Stress resets ancestral heritable small RNA responses
- Department of Neurobiology, Wise Faculty of Life Sciences & Sagol School of Neuroscience, Tel Aviv University, Israel
Figures
Figure 1 with 5 supplements
Stress resets heritable small RNA silencing.
(A) Experimental scheme. Heritable small RNA responses are initiated at the first generation, and the F1 progeny are then subjected to three different stress types (heat shock {HS}, hyperosmotic …
Figure 1—figure supplement 1
Multiple durations and magnitudes of stress can induce resetting of small RNAs.
(A) Both 3 day long and 6 day long starvation lead to resetting of a heritable RNAi response. Each condition was tested separately, and they are displayed side-by-side for readability. The graph …
Figure 1—figure supplement 2
Starvation and hyperosmotic stress do not affect the basal expression level of the GFP reporter.
(A) Hyperosmotic stress does not affect the basal expression level of the GFP reporter. The graph displays the measured germline GFP fluorescence levels of wild-type worms which were not exposed to …
Figure 1—figure supplement 3
stress expedites the typical diminishment of heritable small RNA responses.
(A) Heritable exogenous small RNA silencing is reset by stress. The graph displays the measured germline GFP fluorescence levels of worms (y-axis) across generations (x-axis). Shown are the median …
Figure 1—figure supplement 4
Stress resets heritable small RNAs even when applied during adulthood.
Stress applied during adulthood leads to resetting of heritable silencing in the next generation. The graph displays the measured germline GFP fluorescence levels of individual worms (y-axis) across …
Figure 1—figure supplement 5
Resetting of heritable small RNA responses can only occur during the F1 generation.
Stress applied two generations after the initiation of the heritable small RNAs response does not reset the inheritance. Upper panel: Experimental scheme. A heritable anti-gfp small RNA response is …
Figure 2
Stress resets endo-siRNAs and piRNAs-induced silencing.
(A) Representative images of worms expressing endo-siRNAs sensor (left) or the piRNAs sensor (right) under control or stress (HS) conditions. (B) The graph displays the measured GFP (left, …
Figure 3
Resetting of heritable small RNA responses is induced specifically by stress, also when experienced prior to initiation of RNAi.
(a) Shifting from stress to non-stress conditions fails to reset small RNA inheritance. Upper panel: Experimental scheme. Worms grown in regular growth conditions (20°C, control) or in high …
Figure 4
Genome-wide small RNA changes following stress.
(A) Experimental scheme. Worms were exposed to stress during their first larval stage and were collected for RNA extraction and small RNA sequencing on the first day of adulthood. The next …
Figure 5 with 3 supplements
The MAPK pathway and the SKN-1 transcription factor regulate small RNAs resetting in response to stress.
(A) Mutants defective in stress-responsive genes display altered heritable RNAi dynamics. Heatmap representing the log2-fold change of GFP fluorescence levels (color coded and indicated values) in …
Figure 5—figure supplement 1
Multiple stress signaling and processing pathways affect heritable RNAi dynamics and stress-induced resetting of heritable silencing.
The graphs display the measured germline GFP fluorescence levels of mutant worms (y-axis) across generations under the indicated condition (x-axis). Each dot represents the value of an individual …
Figure 5—figure supplement 2
Mutants of the daf-16, aak-1/2 and daf-2 genes are capable of stress-induced resetting of heritable responses.
The graphs display the measured germline GFP fluorescence levels of mutant worms (y-axis) across generations under the indicated condition (x-axis). Each dot represents the value of an individual …
Figure 5—figure supplement 3
Mutants in the MAPK pathway, the transcription factor SKN-1, and the putative H3K9 methyltransferase MET-2 do not affect the basal expression of the GFP reporter.
The graphs display the measured germline GFP fluorescence levels of worms which were not exposed to RNAi (y-axis) under the indicated genotype (x-axis). Each dot represents the value of an …
Figure 6 with 1 supplement
Stress-induced small RNA resetting depends on the H3K9 methyltransferase MET-2.
(A) Targets of stress-affected small RNAs show significantly increased H3K9me2 marks. An analysis of H3K9me2 signal (based on published data from McMurchy et al., 2017). Presented is the averaged …
Figure 6—figure supplement 1
Targets of stress-affected small RNAs show unique H3K9 marks and the H3K9 methyltransferase met-2 is required for the execution of small RNA resetting.
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Chemical compound, drug | Levamisole hydrochloride | Sigma | L0380000 | |
| Chemical compound, drug | Trizol Reagent | Life Technologies | 15596026 | |
| Chemical compound, drug | Phenol Chloroform Isoamyl | Sigma | P2069 | |
| Other | Heavy Phase Lock tube | QuantaBio | 23028330 | |
| Chemical compound, drug | Ultra Pure Glycogen | ThermoFisher | 10814010 | |
| Peptide, recombinant protein | RNA 5' Polyphosphatase | Epicenter | RP8092H | |
| Commercial assay, kit | NEBNext Multiplex Small RNA Library Prep Set for Illumina | New England Biolabs | E7300 | |
| Commercial assay, kit | TapeStation screen tapes | Agilent | 5067–5582 | |
| 5067–5588 | ||||
| Commercial assay, kit | TapeStation reagents | Agilent | 5067–5583 | |
| 5067–5589 | ||||
| Chemical compound, drug | E-Gel 4% agarose | Life Technologies | G401004 | |
| Commercial assay, kit | MinElute DNA purification kit | Qiagen | 28006 | |
| Chemical compound, drug | RNase free Nuclease-free water | Ambion | AM9932 | |
| Peptide, recombinant protein | NlaIII | New Englang BioLabs (NEB) | 631207 | |
| Commercial assay, kit | TG NextSeq 500/550 High Output Kit v2 (75 cycles) | Illumina | TG-160–2005 | |
| Strain, strain background (Caenorhabditis elegans) | C. elegans: Strain SX1263: unc-119(ed3) III; mex-5::gfp::h2b::tbb-2 II | The Eric Miska lab (Sapetschnig et al., 2015) | SX1263 | |
| Strain, strain background (C. elegans) | C. elegans: Strain EG6089: unc-119(ed3) III; oxTi38[cb-unc-119(+) Ppie-1::GFP] IV | The Eric Miska lab (Sapetschnig et al., 2015) | EG6089 | |
| Strain, strain background (C. elegans) | C. elegans: Strain JA1527: weSi14 [Pmex-5::mCherry::(Gly)5Ala/his-58/tbb-2 3′UTR; cb-unc-119(+)] IV | The Julie Ahringer lab (Zeiser et al., 2011) | JA1527 | |
| Strain, strain background (C. elegans) | C. elegans: Strain GR1720: mgSi4 [(pCMP2) ubl-1p::GFP::siR-1-sensor-ubl-1–3'UTR + Cbr-unc-119(+)] IV | Caenorhabditis Genetics Center | WB strain: GR1720 | |
| Strain, strain background (C. elegans) | C. elegans: Strain KB3: kgb-1 (um3) IV | Caenorhabditis Genetics Center | KB3 | |
| Strain, strain background (C. elegans) | C. elegans: Strain KB3: kgb-1 (um3) IV crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain FK171: mek-1(ks54); sek-1(qd127) | Caenorhabditis Genetics Center | FK171 | |
| Strain, strain background (C. elegans) | C. elegans: Strain FK171: mek-1(ks54); sek-1(qd127) X crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain CF1038: daf-16(mu86) I | Caenorhabditis Genetics Center | CF1038 | |
| Strain, strain background (C. elegans) | C. elegans: Strain CF1038: daf-16(mu86) I, crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain KU4: sek-1(km4) X | Caenorhabditis Genetics Center | KU4 | |
| Strain, strain background (C. elegans) | C. elegans: Strain KU4: sek-1(km4) X, crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain KU25: pmk-1(km25) IV | Caenorhabditis Genetics Center | KU25 | |
| Strain, strain background (C. elegans) | C. elegans: Strain KU25: pmk-1(km25) IV, crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain MR1175: aak-1(tm1944) III, aak-2(ok524) X | The Richard Roy lab (Demoinet et al., 2017) | MR1175 | |
| Strain, strain background (C. elegans) | C. elegans: Strain MR1175: aak-1(tm1944) III, aak-2(ok524) X, crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain PS355: hsf-1(sy441) I | Caenorhabditis Genetics Center | PS355 | |
| Strain, strain background (C. elegans) | C. elegans: Strain PS355: hsf-1(sy441) I, crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain CB1370: daf-2(e1370) III | Caenorhabditis Genetics Center | CB1370 | |
| Strain, strain background (C. elegans) | C. elegans: Strain CB1370: daf-2(e1370) III, crossed with Strain EG6089 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain QV225: skn-1(zj15) IV | Caenorhabditis Genetics Center | QV225 | |
| Strain, strain background (C. elegans) | C. elegans: Strain QV225: skn-1(zj15) IV, crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain MT13293: met-2(n4256) III | Caenorhabditis Genetics Center | MT13293 | |
| Strain, strain background (C. elegans) | C. elegans: Strain MT13293: met-2(n4256) III, crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain RB1789: met-2(ok2307) III | Caenorhabditis Genetics Center | RB1789 | |
| Strain, strain background (C. elegans) | C. elegans: Strain RB1789: met-2(ok2307) III, crossed with Strain SX1263 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain KU4: sek-1(km4) X, crossed with strain JA1527 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain ZD202: sek-1(km4) X; qdEx8[unc-119p::sek-1(cDNA)::GFP::unc-54–3' UTR + myo-2p::mStrawberry::unc-54–3' UTR], crossed with strain JA1527 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain ZD193: sek-1(km4) X; qdEx4 [ges-1p::sek-1(cDNA)::GFP::unc-54–3' UTR + myo-2p::mStrawberry::unc-54–3' UTR], crossed with strain JA1527 | This study | ||
| Strain, strain background (C. elegans) | C. elegans: Strain OH14221: met-2(ot861[met-2::mKate2]) III | Caenorhabditis Genetics Center (Patel and Hobert, 2017) | OH14221 | |
| Strain, strain background (C. elegans) | C. elegans: Strain OH14221: met-2(ot861[met-2::mKate2]) III crossed with strain QV225 | This study | ||
| Sequence-based reagent | PCR 1-FWD: mek-1/sek-1 | IDT | TTTCCATCAACTCAGTCGCCG | |
| Sequence-based reagent | PCR 1-REV1: mek-1/sek-1 | IDT | TTCATTAGTCAATTGGGTCAG | |
| Sequence-based reagent | PCR 1-REV2: mek-1/sek-1 | IDT | CACTTTTCAATTAAGGTACAAC | |
| Sequence-based reagent | PCR 2-FWD: kgb-1 | IDT | CCCTACTTTATAATGAGATGC | |
| Sequence-based reagent | PCR 2-REV1: kgb-1 | IDT | TTCATTAGTCAATTGGGTCAG | |
| Sequence-based reagent | PCR 2-REV2: kgb-1 | IDT | CACTTTTCAATTAAGGTACAAC | |
| Sequence-based reagent | PCR 3-FWD: daf-16 | IDT | GTTCAGTAGACGGTGACCATCT | |
| Sequence-based reagent | PCR 3-REV1: daf-16 | IDT | GCTTCGGCTTGAAAGATCAGTG | |
| Sequence-based reagent | PCR 3-REV2: daf-16 | IDT | GTACGCCGTGGTCCGACTA | |
| Sequence-based reagent | PCR 4-FWD: skn-1 | IDT | GAAGAGAATGCTCGATATGAAG | |
| Sequence-based reagent | PCR 4-REV: skn-1 | IDT | TTTCAGTCGTTTATAAGAGAGC | |
| Sequence-based reagent | PCR 5-FWD: aak-1 | IDT | ATCGATACGGAACCAACTG | |
| Sequence-based reagent | PCR 5-REV: aak-1 | IDT | GGGTATGGTAGTACCAATAGG | |
| Sequence-based reagent | PCR 6-FWD: aak-2 | IDT | CGATAGCACAGACAACAGTTCG | |
| Sequence-based reagent | PCR 6-REV: aak-2 | IDT | GATGGTGGCCCTCTTCATC | |
| Sequence-based reagent | PCR 7-FWD1: daf-18 | IDT | AGGGTAATGCATTTCAGCAC | |
| Sequence-based reagent | PCR 7-FWD2: daf-18 | IDT | CCCGCATATAAACTGGAAATGTG | |
| Sequence-based reagent | PCR 7-REV: daf-18 | IDT | CAAATACGTCAGTTTCAACGTG | |
| Sequence-based reagent | PCR 8-FWD: pmk-1 | IDT | CTATAAGTTGCCATGACCTC | |
| Sequence-based reagent | PCR 8-REV: pmk-1 | IDT | GCTCCCATCAACATTGATAC | |
| Sequence-based reagent | PCR 9-FWD1: sek-1 | IDT | CTAGAATAAGTGCTATGCTAG | |
| Sequence-based reagent | PCR 9-FWD2: sek-1 | IDT | GTTGTCTAAGTATAATTGTCC | |
| Sequence-based reagent | PCR 9-REV: sek-1 | IDT | TGATTGATTATAACTACGAGG | |
| Sequence-based reagent | PCR 10-FWD1: met-2 | IDT | TTTACTGTCACATCACCTGC | |
| Sequence-based reagent | PCR 10-FWD2: met-2 | IDT | AAGCAGATGTTTGTCAGAATCC | |
| Sequence-based reagent | PCR 10-REV: met-2 | IDT | AGCAGCATTCATCTTCGC | |
| Software, algorithm | FastQC | Andrews, 2010 | ||
| Software, algorithm | Cutadapt | Martin, 2011 | ||
| Software, algorithm | Shortstack | Shahid and Axtell, 2014 | ||
| Software, algorithm | HTSeq count | Anders et al., 2014 | ||
| Software, algorithm | R Deseq2 | Love et al., 2014 | ||
| Software, algorithm | RNAlysis | Teichman, 2019 | Version 1.3.5 | |
| Software, algorithm | Fiji | Schindelin et al., 2012 | ||
| Software, algorithm | MATLAB R2018b | MATLAB | Version R2018b | |
| Software, algorithm | IoSR-Surry MatlabToolbox (BoxPlot function) | Institute of Sound Recording, University of Surrey | https://github.com/IoSR-Surrey/MatlabToolbox | Version 2.8 |
| Software, algorithm | GraphPad Prism 8 | GraphPad Software | http://www.graphpad.com/ | Version 8.0.0 |
Additional files
-
Supplementary file 1
A total of 281 targets of small RNAs which were affected across all stress conditions at the stress generation.
Table presents DESeq2 comparison of Control vs. Stress samples. Related to Figure 4.
- https://cdn.elifesciences.org/articles/65797/elife-65797-supp1-v2.csv
-
Supplementary file 2
Ten targets of small RNAs which were affected across all stress conditions at the next generation.
Table presents DESeq2 comparison of Control vs. Stress samples. Related to Figure 4.
- https://cdn.elifesciences.org/articles/65797/elife-65797-supp2-v2.csv
-
Supplementary file 3
Enrichment table for the 281 targets of stress-affected genes, generated using WormExp (Yang et al., 2016).
Related to Figure 4.
- https://cdn.elifesciences.org/articles/65797/elife-65797-supp3-v2.csv
-
Supplementary file 4
Seventy-three epigenetic-related genes significantly downregulated under all stress conditions.
- https://cdn.elifesciences.org/articles/65797/elife-65797-supp4-v2.csv
-
Supplementary file 5
Thirty-five epigenetic-related skn-1-dependent stress-dependent genes.
- https://cdn.elifesciences.org/articles/65797/elife-65797-supp5-v2.csv
-
Supplementary file 6
Enrichment table for skn-1-dependent stress-dependent genes, generated using RNAlysis (Teichman, 2019).
- https://cdn.elifesciences.org/articles/65797/elife-65797-supp6-v2.csv
-
Supplementary file 7
Sixty-three epigenetic-related genes whose putative promoter regions contain the binding motif sequence of SKN-1, generated using TF2DNA (Pujato et al., 2014).
- https://cdn.elifesciences.org/articles/65797/elife-65797-supp7-v2.csv
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/65797/elife-65797-transrepform-v2.docx
