Mechanical stretch scales centriole number to apical area via Piezo1 in multiciliated cells
- Pediatric Genomics Discovery Program, Department of Pediatrics and Genetics, Yale University School of Medicine, United States
- Department of Cell and Developmental Biology, Feinberg School of Medicine, Northwestern University, United States
Figures
Figure 1 with 2 supplements
Centriole number scales with apical area in Xenopus MCCs.
(a) Schematic representing the current understanding of how MCCs differentiate and develop (Steps 0–4). Xenopus embryonic development is closely linked (dashed arrows) to MCC development. (b) MCCs …
-
Figure 1—source data 1
Source data related to Figure 1 .
- https://cdn.elifesciences.org/articles/66076/elife-66076-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Relation between centriole number and apical area in goblet cells converted to MCCs in Xenopus laevis.
(a) MCCs marked with centrin-GFP (centrioles, green), and phalloidin (F-actin, magenta) in Xenopus laevis. (b) Regression plot showing the relation between apical area and centriole number in MCCs …
Figure 1—figure supplement 2
Increasing apical area leads to an increase in centriole number.
(a) Mature (Step 4) epidermal MCCs marked with chibby-GFP (centrioles, green) and phalloidin (F-actin, magenta) in control and ccdc11 morphant embryos at Stage 28. Quantitation of (b) apical area …
Figure 2
Perturbation of centriole amplification affects apical area contextually.
(a) Mature (Step 4) epidermal MCCs marked with chibby-GFP (centrioles, green), and phalloidin (F-actin, magenta) in control and Cep152 overexpressed (OE) embryos. Quantitation of (b) apical area and …
-
Figure 2—source data 1
Source data related to Figure 2.
- https://cdn.elifesciences.org/articles/66076/elife-66076-fig2-data1-v2.xlsx
Figure 3
MCCs synthesize about half the total number of centrioles during intercalation.
(a–c) Centrioles (chibby-GFP, green) and F-actin (phalloidin, magenta) in intercalating MCCs (Step 1). Dotted while lines show the border of the intercalating MCCs. (d) The same MCC is segmented …
-
Figure 3—source data 1
Source data related to Figure 3.
- https://cdn.elifesciences.org/articles/66076/elife-66076-fig3-data1-v2.xlsx
Figure 4 with 3 supplements
Mechanical stretch triggers centriole amplification in MCCs.
(a) Schematic showing the effect of cell autonomous pushing (blue) vs. cell non-autonomous pulling forces (red) on cell shape and the thinness ratio (TR). (b) A single MCC (marked by membrane-RFP) …
-
Figure 4—source data 1
Source data related to Figure 4.
- https://cdn.elifesciences.org/articles/66076/elife-66076-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Depletion of β-catenin affects apical area and centriole number in MCCs Stage 28 embryos of (a) controls and (c) β-catenin morphants.
Images are to scale. Mature epidermal MCCs marked with chibby-GFP (centrioles, green), and phalloidin (F-actin, magenta) in (b) control and (d) β-catenin morphant embryos at stage 28. Quantitation …
Figure 4—figure supplement 2
Manipulation of animal caps by cell adhesion and mechanical stretcher.
(a, b) Untethered (grown on agarose) and (c, d) tethered animal caps (grown on fibronectin slides) labeled with phalloidin (F-actin, magenta, b, d) at stage 28. (e) Mechanical stretcher (top view, …
Figure 4—figure supplement 3
Apical area of non-MCCs in untethered/tethered animal caps.
Quantitation of apical area in non-MCCs of control embryos (blue) and animal caps that are untethered (magenta) or tethered (green). * indicates statistical significance at p < 0.05. The statistical …
Figure 5 with 1 supplement
Piezo1 fine tunes centriole amplification and the scaling relation with apical area in the embryos.
(a) Mature epidermal MCCs marked with anti-Piezo1 antibody (magenta) and chibby-GFP (centrioles, green) in X. tropicalis embryos. XZ axis shows that Piezo1 localizes at the same plane as centrioles. …
-
Figure 5—source data 1
Source data related to Figure 5.
- https://cdn.elifesciences.org/articles/66076/elife-66076-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Piezo1 localization at the cell junctions and the bases of cilia in the MCCs.
(a) Mature epidermal MCCs stained using anti-Piezo1 antibody. Box region (b) shows MCCs at increased magnification. Dashed box in (b) indicates the localization of Piezo1 at cell junction. (c) …
Figure 6
Piezo1 dysfunction leads to reduced number of centrioles in MCCs in a tension-dependent manner.
MCCs marked with chibby-GFP (centrioles, green), and phalloidin (F-actin, magenta) in controls and piezo1 morphants in (a) untethered animal caps and (b) tethered animal caps. Quantitation of (c) …
-
Figure 6—source data 1
Source data related to Figure 6.
- https://cdn.elifesciences.org/articles/66076/elife-66076-fig6-data1-v2.xlsx
Videos
Video 1
Centrioles (green) and F-actin (magenta).
Centrioles dispersed below the apical surface of an intercalating MCC.
Video 2
Segmentation and 3D reconstruction of the Video 1 using IMARIS.
Video 3
MCC labeled with membrane-RFP undergoing expansion of its apical surface.
Video 4
Untethered cap forms an irregular spherical structure.
F-actin is in magenta.
Video 5
Tethered animal cap forms a flat multiciliated epithelium.
F-actin is in magenta.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Other | Translation blocking morpholino (X. tropicalis) | b-catenin | 5’-TTTCAACAGTTTCCAAAGAACCAGG-3’ | 7.5–10 ng/ embryo |
| Other | Translation blocking morpholino (X. tropicalis) | ccdc11 | 5’-CATGCTTTCTCCCCAGCCGTGCTGT-3’ | 7.5–10 ng/ embryo |
| Other | Translation blocking morpholino (X. tropicalis) | piezo1 | 5’- CACAGAGGACTTGCAGTTCCATC-3’ | 10 ng/embryo |
| Other | Translation blocking morpholino (X. tropicalis) | standard control | 5’- CCTCTTACCTCAGTTACAATTTATA −3’ | 10 ng/embryo |
| Other | CRISPR (X. tropicalis) | piezo1 | 5’- GGGGCAGAAGGAGCCAAAAC −3’ | 600 ng of sgRNA and2.4 ng of NLS-Cas9 protein (PNABio)/ embryo |
| Antibody | Anti-Piezo1 (Rabbit polyclonal) | Novus | NBP1-78537 | IF (1:25) |
| Recombinant DNA reagent | Chibby-GFP (plasmid) | Kulkarni et al., 2018b | ||
| Recombinant DNA reagent | GFP-Centrin4 | Klos Dehring et al., 2013 | ||
| Recombinant DNA reagent | RFP-Cep152 | Klos Dehring et al., 2013 | ||
| Recombinant DNA reagent | hGR-Mcidas | Stubbs et al., 2012 | ||
| Recombinant DNA reagent | GFP-Sas6 | Stubbs et al., 2012 | ||
| Chemical compound, drug | GSMTx-4 | Abcam | ab141871 | |
| Chemical compound, drug | Centrinone | Tocris | 5687 | |
| Other | Alexa 488 Phalloidin | Thermo Fisher | A12379 | |
| Other | Alexa 647 Phalloidin | Thermo Fisher | A30107 |
