. For FCS measurements, HCT116 cells were cultured in McCoy’s medium without phenol red in the chambers. For drug treatment, the cell culture medium was replaced with a medium containing 10 µM CHIR99021 ~16‒26 hr before the FCS measurements. For LGK974 treatment, cells were seeded in six-well plates and incubated with 5 µM LGK974 for 5 days. During this period, the drug-containing medium was renewed and, if necessary, cells were split. On day 6, cells were transferred into fibronectin-coated eight-well chambered cover glass, where they were left to adhere for ~4‒6 hr before adding 100 ng ml–1 of recombinant Wnt3a. FCS measurements were started at ~16‒26 hr after Wnt treatment. All FCS measurements were carried out at 37°C and 5% CO2.

For FCS analysis, intensity time traces were acquired in two color channels for 120 s each by using a home-built confocal microscope described previously (Eckert et al., 2020). mClover3 and mCherry2 were excited with pulsed 470 nm and 561 nm laser light of typically 3 µW (1.5 kW cm−2) and 5 µW (2.8 kW cm−2), respectively. The emission was filtered by 525/50 nm and 607/37 nm (center/width) band-pass filters (BrightLine, Semrock, Rochester, NY). For data acquisition, the observation volume of the microscope was first positioned into the cytoplasm and directly afterward into the nucleus. The intensity decrease during the measurement due to photobleaching was compensated as described (Dörlich et al., 2015). Then, autocorrelation and cross-correlation functions were calculated from the time traces, and correlation amplitudes and times were extracted by fitting a model function to the correlation functions that describes free diffusion of fluorescent particles through an observation volume shaped as a three-dimensional Gaussian function (Gao et al., 2017). The correlation amplitudes of each individual cell measurement were corrected for photobleaching according to Eckert et al., 2020, and uncorrelated background according to Foo et al., 2012. For the latter correction, we measured background intensities in the cytosol and in the nucleus on ensembles of more than 15 cells of lines #45 and #33, both under control conditions (DMSO) and with drug treatment (CHIR99021). For each cell measurement, the correction factor was calculated using the median intensity of the respective ensemble. Finally, the (microscope-dependent) correlation times and corrected amplitudes were converted into (microscope-independent) diffusion coefficients and concentrations, which are reported in this work. For this conversion, we carried out careful FCS calibration experiments using solutions of organic dyes (Alexa 488 and Alexa 546, Thermo Fisher Scientific) with well-known diffusion coefficients and concentrations. Furthermore, FCS measurements of fluorescent proteins (eGFP, Clover, and Cherry) overexpressed in HCT116 wild-type cells were performed to obtain estimates of the molecular mass of the β-catenin carrying entities.

Data availability

All data generated during this study is included in the manuscript.

References

  1. Book
    1. Foo YH
    2. Korzh V
    3. Wohland T
    (2012) Fluorescence Correlation and Cross-Correlation Spectroscopy Using Fluorescent Proteins for Measurements of Biomolecular Processes in Living Organisms
    In: Jung G, editors. Fluorescent Proteins II: Application of Fluorescent Protein Technology. Berlin, Heidelberg: Springer. pp. 213–248.
    https://doi.org/10.1007/4243_2011_16

Decision letter

  1. William I Weis
    Reviewing Editor; Stanford University School of Medicine, United States
  2. Marianne E Bronner
    Senior Editor; California Institute of Technology, United States

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

Thank you for submitting your article "Allele-specific endogenous tagging and quantitative analysis of β-catenin in colorectal cancer cells" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Marianne Bronner as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed the reviews with one another and the Reviewing Editor has drafted this decision to help you prepare a revised submission.

As the editors have judged that your manuscript is of interest, but as described below that additional experiments are required before it is published, we would like to draw your attention to changes in our revision policy that we have made in response to COVID-19 (https://elifesciences.org/articles/57162). First, because many researchers have temporarily lost access to the labs, we will give authors as much time as they need to submit revised manuscripts. We are also offering, if you choose, to post the manuscript to bioRxiv (if it is not already there) along with this decision letter and a formal designation that the manuscript is "in revision at eLife". Please let us know if you would like to pursue this option. (If your work is more suitable for medRxiv, you will need to post the preprint yourself, as the mechanisms for us to do so are still in development.)

Summary:

The authors describe a fluorescent tagging strategy that allows them to knock in one copy each of differently tagged wild-type and a non-destructible β-catenin mutant, so that the behavior of the mutant can be directly compared to the wild-type protein under different activities of the β-catenin destruction complex. The differential tagging of a wild-type and mutant Wnt components offers the opportunity to compare directly their properties in a living cell, and the approach is likely to be useful for future mechanistic investigations by the Wnt and cancer communities.

Essential revisions:

The authors show that wt and mutant β-catenins both diffuse in larger complexes that differ between wt and mutant, possibly destruction complexes vs. transcriptional partners. These are interesting observations that may ultimately provide insights into the mechanism of β-catenin destruction. There is concern regarding the apparent degradation of the cherry fluorescent protein, and although the authors rationalize what is happening based on prior literature, there is no experimental validation of these ideas. Nonetheless, the ability to IP the cherry tag and the observation of fluorescence from this tagged version is consistent with their interpretation. There are, however, a number of technical issues that require attention, specifically a more rigorous validation that the targeting is correct, and better support for the conclusions regarding nuclear β-catenin translocation.

1. The genotyping is not adequate to prove both alleles have been correctly targeted in the double targeted clone.

In the case of the double targeted cells, specific genotyping is required for the 5' and 3' ends of both alleles. As the 3' genotyping only is the same primer set for both the Cherry and Clover cassettes it is possible that only one is targeted. 3' genotyping should be shown both for the Cherry and Clover alleles separately. Especially as CRISPR was used to generate these, it is quite possible the other allele has an NHEJ generated mutation which does not amplify by PCR, meaning that the positive band is derived from just one targeted allele (without amplification from the second allele) (New Figure 1—figure supplement 2 - old Figure S1c; primer pair c).

2. Some of the clones are apparently positive in the wrong genotyping reactions.

Clone 33 and 24 are supposedly heterozygous for the Clover allele but also appear to be positive for the specific Cherry allele (New Figure 1—figure supplement 2A - figure supplement 2A - Figure S1c; primer pair b). This may indicate that the clones are carrying extra integrated copies of the targeting vectors or that the clones analysed contain a mixture of cells both of which may impact the downstream analysis.

Clone 37 also has an apparent 3rd band when PCR is performed with the internal primer set (primer pair d; Figure S1c). This may indicate a duplication of the cassette at the targeted locus. This is especially important to resolve given that the data presented does not prove both alleles are correctly targeted at the 3' end.

3. Sequencing of the targeted alleles had not been done or has not been adequately detailed

There is no real description of the sequencing done on the targeting alleles. It is not uncommon for CRISPR generated alleles to have rearrangements including nucleotide changes, indels, local rearrangements and additional integrations were also frequently generated (e.g. Codner et al. BMC Biol. 2018 Jun 21;16(1):70.). Consequently it is important that these alleles should be properly characterised.

4. Although the quantification (Figure 4) shows increase in nuclear/cytoplasmic ratio of β-catenin, the images presented do not seem to support this. Can the authors present zoomed-in images of different cells to demonstrate that this is the case?

5. There seems to be more perinuclear puncta for Cherry-β-catenin in general compared to Clover-β-catenin, and they increase in the presence of CHIR99021 compared to DMSO control. The authors do not comment on this, and how it might possibly impact the quantification of the images, given that these puncta are outside the nuclear area.

6. Consistent with point #2 above, siCLOVER experiments (Figure 5) demonstrate that a pool of Cherry-β-catenin seems to localize at the perinuclear region in cells. The authors do not comment on this and also do not provide quantification of the fluorescence imaging experiments to support their conclusion.

7. How do clover-WT and Cherry-mut-β-catenin diffuse in response to treatment with exogenous Wnt ligand, given that Wnt secretion is still required for Wnt signaling activity in HCT116 cells? Is there a difference in their nuclear translocation?

8. Why is there a band corresponding to Cherry β-catenin in the western blot of clone #33 (Figure 2)? The authors do not comment on this. Also, were all lanes loaded with equivalent amounts of total protein? The β-catenin expression levels in knock-ins are clearly higher than in the parental line.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Thank you for submitting your article "Allele-specific endogenous tagging and quantitative analysis of β-catenin in colorectal cancer cells" for consideration by eLife. Your article has been reviewed by 2 peer reviewers, one of whom is a member of our Board of Reviewing Editors, and the evaluation has been overseen by Marianne Bronner as the Senior Editor. The following individual involved in review of your submission has agreed to reveal their identity: Owen J Sansom (Reviewer #3).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1. Regarding the new experiments looking at diffusion after treatment with porcupine inhibitor, which show some level of Wnt regulation of the Δ45 mutant, have the authors considered that GSK3 inhibition produced by Wnt treatment will also reduce the association of β-catenin with APC; perhaps this is the origin of their observation.

2. The discussion starting at line 430 could use some clarification. Can the authors be more specific as to what they think are the causes of the difference in diffusivity of the WT and mutant alleles? One can imagine that the mutant is bound to Axin and APC in the destruction complex and not turned over as fast as WT. The authors also mention association with transcription factors, and also cytoplasmic-nuclear shuttling of destruction complex components. Perhaps a cartoon or at least a clear delineation of the possible reasons for these behaviors would help.

3. Figure S1d is frequently referred to but is not clearly indicated. I assume it's part of S1B but not clear. These supplemental figures are also called out in the rebuttal but don't exactly correspond to what is in the manuscript. Lowercase vs. uppercase? Labeling of the individual FACS plots is needed.

https://doi.org/10.7554/eLife.64498.sa1

Author response

Essential revisions:

The authors show that wt and mutant β-catenins both diffuse in larger complexes that differ between wt and mutant, possibly destruction complexes vs. transcriptional partners. These are interesting observations that may ultimately provide insights into the mechanism of β-catenin destruction. There is concern regarding the apparent degradation of the cherry fluorescent protein, and although the authors rationalize what is happening based on prior literature, there is no experimental validation of these ideas. Nonetheless, the ability to IP the cherry tag and the observation of fluorescence from this tagged version is consistent with their interpretation. There are, however, a number of technical issues that require attention, specifically a more rigorous validation that the targeting is correct, and better support for the conclusions regarding nuclear β-catenin translocation.

1. The genotyping is not adequate to prove both alleles have been correctly targeted in the double targeted clone.

In the case of the double targeted cells, specific genotyping is required for the 5' and 3' ends of both alleles. As the 3' genotyping only is the same primer set for both the Cherry and Clover cassettes it is possible that only one is targeted. 3' genotyping should be shown both for the Cherry and Clover alleles separately. Especially as CRISPR was used to generate these, it is quite possible the other allele has an NHEJ generated mutation which does not amplify by PCR, meaning that the positive band is derived from just one targeted allele (without amplification from the second allele) (New Figure 1—figure supplement 2 - old Figure S1c; primer pair c).

To validate the correct integration of Cherry and Clover in each allele, we performed the additional experiments suggested by the reviewers (Modified Figure 1—figure supplement 2, New Figure 1—figure supplement 3,4). We now show 3’ genotyping with three different primer pairs (Modified Figure 1—figure supplement 2A primer pairs c, e, e’). While primer pair e selectively amplifies the Cherry-tagged allele and e’ selectively amplifies the Clover-tagged allele, primer set c amplifies both alleles, which can be distinguished by their size, due to the different lengths of the antibiotic resistance markers (Modified Figure 1—figure supplement 2A). All three PCRs support the correct integration of each cassette in the different clones. To make these results more accessible, we now show all primer pairs separately in Modified Figure 1—figure supplement 2A.

Furthermore, we have also performed additional genotyping of the double targeted clone 37 with primers annealing 5’ and 3’ of the integration cassettes outside of the homology arms (New Modified Figure 1—figure supplement 2B). This further supports the correct integration and does not indicate that multiple copies of the cassette are present in the target locus. Moreover, we have used the PCR amplicons spanning the modified locus for Sanger sequencing (primers are indicated in Modified Figure 1—figure supplement 2B, sequence alignments are shown in New Figure 1—figure supplement 3,4), which further supports successful gene targeting. We have revised the text to better explain these results.

Specifically, we have made the following changes to the text:

“In the following we focus on clones #24, #33, #37, #45, as they were found to represent different integration events. To confirm the editing events, genomic DNA, mRNA and protein lysates were analyzed and compared to the parental HCT116 (β-cateninWT/∆45) cell line and to an HCT116 isogenic cell line in which the ∆Ser45 allele was removed (β-cateninWT+/-) (Chan et al., 2002). First, to analyze them in depth, we used primers annealing upstream and downstream of the fluorophore tags (primers (a) in Figure 1—figure supplement 2A). While PCR amplicons of successfully tagged CTNNB1/β-catenin alleles are expected to be more than 3 kb in length, amplicons from the untagged locus would be approximately 1.2 kb. PCR from genomic DNA from clone #37 resulted in a single band of 3kb, indicating that both alleles of CTNNB1 were edited. In contrast, genotyping of clones #33, #45 and #24 resulted in 3 kb and 1.2 kb amplicons, suggesting that only a single donor integrated in one allele (Figure 1-figure supplement 2A). Since genotyping with primers annealing within the donor construct cannot distinguish between homology-mediated integration at the target locus and non-targeted integration elsewhere in the genome, we next performed genotyping PCRs with one primer annealing in the CTNNB1 locus and the other inside the integration cassette (Figure 1—figure supplement 2A) .....”

2. Some of the clones are apparently positive in the wrong genotyping reactions.

Clone 33 and 24 are supposedly heterozygous for the Clover allele but also appear to be positive for the specific Cherry allele (New Figure 1—figure supplement 2A - figure supplement 2A - Figure S1c; primer pair b). This may indicate that the clones are carrying extra integrated copies of the targeting vectors or that the clones analysed contain a mixture of cells both of which may impact the downstream analysis.

We thank the reviewers for this comment. To further verify the genotype of the indicated clones, we performed additional PCRs (New primer pairs d,e and e’ – Modified Figure 1—figure supplement 2A). These include primer sets, which distinguish the Cherry and Clover alleles by their BRS/blasticidin (Cherry, new primer set e) and HGR/hygromycin (Clover, new primer set e’) resistance genes. Clones #24 and #33 result in bands with primer pair e’, but no amplification with primer pair e, indicating that they exclusively harbor a Clover-tagged allele (Modified Figure 1—figure supplement 2A). Importantly, we also performed PCR with primer pair c, where both primers anneal inside the donor plasmid and would therefore also amplify integrations elsewhere in the genome (Modified Figure 1—figure supplement 2A). Due to the size difference of the blasticidin and hygromycin resistance genes, this PCR can differentiate between both donor templates. In clones #24 and #33, we exclusively detect a larger PCR amplicon expected from the Clover donor. Together, these assays support that clones #24 and #33 only contain a single integration of the Clover donor template in one β-catenin allele.

Clone 37 also has an apparent 3rd band when PCR is performed with the internal primer set (primer pair d; Figure 1—figure supplement 2A - old Figure S1c). This may indicate a duplication of the cassette at the targeted locus. This is especially important to resolve given that the data presented does not prove both alleles are correctly targeted at the 3' end.

As described above, we performed genotyping with a number of additional primer pairs (New primer pairs d,e and e’ - Modified Figure 1—figure supplement 2A, New Figure 1—figure supplement 2B). We would expect to detect larger bands in the case of full or partial cassette duplication by most of the primers (Modified Figure 1—figure supplement 2A, New Figure 1—figure supplement 2B). We do not detect such bands, however, indicating single copy integration of our donor sequences. Occasionally, a weak and often fuzzy DNA signal appears above the main bands, which we interpret as an unspecific amplification event or artefact of the agarose gels.

3. Sequencing of the targeted alleles had not been done or has not been adequately detailed.

There is no real description of the sequencing done on the targeting alleles. It is not uncommon for CRISPR generated alleles to have rearrangements including nucleotide changes, indels, local rearrangements and additional integrations were also frequently generated (e.g. Codner et al. BMC Biol. 2018 Jun 21;16(1):70.). Consequently it is important that these alleles should be properly characterised.

We thank the reviewers for highlighting that the sequencing results were not adequately discussed in the initial submission. We sequenced the whole set of clones and the results are summarized in the table presented as Figure S1C. As expected, we found that several clones carried mutations and/or rearrangements (Figure S1C). Sequencing also confirmed that only clone #37, which has been used for the bi-allelic comparison presented in this manuscript, harbors an integration cassette in both alleles. Importantly, extended sequence analysis of clone #37 covered both integrated regions completely and confirmed correct integration (Modified Figure 1—figure supplement 2A, New Figure 1—figure supplement 2,3,4).

4. Although the quantification (Figure 4) shows increase in nuclear/cytoplasmic ratio of β-catenin, the images presented do not seem to support this. Can the authors present zoomed-in images of different cells to demonstrate that this is the case?

To clarify this point we have added enlarged images and show them in the New Figure 4—figure supplement 2.

5. There seems to be more perinuclear puncta for Cherry-β-catenin in general compared to Clover-β-catenin, and they increase in the presence of CHIR99021 compared to DMSO control. The authors do not comment on this, and how it might possibly impact the quantification of the images, given that these puncta are outside the nuclear area.

As suggested by the reviewer, we looked specifically for perinuclear puncta of both alleles of βcatenin and detected them for both WT and mutated alleles. We did not quantify them, since this was not the focus of our study, but we did not notice a significant difference. We could detect cells without these puncta, just puncta with one color (WT or mutant allele) or yellow (WT and mutant allele together in the same puncta). Similar structures were described upon overexpression of the amino-terminal part of β-catenin by Giannini et al. (2000).

Author response image 1
Both alleles, β-cateninWTClover and β-cateninΔ45Cherry, can be located in the perinuclear puncta.

Representative immunofluorescence images of HCT116 β-cateninwtClover/Δ45Cherry cells from experiments shown in Figure 4C, 5B. Scale bar: 10 μm.

6. Consistent with point #2 above, siCLOVER experiments (Figure 5) demonstrate that a pool of Cherry-β-catenin seems to localize at the perinuclear region in cells. The authors do not comment on this and also do not provide quantification of the fluorescence imaging experiments to support their conclusion.

As suggested by the reviewer, we quantified immunofluorescence as shown in New Figure 5B, New Figure 5—figure supplement 1. Since β-catenin is difficult to detect on an endogenous level, its quantification is challenging, especially upon downregulation, and interpretation of the results is limited. New Figure 5B represents one of the four biologically independent experiments and normalized results of four independent ones are provided in New Figure 5—figure supplement 1.

7. How do clover-WT and Cherry-mut-β-catenin diffuse in response to treatment with exogenous Wnt ligand, given that Wnt secretion is still required for Wnt signaling activity in HCT116 cells? Is there a difference in their nuclear translocation?

As indicated by the reviewer, HCT116 cells express canonical Wnt ligands, resulting in strong Wnt pathway activity. Therefore, it is not surprising that no changes were detected by IF upon addition of recombinant Wnt3a (New Figure 4C). Presumably, the cells reached maximal Wnt activity even without Wnt ligand stimulation, as shown previously (Voloshanenko et al. Nature Commun 2013). Hence, to address the role of Wnt secretion, we inhibited Wnt protein secretion using the porcupine inhibitor LGK974. First, we treated HCT116 #37 cells with the porcupine inhibitor LGK974 for five to six days to inhibit endogenous Wnt ligand secretion, then added 200 ng/ml of recombinant Wnt3a to induce Wnt signaling and performed immunofluorescence analysis 16 h later. Upon inhibition of Wnt secretion from HCT116 #37 cells, we observed a strong decrease of β-catenin that was rescued upon addition of recombinant Wnt3a (New Figure 4C). Surprisingly, not only β-catenin-Clover WT protein but also β-catenin-Cherry ∆Ser45 protein was regulated by LGK974. As we saw striking differences in the signal of β-catenin, we cannot measure translocation from the cytoplasm to the nucleus of the protein.

The quantification of IF data of endogenous β-catenin especially upon signal reduction could lead to an over-interpretation of the data as the signal intensity is not linear. To confirm this result, we performed FCS measurements of β-catenin alleles after LGK794 treatment. Indeed, concentrations of both alleles of β-catenin are regulated by LGK974 treatment. β-catenin-Clover WT protein concentration in the cytoplasm is strongly dependent on Wnt secretion, for which the concentration in the cytosol was reduced from CWT,LGK = 36 ± 10 nM to CWT,LGK = 7.2 ± 2.6 nM. Additional treatment with recombinant Wnt3a raised the concentration again and almost reversed the effects of the LGK treatment (CWT,LGK+Wnt3a = 20 ± 8 nM, Cytosol). The concentration of the mutant β-catenin-Cherry decreased from CΔ45,DMSO = 101 ± 18 nM to CΔ45,LGK = 79 ± 13 nM upon LGK974 treatment and rose again to CΔ45,LGK+Wnt3a = 94 ± 22 nM by adding Wnt3a (New Figure 6D, New Figure 6—figure supplement 1B).

8. Why is there a band corresponding to Cherry β-catenin in the western blot of clone #33 (Figure 2)? The authors do not comment on this. Also, were all lanes loaded with equivalent amounts of total protein? The β-catenin expression levels in knock-ins are clearly higher than in the parental line.

To improve the presentation of Figure 2B, we now indicated the different isoforms of β-catenin in the Western blot. Regarding clone #33, the lower band corresponds to the WT allele of β-catenin indicating the heterozygosity of clone #33. β-actin serves as a loading control in Figure 2B. Since less total protein was detected in the lane of the parental cell line, this might explain the lower β-catenin levels. Comparison of qPCR (Figure 3B) and CTNNB1/β-catenin mRNA expression levels indicated no differences between parental cells and clones. To clarify this point, we made additional Western blots to compare the parental cells and clone #37 and added them as New Figure 2—figure supplement 1A.

[Editors' note: further revisions were suggested prior to acceptance, as described below.]

Essential revisions:

1. Regarding the new experiments looking at diffusion after treatment with porcupine inhibitor, which show some level of Wnt regulation of the Δ45 mutant, have the authors considered that GSK3 inhibition produced by Wnt treatment will also reduce the association of β-catenin with APC; perhaps this is the origin of their observation.

Our results indicate that the mutant form of β-catenin can also (in part) be regulated by Wnt signaling, likely involving the regulation of its interaction with APC. In line with our report, previous studies have indicated that β-catenin mutants with deletion or a mutation of Ser 45 retain signaling activity and are still responsive towards Wnt activation (PMID: 12060769 and PMID: 32751567). Together, these data suggest that, despite the absence of Ser45 phosphorylation, interactions of β-catenin with the destruction complex and its proteasomal degradation still occur. Further studies will be required to test if inhibition of GSK3 after Wnt stimulation is an essential mechanism that controls the cellular behavior of mutant β-catenin, including its interaction with APC.

2. The discussion starting at line 430 could use some clarification. Can the authors be more specific as to what they think are the causes of the difference in diffusivity of the WT and mutant alleles? One can imagine that the mutant is bound to Axin and APC in the destruction complex and not turned over as fast as WT. The authors also mention association with transcription factors, and also cytoplasmic-nuclear shuttling of destruction complex components. Perhaps a cartoon or at least a clear delineation of the possible reasons for these behaviors would help.

As suggested by the reviewers, we have rephrased and expanded this part of the discussion to indicate the different possibilities. In short, wt β-catenin protein diffuses faster than mutant β-catenin, suggesting that wt protein is present as individual molecules or as part of smaller complexes, whereas the mutant is part of larger, more slowly diffusing complexes. FCS analysis only reveals the size but not the composition of the complexes. Hence, we can only speculate about the different possibilities. For example, in the nucleus, the mutant form presumably already interacts with the Wnt enhanceosome, in the absence of stimulation. We agree with the reviewer that, in the cytoplasm, the mutant form is likely to interact with the destruction complex, but might not be turned over as fast as the wt isoform. In the revised manuscript, we discuss these possibilities in much more detail.

3. Figure S1d is frequently referred to but is not clearly indicated. I assume it's part of S1B but not clear. These supplemental figures are also called out in the rebuttal but don't exactly correspond to what is in the manuscript. Lowercase vs. uppercase? Labeling of the individual FACS plots is needed.

We would like to thank the reviewer for pointing out the inconsistency in the figure labels, which we have corrected in the revised manuscript. We have added the labeling of the FACS plots, which was accidentally removed from the Figure 1—figure supplement 1B. Now every individual plot is labeled as (i), (ii), (iii) and (iv). We have also corrected the inconsistencies in the figure labeling.

https://doi.org/10.7554/eLife.64498.sa2

Article and author information

Author details

  1. Giulia Ambrosi

    German Cancer Research Center (DKFZ), Division of Signaling and Functional Genomics and Heidelberg University, BioQuant and Medical Faculty Mannheim, Heidelberg, Germany
    Contribution
    Conceptualization, Investigation, Methodology, Visualization, Writing – original draft
    Contributed equally with
    Oksana Voloshanenko and Antonia F Eckert
    Competing interests
    No competing interests declared
  2. Oksana Voloshanenko

    German Cancer Research Center (DKFZ), Division of Signaling and Functional Genomics and Heidelberg University, BioQuant and Medical Faculty Mannheim, Heidelberg, Germany
    Contribution
    Conceptualization, Investigation, Methodology, Validation, Visualization, Writing – original draft, Writing – review and editing
    Contributed equally with
    Giulia Ambrosi and Antonia F Eckert
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0673-3278
  3. Antonia F Eckert

    Institute of Applied Physics, Karlsruhe Institute of Technology, Karlsruhe, Germany
    Contribution
    Conceptualization, Investigation, Methodology, Visualization, Writing – original draft, Writing – review and editing
    Contributed equally with
    Giulia Ambrosi and Oksana Voloshanenko
    Competing interests
    No competing interests declared
  4. Dominique Kranz

    German Cancer Research Center (DKFZ), Division of Signaling and Functional Genomics and Heidelberg University, BioQuant and Medical Faculty Mannheim, Heidelberg, Germany
    Contribution
    Investigation, Methodology, Visualization, Writing – original draft, Writing – review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-3604-7647
  5. G Ulrich Nienhaus

    1. Institute of Applied Physics, Karlsruhe Institute of Technology, Karlsruhe, Germany
    2. Institute of Nanotechnology, Karlsruhe Institute of Technology, Karlsruhe, Germany
    3. Institute of Biological and Chemical Systems, Karlsruhe Institute of Technology, Karlsruhe, Germany
    4. Department of Physics, University of Illinois at Urbana-Champaign, Urbana, United States
    Contribution
    Conceptualization, Funding acquisition, Investigation, Supervision, Writing – original draft, Writing – review and editing
    For correspondence
    uli@uiuc.edu
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5027-3192
  6. Michael Boutros

    German Cancer Research Center (DKFZ), Division of Signaling and Functional Genomics and Heidelberg University, BioQuant and Medical Faculty Mannheim, Heidelberg, Germany
    Contribution
    Conceptualization, Funding acquisition, Investigation, Supervision, Writing – original draft, Writing – review and editing
    For correspondence
    m.boutros@dkfz.de
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-9458-817X

Funding

Deutsche Forschungsgemeinschaft (SFB1324, Project number 331351713)

  • Giulia Ambrosi
  • Oksana Voloshanenko
  • Antonia Franziska Eckert
  • Dominique Kranz
  • Gerd Ulrich Nienhaus
  • Michael Boutros

Helmholtz Association (Material Systems Engineering)

  • G Ulrich Nienhaus

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

The authors are grateful to F Port, KE Boonekamp, and S Redhai for providing critical comments on the manuscript. The authors would like to acknowledge all members of the Boutros group and of the SFB1324 for helpful discussions. The authors thank F Zhang, M Waterman, and D Virshup for plasmids, which were obtained via Addgene. The authors are grateful for the support by the Excellence Cluster CellNetworks Core Facilities. Research in the labs of MB and GUN has been supported by the SFB1324 “Mechanisms and Functions of Wnt Signaling” of the German Research Foundation (DFG).

Senior Editor

  1. Marianne E Bronner, California Institute of Technology, United States

Reviewing Editor

  1. William I Weis, Stanford University School of Medicine, United States

Version history

  1. Received: October 30, 2020
  2. Accepted: December 16, 2021
  3. Version of Record published: January 11, 2022 (version 1)

Copyright

© 2022, Ambrosi et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,653
    Page views
  • 205
    Downloads
  • 2
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Giulia Ambrosi
  2. Oksana Voloshanenko
  3. Antonia F Eckert
  4. Dominique Kranz
  5. G Ulrich Nienhaus
  6. Michael Boutros
(2022)
Allele-specific endogenous tagging and quantitative analysis of β-catenin in colorectal cancer cells
eLife 11:e64498.
https://doi.org/10.7554/eLife.64498

Further reading

    1. Cell Biology
    2. Microbiology and Infectious Disease
    Heledd Davies, Hugo Belda ... Moritz Treeck
    Tools and Resources

    Reverse genetics is key to understanding protein function, but the mechanistic connection between a gene of interest and the observed phenotype is not always clear. Here we describe the use of proximity labeling using TurboID and site-specific quantification of biotinylated peptides to measure changes to the local protein environment of selected targets upon perturbation. We apply this technique, which we call PerTurboID, to understand how the P. falciparum exported kinase, FIKK4.1, regulates the function of the major virulence factor of the malaria causing parasite, PfEMP1. We generated independent TurboID fusions of 2 proteins that are predicted substrates of FIKK4.1 in a FIKK4.1 conditional KO parasite line. Comparing the abundance of site-specific biotinylated peptides between wildtype and kinase deletion lines reveals the differential accessibility of proteins to biotinylation, indicating changes to localization, protein-protein interactions, or protein structure which are mediated by FIKK4.1 activity. We further show that FIKK4.1 is likely the only FIKK kinase that controls surface levels of PfEMP1, but not other surface antigens, on the infected red blood cell under standard culture conditions. We believe PerTurboID is broadly applicable to study the impact of genetic or environmental perturbation on a selected cellular niche.

    1. Biochemistry and Chemical Biology
    2. Cell Biology
    Sevim Kahraman, Kimitaka Shibue ... Rohit N Kulkarni
    Tools and Resources

    Pancreatic a-cells secrete glucagon, an insulin counter-regulatory peptide hormone critical for the maintenance of glucose homeostasis. Investigation of the function of human a-cells remains a challenge due to the lack of cost-effective purification methods to isolate high-quality a-cells from islets. Here, we use the reaction-based probe diacetylated Zinpyr1 (DA-ZP1) to introduce a novel and simple method for enriching live a-cells from dissociated human islet cells with ~ 95% purity. The a-cells, confirmed by sorting and immunostaining for glucagon, were cultured up to 10 days to form a-pseudoislets. The a-pseudoislets could be maintained in culture without significant loss of viability, and responded to glucose challenge by secreting appropriate levels of glucagon. RNA-sequencing analyses (RNA-seq) revealed that expression levels of key a-cell identity genes were sustained in culture while some of the genes such as DLK1, GSN, SMIM24 were altered in a-pseudoislets in a time-dependent manner. In conclusion, we report a method to sort human primary a-cells with high purity that can be used for downstream analyses such as functional and transcriptional studies.