1. Developmental Biology
  2. Stem Cells and Regenerative Medicine

Insulin-producing β-cells regenerate ectopically from a mesodermal origin under the perturbation of hemato-endothelial specification

  1. Ka-Cheuk Liu
  2. Alethia Villasenor
  3. Maria Bertuzzi
  4. Nicole Schmitner
  5. Niki Radros
  6. Linn Rautio
  7. Kenny Mattonet
  8. Ryota L Matsuoka
  9. Sven Reischauer
  10. Didier YR Stainier
  11. Olov Andersson  Is a corresponding author
  1. Department of Cell and Molecular Biology, Karolinska Institutet, Sweden
  2. Department of Developmental Genetics, Max Planck Institute for Heart and Lung Research, Germany
  3. Department of Neuroscience, Karolinska Institutet, Sweden
  4. Dermatology and Venereology Division, Department of Medicine (Solna), Karolinska Institutet, Sweden
  5. Department of Cardiovascular and Metabolic Sciences, Lerner Research Institute, Cleveland Clinic, United States
  6. Cardio-Pulmonary Institute, Frankfurt, Germany; Medical Clinic I, (Cardiology/Angiology) and Campus Kerckhoff, Justus-Liebig-University Giessen, Germany
https://doi.org/10.7554/eLife.65758
Share this article
Cite this article
  1. Ka-Cheuk Liu
  2. Alethia Villasenor
  3. Maria Bertuzzi
  4. Nicole Schmitner
  5. Niki Radros
  6. Linn Rautio
  7. Kenny Mattonet
  8. Ryota L Matsuoka
  9. Sven Reischauer
  10. Didier YR Stainier
  11. Olov Andersson
(2021)
Insulin-producing β-cells regenerate ectopically from a mesodermal origin under the perturbation of hemato-endothelial specification
eLife 10:e65758.
https://doi.org/10.7554/eLife.65758
  2. Download BibTeX
  3. Download .RIS
7 figures, 1 video, 2 tables and 2 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
Ectopic β-cell formation in npas4l mutants.

(A, B) Representative confocal projections of the pancreas and neighbouring tissues of control siblings and npas4l−/− Tg(ins:Flag-NTR);Tg(ins:H2BGFP;ins:DsRed) zebrafish larvae at 3 dpf after β-cell …

Figure 1—figure supplement 1
Download asset Open asset
Mutation of npas4l suppresses the development of exocrine pancreas.

(A, B) Representative image projections of the pancreas in control siblings and npas4l−/− Tg(ptf1a:EGFP) larvae, without carrying the ins:Flag-NTR transgene, that is during regular development. …

Figure 2 with 1 supplement
Download asset Open asset
The ectopic β-cells co-express insulin and endocrine markers in npas4l mutants.

Representative confocal images of the tissues adjacent to the pancreas of control siblings and npas4l−/− Tg(ins:Flag-NTR) zebrafish larvae at 3 dpf after β-cell ablation by MTZ at 1–2 dpf, …

Figure 2—figure supplement 1
Download asset Open asset
Mutation of npas4l inhibits pdx1-expressing pancreatic duct formation.

(A–D) Representative image projections of the pancreas and the surrounding tissues in control siblings and npas4l−/− Tg(pdx1:EGFP) zebrafish larvae without (A, B) or with (C, D) ins:Flag-NTR …

Figure 3
Download asset Open asset
Ectopic β-cells can respond to glucose by displaying calcium oscillations.

Representative images captured from a live calcium imaging video of npas4l−/−Tg(ins:GCaMP6s);Tg(ins:mCherry);Tg(ins:Flag-NTR) zebrafish larvae at 3 dpf after β-cell ablation by MTZ from 1 to 2 dpf, …

Figure 4 with 4 supplements
Download asset Open asset
The ectopic β-cells are of mesodermal origin in npas4l mutants and etsrp morphants.

(A) Constructs of −6.35drl:Cre-ERT2 (drl:CreERT2) and −3.5ubb:LOXP-EGFP-LOXP-mCherry (ubi:Switch). Upon 4-OHT induction between 10 and 12 hpf, Cre recombinase expressed by the drl promoter cleave …

Figure 4—figure supplement 1
Download asset Open asset
Cell population with reduced npas4l expression remains in the lateral plate mesoderm before β-cell ablation.

(A, B) Representative images of in situ hybridisation against npas4l expression in control siblings and npas4l−/− zebrafish embryos at 20 hpf after a 45 min incubation to develop the expression …

Figure 4—figure supplement 2
Download asset Open asset
The npas4l mutant does not display altered expression of drl in the lateral plate mesoderm.

(A, B) Representative images of in situ hybridisation against drl expression in control siblings and npas4l−/− zebrafish embryos at 10 hpf.

Figure 4—figure supplement 3
Download asset Open asset
Lateral plate mesoderm-derived cardiomyocytes are traced back to a drl-expressing lineage.

(A, B) Representative confocal images of hearts of Tg(drl:CreERT2);Tg(ubi:Switch) zebrafish larvae at three dpf after DMSO (A) or 4-OHT (B) treatment from 10 to 12 hpf. Cells with or without …

Figure 4—figure supplement 4
Download asset Open asset
Validation of etsrp morpholinos.

(A) Quantification of ectopic β-cells in Tg(ins:Flag-NTR) zebrafish larvae at 3 dpf after injection of random control MO (4 ng), etsrp MO1 (4 ng), or etsrp MO2 (4 ng) at one-cell stage, followed by …

Figure 5
Download asset Open asset
The mesodermal cells lose npas4l expression after differentiating into ectopic β-cells.

(A) Schematics of npas4lPt(+36-npas4l-p2a-Gal4-VP16)bns423 (npas4l:Gal4), UAS:Cre and −3.5ubb:LOXP-EGFP-LOXP-mCherry (ubi:Switch). (B, C) Quantification of the pancreatic or ectopic β-cells with or …

Figure 6 with 1 supplement
Download asset Open asset
The ectopic β-cells derive from the etsrp-expressing mesodermal lineage in etsrp morphants.

(A) Constructs of etsrp:Cre and −3.5ubb:LOXP-EGFP-LOXP-mCherry (ubi:Switch). (B, C) Quantification of the pancreatic or ectopic β-cells with or without etsrp-positive mesodermal origin in control or …

Figure 6—figure supplement 1
Download asset Open asset
Most of the kdrl-expressing endothelial cells are traced back to an etsrp lineage.

(A–C) Representative confocal images of intersegmental vessels and other vasculatures in different body regions (front, mid, or tail) of Tg(etsrp:Cre);Tg(ubb:LOXP-CFP-LOXP-zgc:114046-mCherry) …

Figure 7
Download asset Open asset
Npas4l/Etsrp restricts the plasticity of the mesoderm.

Mesoderm and endoderm normally follow Waddington’s landscape model to further differentiate into cells with mesodermal fates and endodermal fates, respectively, during development. However, mutating …

Videos

Video 1
Download asset
Live calcium imaging of β-cells in a npas4l mutant.

An example video of live calcium imaging of both pancreatic and ectopic β-cells in a Tg(ins:GCaMP6s);Tg(ins:mCherry);Tg(ins:Flag-NTR) npas4l mutant at 3 dpf after β-cell ablation from 1 to 2 dpf, …

Tables

Table 1
Percentages of pancreatic or ectopic cells co-expressing insulin and corresponding marker gene or protein in npas4l mutants.
Marker gene/proteinPancreatic co-expression (%)Ectopic co-expression (%)
Isl197.996.8
neurod197.517.5
pdx172.132.8
mnx175.370.2
pcsk185.174.1
ascl1b21.217.8
Key resources table
Reagent type
(species) or
resource		DesignationSource or
reference		IdentifiersAdditional
information
Genetic reagent (Danio rerio)npas4ls5PMID:7588049ZFIN: ZDB-ALT-010426–6
Genetic reagent (Danio rerio)npas4lPt(+36-npas4l-p2a-Gal4-VP16)bns423OtherWill be described in detail elsewhere (K.M. and D.Y.R.S., Manuscript in preparation)
Genetic reagent (Danio rerio)Tg(ins:Hsa.HIST1H2BJ-GFP;ins:DsRed)s960PMID:25117518ZFIN: ZDB-ALT-131001–6
Genetic reagent (Danio rerio)Tg(ins:FLAG-NTR,cryaa:mCherry)s950PMID:22608007ZFIN: ZDB-ALT-130930–5
Genetic reagent (Danio rerio)Tg(ptf1a:EGFP)jh1PMID:16258076ZFIN: ZDB-ALT-070531–2
Genetic reagent (Danio rerio)TgBAC(hand2:EGFP)pd24PMID:21397850ZFIN: ZDB-ALT-110128–40
Genetic reagent (Danio rerio)TgBAC(neurod1:EGFP)nl1PMID:18305245ZFIN: ZDB-ALT-080701–1
Genetic reagent (Danio rerio)TgBAC(pdx1:EGFP)bns13PMID:31142539ZFIN: ZDB-ALT-191212–6
Genetic reagent (Danio rerio)Tg(mnx1:GFP)ml2PMID:16162647ZFIN: ZDB-ALT-051025–4
Genetic reagent (Danio rerio)Tg(pcsk1:EGFP)KI106PMID:27516442ZFIN: ZDB-ALT-161115–10
Genetic reagent (Danio rerio)TgBAC(ascl1b:EGFP-2A-Cre-ERT2)ulg006PMID:26329351ZFIN: ZDB-ALT-160205–2
Genetic reagent (Danio rerio)Tg(ins:GCaMP6s,cryaa:RFP)PMID:28939870ZFIN: ZDB-ALT-181221–2
Genetic reagent (Danio rerio)Tg(−3.5ubb:LOXP-EGFP-LOXP-mCherry)cz1701PMID:21138979ZFIN: ZDB-ALT-110124–1
Genetic reagent (Danio rerio)Tg(−6.35drl:Cre-ERT2,cryaa:Venus)cz3333PMID:26306682ZFIN: ZDB-ALT-160129–4
Genetic reagent (Danio rerio)Tg(5xUAS:EGFP)nkuasgfp1aPMID:18202183ZFIN: ZDB-ALT-080528–1
Genetic reagent (Danio rerio)Tg(kdrl:EGFP)s843PMID:16251212ZFIN: ZDB-ALT-050916–14
Genetic reagent (Danio rerio)Tg(ubb:LOXP-CFP-LOXP-zgc:114046-mCherry)jh63PMID:25773748ZFIN: ZDB-ALT-151007–31
Genetic reagent (Danio rerio)Tg(ins:LOXP-mCherry-LOXP-Hsa.HIST1H2BJ-GFP,cryaa:Cerulean)s934PMID:21497092ZFIN: ZDB-ALT-111031–2
Genetic reagent (Danio rerio)Tg(etsrp:iCre;cryaa:Venus)KI114This paperSee Materials and methods, section Zebrafish
Genetic reagent (Danio rerio)Tg(UAS:Cre, cryaa:Cerulean)bns382This paperSee Materials and methods, section Zebrafish
AntibodyAnti-GFP (chicken polyclonal)Aves LabsGFP-1020(1:500)
AntibodyAnti-RFP (rabbit polyclonal)Abcamab62341(1:500)
AntibodyAnti-tdTomato (goat polyclonal)MyBioSourceMBS448092(1:500)
AntibodyAnti-insulin (rabbit polyclonal)Cambridge Research BiochemicalsCustomised(1:100)
AntibodyAnti-pan-cadherin (rabbit polyclonal)Sigma-AldrichC3678(1:5000)
AntibodyAnti-islet-1-homeobox (mouse monoclonal)DSHB40.3A4 supernatant(1:10)
Recombinant DNA reagentp5E-MCS (plasmid)Tol2kit228
Recombinant DNA reagentp5E-etsrp (plasmid)This paper−2.3etsrp promoter inserted into p5E-MCS
Recombinant DNA reagentpME-iCre (plasmid)OtherFrom Kristen M. Kwan’s lab
Recombinant DNA reagentp3E-polyA (plasmid)Tol2kit302
Recombinant DNA reagentpDestTol2gY (plasmid)OtherFrom Naoki Tsuji
Recombinant DNA reagent−2.3etsrp:iCre,cryaa:Venus (plasmid)This paperSee Materials and methods, section Zebrafish
Sequence-based reagent−2.3etsrp_FWDThis paperPCR primerTATAGGGCGAATTGggtaccTTCAGTAAGCAGACTCCTTCAATCA
Sequence-based reagent−2.3etsrp_REVThis paperPCR primerAGCTGGAGCTCCAccgcggTTCGGCATACTGCTGTTGGAC
Sequence-based reagentStandard control morpholinoGene ToolsMorpholinoCCTCTTACCTCAGTTACAATTTATA
Sequence-based reagentRandom control morpholinoGene ToolsMorpholinoMixture of many oligo sequences
Sequence-based reagentetsrp morpholino MO1Gene ToolsMorpholino
ZFIN: ZDB-MRPHLNO-060407–2		TTGGTACATTTCCATATCTTAAAGT
Sequence-based reagentetsrp morpholino MO2Gene ToolsMorpholino
ZFIN: ZDB-MRPHLNO-060407–3		CACTGAGTCCTTATTTCACTATATC
Sequence-based reagentnpas4l_ISH_FWDThis paperPCR primerACTCGGGCATCAGGAGGATC
Sequence-based reagentnpas4l_ISH_REVThis paperPCR primer(CCTAATACGACTCACTATAGGG)GACACCAGCATACGACACACAAC
Sequence-based reagentdrl_ISH_FWDThis paperPCR primerATGAAGAATACAACAAAACCC
Sequence-based reagentdrl_ISH_REVThis paperPCR primer(CCTAATACGACTCACTATAGGG)TGAGAAGCTCTGGCCGC
Sequence-based reagentnpas4ls5_FWDPMID:27411634PCR primerTTCCATCTTCTGAATCCTCCA
Sequence-based reagentnpas4ls5_REVPMID:27411634PCR primerGGACAGACCCAGATACTCGT
Sequence-based reagentnpas4ls5_SEQThis paperSequencing primerTTTCTGCCGTGAATGGATGTG
Commercial assay or kitGateway LR Clonase II Enzyme MixInvitrogen11791–020
Commercial assay or kitPhusion High-Fidelity DNA PolymeraseThermo ScientificF-530L
Commercial assay or kitIn-Fusion HD Cloning KitTakara Bio639648
Commercial assay or kitMAXIscript T7/T3 Transcription KitInvitrogenAM1324
Chemical compound, drugMetronidazoleSigma-AldrichM3761
Chemical compound, drug4-HydroxytamoxifenSigma-AldrichH7904
Software, algorithmImageJPMID:22930834
Software, algorithmFijiPMID:22743772
Software, algorithmLAS X Version 3.5.5.19976Leica
Software, algorithmZEN 3.1Zeiss
Software, algorithmGraphPad Prism 9GraphPad Software
OtherDAPIThermoFisher ScientificD1306(1 µg/mL)

Additional files

Source data 1

Source data for all Figures.

https://cdn.elifesciences.org/articles/65758/elife-65758-data1-v1.xlsx
Transparent reporting form
https://cdn.elifesciences.org/articles/65758/elife-65758-transrepform-v1.pdf

Download links