Non-canonical H3K79me2-dependent pathways promote the survival of MLL-rearranged leukemia
- Department of Molecular Genetics and Cell Biology, The University of Chicago, United States
- Pritzker School of Medicine, The University of Chicago, United States
- Department of Biochemistry and Molecular Biology, The University of Chicago, United States
Figures
Figure 1 with 1 supplement
Low doses of DOT1L inhibitor ablate bulk H3K79me2 and curtail MV4;11 proliferation without impacting expression of canonical target genes.
(A) Conventional model depicting how DOT1L methyltransferase activity activates transcription of key proliferative oncogenic transcription factors (Okada et al., 2005; Bernt et al., 2011; Guenther …
Figure 1—figure supplement 1
Low-dose DOT1L inhibition has little effect on Hox gene expression.
(A) Proliferation assay of MV4;11 cells treated with the DOT1L inhibitor SGC0946 using CellTiter-Glo 2.0 to measure viability represented as the luminescence fraction of treated over mock-treated …
Figure 2 with 1 supplement
DOT1L inhibition downregulates a subset of MLL-AF4 targets including the leukemic oncogene FLT3.
(A) MA plot showing genes differentially expressed in MV4;11 cells treated with 100 nM pinometostat or DMSO 7 days as log2-mean of expression (FPKM) of the DMSO and pinometostat-treated samples …
Figure 2—figure supplement 1
DOT1L inhibition upregulates components of the interferon gamma pathway and markers of differentiation.
(A) Gene Ontology analysis (DAVID) (Huang et al., 2009a; Huang et al., 2009b) of pinometostat-upregulated genes showing top functional classification categories and the number of genes in each …
Figure 3 with 1 supplement
Low-dose DOT1L inhibition disrupts H3K79me2 with more pronounced effects on downregulated MLL-AF4 targets.
(A) Scatterplot of the mean normalized log2-FPKM (three independent replicates) of genes expressed in DMSO-treated MV4;11 cells plotted versus the log2-HMD (H3K79me2) for +1000 bp from the TSS. …
Figure 3—figure supplement 1
H3K79me2 loss is poorly correlated with reductions in gene expression.
(A) Plots of H3K79me2 density from ICeChIP-seq in MV4;11 cells treated with 100 nM pinometostat for 4 or 7 days. H3K79me2 modification density (HMD) is displayed from ± 2000 bp of the TSS of all …
Figure 4 with 1 supplement
DOT1L inhibition reduces STAT5A activation and downregulates STAT5A targets in FLT3-ITD leukemia lines.
(A) MLL-rearranged leukemia lines with genotypes indicated were treated with 100 nM pinometostat (left panel, DOT1L inhibitor) or 30 nM tandutinib (right panel, FLT3 inhibitor MLN518), and relative …
Figure 4—figure supplement 1
FLT3 knockdown reduces STA5A activation.
(A) RT-qPCR analysis of HOXA9 and MEIS1 expression from three independent experiments of MOLM13 cells treated with 100 nM pinometostat for 7 days. Fold change over DMSO-treated cells is depicted ± …
Figure 5 with 1 supplement
Exogenous expression of constitutively active STAT5A partially rescues proliferation and gene expression effects of DOT1L inhibition.
(A) RT-qPCR analysis of STAT5A expression from three monoclonal isolates of MV4;11 cells virally transduced with a tet-inducible constitutively active STAT5A (STAT5A-CA) depicted as fold-change over …
Figure 5—figure supplement 1
STAT5A-CA overexpression partially rescues proliferation and gene expression effects caused by FLT3 inhibition.
(A) Western blots of whole cell extracts from WT MV4;11 cells or three clonal lines isolated from MV4;11 cells virally transduced with constitutively active STAT5A (STAT5A-CA). Membranes were …
Figure 6 with 1 supplement
PRC2 function is an ancillary pathway dependent on DOT1L and necessary for leukemia proliferation.
(A) RT-qPCR analysis of the components of the polycomb complex EZH2 and EED expression in MV4;11 cells ± 100 nM pinometostat for 7 days. Results are displayed as mean fold-change vs. DMSO-treated …
Figure 6—figure supplement 1
PRC2 inhibition reduces leukemia survival without affecting STAT5A actiation.
(A) Bar graph of Cuffdiff (Trapnell et al., 2012) output for the expression of polycomb complex members. EED and EZH2 from RNA-seq in MV4;11 cells ± 100 nM pinometostat for 7 days. Values are …
Figure 7 with 1 supplement
STAT5A-CA overexpression rescues the viability of MV4;11 cells treated with MLL1 inhibitors.
Proliferation assay of MLL-r cell lines treated with (A) 250 nM MI-503 (MLL1-Menin interaction inhibitor) or (B) 10 µM MM-401 (MLL1 histone methyltransferase inhibitor) for 7 days. Viability was …
Figure 7—figure supplement 1
MLL1 inhibitors reduce STAT5A phosphorylation.
(A) Western blots of whole cell extract from MV4;11 cells treated with 100 nM pinometostat for 7 days and blotted for H3K4me3 or LEDGF as a loading control. (B) Western blots of whole cell extract …
Author response image 1
(left) H3K4me3 HMD percent enrichment from ICeChIP-seq at the promoter regions of the indicated genes.
(right) B2M expression fold-change ± 250 nM MI-503.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| cell line (Homo-sapiens) | SEM | DSMZ | ACC546 | |
| cell line (Homo-sapiens) | MOLM13 | Duo laboratory University of Michigan | Verified by STR profiling ATCC | |
| cell line (Homo-sapiens) | THP-1 | ATCC | TIB-202 | Verified by STR profiling ATCC |
| cell line (Homo- sapiens) | MV4;11 | Duo laboratory University of Michigan | Verified by STR profiling ATCC | |
| Gene (Homo- sapiens) | STAT5A-CA | This paper | Constitutively active human STAT5A. | |
| recombinant DNA reagent | pTRIPZ-STAT5A-CA (plasmid) | This paper | Lentiviral construct to transfect and express the gene. | |
| recombinant DNA reagent | pTRIPZ-EZH2 (plasmid) | This paper | Lentiviral construct to transfect and express the gene. | |
| recombinant DNA reagent | Tet-pLKO-puro | Addgene | Cat # 21915 | |
| recombinant DNA reagent | PLKO-shFLT3 (plasmid) | This paper | Lentiviral construct to transfect and knock down gene. | |
| recombinant DNA reagent | PLKO-shscrambled (plasmid) | This paper | Lentiviral construct to transfect and knock down gene. | |
| recombinant DNA reagent | pTRIPZ-GFP (plasmid) | This paper | Lentiviral construct to transfect and express the gene. | |
| antibody | anti-MEIS1 (Rabbit polyclonal) | EMD Millipore | Cat# ABE2864 | WB (1:1000) |
| antibody | anti-H3 (Rabbit polyclonal) | Active Motif | Cat#: 61277 | WB (1:5000) |
| antibody | anti-H3K79me2 (Rabbit polyclonal) | Abcam | Cat# ab3594 | WB (1:2000) |
| antibody | anti-H3K27me3 (Rabbit polyclonal) | Cell Signaling | Cat# 9733S | WB (1:1000) |
| antibody | anti-H3K4me3 (mouse monoclonal) | Cell Signaling | Cat# 9751S | WB (1:1000) |
| antibody | anti-H4 (Rabbit polyclonal) | Active Motif | Cat# 61299 | WB (1:1000) |
| antibody | anti-H2B (Rabbit polyclonal) | Proteintech | Cat# 2S2899-2 | WB (1:5000) |
| antibody | anti-FLT3 (Rabbit polyclonal) | Cell Signaling | Cat. #: 33462S | WB (1:500) |
| antibody | anti-GAPDH (Rabbit polyclonal) | Cell Signaling | Cat# 5174S | WB (1:5000) |
| antibody | anti-STAT5A (Rabbit polyclonal) | Cell Signaling | Cat# 94205T | WB (1:1000) |
| antibody | anti-p- STAT5 (Rabbit polyclonal) | Cell Signaling | Cat# 9359S | WB (1:1000) |
| antibody | anti-EZH2 (Rabbit polyclonal) | Cell Signaling | Cat. #: 5246S | WB (1:1000) |
| antibody | anti-LEDGF (Rabbit polyclonal) | Bethyl | Cat# A300-848A | WB (1:2000) |
| antibody | anti-RBBP5 (Rabbit polyclonal) | Bethyl | Cat# A300-109A | WB (1:1000) |
| antibody | anti-HNRNPK (Rabbit polyclonal) | Abcam | Cat# ab70492 | WB (1:5000) |
| antibody | anti-MBD3 (Rabbit polyclonal) | Bethyl | Cat. #: A302-529A | WB (1:1000) |
| antibody | anti-rabbit (secondary HRP-conjugated) | Cell Signaling | Cat# 7074S | WB (1:10000) |
| antibody | anti-mouse (secondary HRP-conjugated) | Bethyl | Cat# 31432 | WB (1:10000) |
| chemical compound, drug | Pinometostat (EPZ5676) | Cayman Chemical | Cat# a16175 | |
| chemical compound, drug | Tandutinib (MLN518) | Selleckchem | Cat. #: S1043 | |
| chemical compound, drug | EI1 | Cayman Chemical | Cat# 19146–1 | |
| chemical compound, drug | MI-503 | Selleckchem | Cat. #: S7817 | |
| chemical compound, drug | PIM1 inhibitor | MedChemExpress | Cat# HY-15604 | |
| chemical compound, drug | MM-401 | Duo laboratory University of Michigan | ||
| chemical compound, drug | Propidium iodide | Alfa Aesar | Cat # J66584 | |
| recombinant DNA reagent | pCMV-Gag-Pol (plasmid) | Manicassamy lab | Lentiviral construct to transfect for viral particle assembly. | |
| recombinant DNA reagent | pCMV-vsvg (plasmid) | Manicassamy lab | Lentiviral construct to transfect for viral particle assembly. | |
| recombinant DNA reagent | pTRIPZ-FLT3-ITD | This paper | Lentiviral construct to transfect and express the gene. | |
| recombinant DNA reagent | RiboZero Gold | Illumina | Cat # MRZ11124C | Ribosomal rRNA removal from total RNA. |
| commercial assay or kit | NEBNext Ultra Directional RNA Library prep kit | NEB | Cat # E7420S | cDNA library kit. |
| commercial assay or kit | Trizol reagent | Life Technologies | Cat # 15596018 | RNA extraction. |
| commercial assay or kit | Zymo Research RNA Clean and Concentrator | Zymo Research | Cat # 11-353B | |
| commercial assay or kit | NEBNext Ultra II DNA Library prep kit | NEB | Cat # E7645 | DNA library kit. |
| commercial assay or kit | PowerUP SYBR Green master mix | Applied Biosystems | Cat # A25742 | qPCR reagent |
| commercial assay or kit | MMLV HP reverse transcriptase | Lucigen | Cat # RT80125K | |
| commercial assay or kit | Cell TiterGlo 2 | Promega | Cat # G924A | Cell proliferation assay. |
| software, algorithm | HISAT2 | Kim et al., 2015 | ||
| software, algorithm | Cufflinks | Trapnell et al., 2012 | ||
| peptide, recombinant protein | FITC-conjugated Annexin V | BD Biosciences | Cat # 556420 | Apoptosis detection reagent. |
| sequence-based reagent | HLD-DRA qPCR F | This paper | PCR primers | CTCAGGAATCATGGGCTATCAA |
| sequence-based reagent | HLA-DRA qPCR R | This paper | PCR primers | CTCATCACCATCAAAGTCAAACAT |
| sequence-based reagent | HLA-DRB1 qPCR F | This paper | PCR primers | GTGACACTGATGGTGCTGAG |
| sequence-based reagent | HLA-DRB1 qPCR R | This paper | PCR primers | GCTCCGTCCCATTGAAGAAA |
| sequence-based reagent | MEF2C qPCR F | This paper | PCR primers | GTCTGAGGACAAGTACAGGAAAA |
| sequence-based reagent | MEF2C qPCR R | This paper | PCR primers | GAGACTGGCATCTCGAAGTT |
| sequence-based reagent | FLT3 qPCR F | This paper | PCR primers | ATCATATCCCATGGTATCAGAATCC |
| sequence-based reagent | FLT3 qPCR R | This paper | PCR primers | GAAGCAGATACATCCACTTCCA |
| sequence-based reagent | ARID3B qPCR F | This paper | PCR primers | AGACCATACCAAAGATGCTTCC |
| sequence-based reagent | ARID3B qPCR R | This paper | PCR primers | ATCATCACTCCAGGCCAAAC |
| sequence-based reagent | STAT5A qPCR F | This paper | PCR primers | CAGATGCAGGTGCTGTACG |
| sequence-based reagent | STAT5A qPCR R | This paper | PCR primers | TGTCCAAGTCAATGGCATCC |
| sequence-based reagent | PIM2 qPCR F | This paper | PCR primers | ATGTTGACCAAGCCTCTACA |
| sequence-based reagent | PIM2 qPCR R | This paper | PCR primers | TCGATACTCGGCCTCGAA |
| sequence-based reagent | MEIS1 qPCR F | This paper | PCR primers | AGACGATAGAGAAGGAGGATCAA |
| sequence-based reagent | MEIS1 qPCR R | This paper | PCR primers | CCGTGTCATCATGATCTCTGTT |
| sequence-based reagent | HOXA9 qPCR F | This paper | PCR primers | AGGCGCCTTCTCTGAAA |
| sequence-based reagent | HOXA9 qPCR R | This paper | PCR primers | GTTGGCTGCTGGGTTATTG |
| sequence-based reagent | PBX3 qPCR F | This paper | PCR primers | CCACCAGATCATGACCATCAC |
| sequence-based reagent | PBX3 qPCR R | This paper | PCR primers | AAGAGCGCTGGTTTCATTCT |
| sequence-based reagent | CEBPA qPCR F | This paper | PCR primers | CCTTCAACGACGAGTTCCT |
| sequence-based reagent | CEBPA qPCR R | This paper | PCR primers | GCCCGGGTAGTCAAAGTC |
| sequence-based reagent | CSF1R qPCR F | This paper | PCR primers | GCCATCCACCTCTATGTCAAA |
| sequence-based reagent | CSF1R qPCR R | This paper | PCR primers | AGCAGACAGGGCAGTAGT |
| sequence-based reagent | B2M qPCR F | This paper | PCR primers | CTCTCTCTTTCTGGCCTGGAG |
| sequence-based reagent | B2M qPCR R | This paper | PCR primers | TCTGCTGGATGACGTGAGTA |
| sequence-based reagent | SPI1 qPCR F | This paper | PCR primers | TGCCCTATGACACGGATCTA |
| sequence-based reagent | SPI1 qPCR R | This paper | PCR primers | GTCCCAGTAATGGTCGCTATG |
| sequence-based reagent | CSF3R qPCR F | This paper | PCR primers | CTATGGCAAGGCTGGGAAA |
| sequence-based reagent | CSF3R qPCR R | This paper | PCR primers | GGGCTGAGACACTGATGTG |
| sequence-based reagent | PIM1 qPCR F | This paper | PCR primers | GTGGAGAAGGACCGGATTTC |
| sequence-based reagent | PIM1 qPCR R | This paper | PCR primers | TTCTTCAGCAGGACCACTTC |
| sequence-based reagent | PBX3 qPCR F | This paper | PCR primers | CAAAGAAACATGCCCTGAACTG |
| sequence-based reagent | PBX3 qPCR R | This paper | PCR primers | CTCTGATGCTGAGACCTGTTT |
| sequence-based reagent | 18S (RNA18S5) F | This paper | PCR primers | CGCAGCTAGGAATAATGGAATAGG |
| sequence-based reagent | 18S (RNA18S5) R | This paper | PCR primers | GCCTCAGTTCCGAAAACCAA |
| sequence-based reagent | CIITA qPCR F | This paper | PCR primers | CTGTGCCTCTACCACTTCTATG |
| sequence-based reagent | CIITA qPCR R | This paper | PCR primers | GTCGCAGTTGATGGTGTCT |
| sequence-based reagent | EZH2 qPCR F | This paper | PCR primers | GGAGGATCACCGAGATGATAAAG |
| sequence-based reagent | EZH2 qPCR R | This paper | PCR primers | TTCTGCTGTGCCCTTATCTG |
| sequence-based reagent | EED qPCR F | This paper | PCR primers | CTGGCACAGTAAAGAAGGAGAT |
| sequence-based reagent | EED qPCR R | This paper | PCR primers | GCATCAGCATCCACGTAAGA |
| sequence-based reagent | MEF2C promoter qPCR F | This paper | PCR primers | TCTGGACGAGTCTGGTTACTT |
| sequence-based reagent | MEF2C promoter qPCR R | This paper | PCR primers | AGGAAGAAGGAGGAGGAAGAG |
| sequence-based reagent | PIM1 promoter qPCR F | This paper | PCR primers | ctcagcgaaacggagagc |
| sequence-based reagent | PIM1 promoter qPCR R | This paper | PCR primers | cgtatcgattcaaacccaaacaa |
| sequence-based reagent | FLT3 promoter qPCR F | This paper | PCR primers | ctttctcagggcctcaaagat |
| sequence-based reagent | FLT3 promoter qPCR R | This paper | PCR primers | ccgaactctgtcgtttggat |
| sequence-based reagent | ARID3B promoter qPCR F | This paper | PCR primers | acgagaacctctgaggaaga |
| sequence-based reagent | ARID3B promoter qPCR R | This paper | PCR primers | gctgggaggaaagtaactaaaga |
| sequence-based reagent | CSF3R promoter qPCR F | This paper | PCR primers | GCAGAACCATTGTGGGTAAAC |
| sequence-based reagent | CSF3R promoter qPCR R | This paper | PCR primers | ggcagatggagaaacaggaa |
| sequence-based reagent | BCL6 promoter qPCR F | This paper | PCR primers | agctcgatctgctgagtttatg |
| sequence-based reagent | BCL6 promoter qPCR R | This paper | PCR primers | gcctctggaattctgagaactaat |
| sequence-based reagent | HOXA9 promoter qPCR F | This paper | PCR primers | GCCTTATGGCATTAAACCTGAAC |
| sequence-based reagent | HOXA9 promoter qPCR R | This paper | PCR primers | GAGGAGAACCACAAGCATAGTC |
| sequence-based reagent | MEIS1 promoter qPCR F | This paper | PCR primers | GGAGAGAGAGGGAGAGAAAGAA |
| sequence-based reagent | MEIS1 promoter qPCR R | This paper | PCR primers | CAAATGCACAAAGCCCTAGC |
| sequence-based reagent | HLA-DRA promoter qPCR F | This paper | PCR primers | CAGAGCGCCCAAGAAGAA |
| sequence-based reagent | HLA-DRA promoter qPCR R | This paper | PCR primers | cctcagcacctacCTTTGATAG |
| sequence-based reagent | intergenic qPCR F | This paper | PCR primers | TACACGACAGAGGACTGGAA |
| sequence-based reagent | intergenic qPCR R | This paper | PCR primers | CCTTCATGGGTGAGGGTAATG |
| sequence-based reagent | scrambled shRNA F | Yuan et al., 2009 | shRNA construct for gene knockdown | CCGG TTCTCCGAACGTGTCACGTTT CTCGAG AAACGTGACACGTTCGGAGAA TTTTT |
| sequence-based reagent | scrambled shRNA R | Yuan et al., 2009 | shRNA construct for gene knockdown | AATTAAAAA TTCTCCGAACGTGTCACGTTT CTCGAG AAACGTGACACGTTCGGAGAA |
| sequence-based reagent | FLT3 shRNA F | Green et al., 2015 | shRNA construct for gene knockdown | CCGG GCATCCCAGTCAATCAGCTTT CTCGAG AAAGCTGATTGACTGGGATGC TTTTT |
| sequence-based reagent | FLT3 shRNA R | Green et al., 2015 | shRNA construct for gene knockdown | AATTAAAAA GCATCCCAGTCAATCAGCTTT CTCGAG AAAGCTGATTGACTGGGATGC |
| sequence-based reagent | GFP shRNA F | Scheeren et al., 2005 | shRNA construct for gene knockdown | CCGG GCAAGCTGACCCTGAAGTTCAT CTCGAG ATGAACTTCAGGGTCAGCTTGC TTTTT |
| sequence-based reagent | GFP shRNA R | Scheeren et al., 2005 | shRNA construct for gene knockdown | AATTAAAAA GCAAGCTGACCCTGAAGTTCAT CTCGAG ATGAACTTCAGGGTCAGCTTGC |
Additional files
-
Source data 1
Blotting source files.
- https://cdn.elifesciences.org/articles/64960/elife-64960-data1-v2.zip
-
Source data 2
Blotting source files.
- https://cdn.elifesciences.org/articles/64960/elife-64960-data2-v2.zip
-
Source data 3
Blotting source files.
- https://cdn.elifesciences.org/articles/64960/elife-64960-data3-v2.zip
-
Supplementary file 1
Oligonucleotide sequences.
- https://cdn.elifesciences.org/articles/64960/elife-64960-supp1-v2.xlsx
-
Supplementary file 2
Antibody information.
- https://cdn.elifesciences.org/articles/64960/elife-64960-supp2-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/64960/elife-64960-transrepform-v2.docx
