Apical contacts stemming from incomplete delamination guide progenitor cell allocation through a dragging mechanism
- Institute of Biomedical Sciences, Faculty of Medicine, Universidad de Chile, Chile
- Biomedical Neuroscience Institute, Chile
- Institute of Science and Technology Austria, Austria
- Physics Department, FCFM, Universidad de Chile, Chile
- National Center for Health Information Systems, CENS, Chile
- Center for Geroscience, Brain Health and Metabolism, Chile
Figures
Figure 1 with 3 supplements
Dorsal forerunner cells (DFCs) delaminate by apical constriction and retain apical attachments with the enveloping layer (EVL) and yolk syncytial layer (YSL).
(A) Dorsal views of confocal z-stack maximum projections showing the collective vegetal movement of DFCs between shield stage and 100% epiboly in a representative Tg(sox17::GFP) embryo injected with …
-
Figure 1—source data 1
Source data for Figure 1.
- https://cdn.elifesciences.org/articles/66483/elife-66483-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Zonula occludens one protein (ZO-1) and F-actin accumulate at dorsal forerunner cell (DFC)-enveloping layer (EVL) cell junctions.
Dorsal view of DFCs from a 75% epiboly Tg(sox17::GFP) embryo (green) immunostained for ZO-1 (white) and phalloidin (red), with animal to the top. Images correspond to confocal microscopy z-stack …
Figure 1—video 1
Movement of dorsal forerunner cells (DFCs) from the embryo equator to the vegetal pole during epiboly (related to Figure 1A).
Time-lapse video of confocal z-stack maximum projections of a Tg(sox17::GFP) embryo injected with gap43-RFP mRNA, showing cytoplasmic GFP (green) in DFCs from early stages (main cell cluster) and …
Figure 1—video 2
Delamination, apical constriction, and vegetal movement of dorsal forerunner cells (DFCs) during epiboly (related to Figure 1E and F).
Time-lapse video of confocal z-stack maximum projections of an embryo injected with zo1-GFP and gap43-RFP, showing dorsal views at the level of the enveloping layer (EVL) (left, zo1-GFP channel) and …
Figure 2
Vegetally directed polarised protrusions are not required for dorsal forerunner cell (DFC) vegetal movement.
(A) Schematic representation of the DFC cluster showing how cell protrusions extending from the vegetal (orange), lateral (purple), and animal (light blue) edges of the cluster were quantified in …
-
Figure 2—source data 1
Source data for Figure 2.
- https://cdn.elifesciences.org/articles/66483/elife-66483-fig2-data1-v2.xlsx
Figure 3 with 2 supplements
Dorsal forerunner cell (DFC) delamination is asynchronous and coexists with the vegetal movement of DFCs and the enveloping layer (EVL).
(A) Schematic diagram showing the origin of DFCs from the EVL through cell delamination. Apical attachments (AA) that result from apical constriction connect delaminating DFCs with the EVL and YSL …
-
Figure 3—source data 1
Source data for Figure 3.
- https://cdn.elifesciences.org/articles/66483/elife-66483-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Alignment of dorsal forerunner cell (DFC) first principal axis mirrors the alignment of first principal axis of neighbouring enveloping layer (EVL) cells.
Dorsal views of DFCs, EVL cells, and merge from a representative living Tg(sox17:GF) injected with lifeactin-RFP embryo, at 75% of epiboly (top). Spatial representation of the alignment of the first …
Figure 3—video 1
The movement of dorsal forerunner cells (DFCs) parallels the movement of the enveloping cell layer in zebrafish (related to Figure 3D–G).
Time-lapse movie of confocal microscopy z-stack maximum projections of a wild-type embryo injected with h2b-GFP mRNA to label all nuclei (white dots in left and middle panels), and the corresponding …
Figure 4 with 4 supplements
Apical attachments transmit extra-embryonic tissue spreading to guide dorsal forerunner cell (DFC) vegetal movement.
(A, B) Laser disruption of the yolk syncytial layer (YSL) actomyosin network impairs DFC vegetal movements. (A) Dorsal views of a Tg(actb1::myl12.1-GFP) embryo at early shield stage (5.8 hpf) before …
-
Figure 4—source data 1
Source data for Figure 4.
- https://cdn.elifesciences.org/articles/66483/elife-66483-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Genetic disruption of the yolk syncytial layer (YSL) actomyosin network impairs dorsal forerunner cell (DFC) vegetal movement.
(A, B) The YSL actomyosin ring is disrupted in embryos overexpressing N-ter-Mypt1 in the yolk cell. (A) Immunostaining of phospho-myosin light chain II (left), phalloidin (middle), and merge (right) …
Figure 4—video 1
The progress of dorsal forerunner cell (DFC) vegetal movement requires the vegetal spreading of the extra-embryonic yolk syncytial layer/enveloping layer (YSL/EVL) (related to Figure 4A and B).
Time-lapse movie of confocal microscopy z-sections of a Tg(actb1:myl12.1-GFP) embryo at early shield stage (5.8 hpf), focused at the level of the EVL (left panel) and DFCs (right panel), showing the …
Figure 4—video 2
Apical attachments of dorsal forerunner cells (DFCs) are under pulling tension from extra-embryonic tissues (related to Figure 4C–E).
Time-lapse video of confocal microscopy z-sections of a Tg(actb1:myl12.1-GFP) embryo at 70% of epiboly, focused at the level of the enveloping layer (EVL) (left panel) and DFC nuclei (right panel), …
Figure 4—video 3
Apical attachments promote a persistent vegetal movement of attached dorsal forerunner cells (DFCs) (related to Figure 4).
Time-lapse video of confocal microscopy z-stack maximum projections of a Tg(sox17::GFP; actb1::mCherry-utrCH) embryo expressing cytoplasmic GFP (green) in DFCs and F-actin (white) in all cells. …
Figure 5
Apical attachments promote a persistent vegetal movement of attached dorsal forerunner cells (DFCs).
(A) Schematic diagram showing single isolated DFCs transiting the process of delamination far from the main DFC cluster (green). Single isolated DFCs are either transiting delamination and be …
-
Figure 5—source data 1
Source data for Figure 5.
- https://cdn.elifesciences.org/articles/66483/elife-66483-fig5-data1-v2.xlsx
Figure 6 with 2 supplements
Dorsal forerunner cells (DFCs) move to the vegetal pole as a collective despite the increase of detached cells.
(A, B) Individual detached DFCs can leave the main cluster towards the deep cell layer (DCL) during normal development. (A) Schematic diagram showing events of escape (top) and quantification of the …
-
Figure 6—source data 1
Source data for Figure 6.
- https://cdn.elifesciences.org/articles/66483/elife-66483-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Dorsal forerunner cells (DFCs) have endodermal potential and acquire endodermal fate after internalising into the deep cell layer (DCL).
(A) During normal development, delaminated DFCs can leave the main cluster and internalise into the DCL (see Figure 6A and B). Once in the DCL, these cells mimic the morphology and migratory …
Figure 6—video 1
Dorsal forerunner cells (DFCs) can leave the main cluster and internalise into the deep cell layer (DCL) (related to Figure 6A and B).
Time-lapse video of confocal microscopy z-stack maximum projections of a Tg(sox17::GFP) embryo (left and middle panels), and the corresponding merge image with bright field (right panel), showing …
Figure 7
Dorsal forerunner cells (DFCs) increase cell-cell contact and cluster compaction during vegetal movement.
(A) Dorsal view of a 3D cell reconstruction of a single DFC cluster from a Tg(β-actin::HRAS-EGFP) embryo at different time points of collective movement. Individual cells are labelled in different …
-
Figure 7—source data 1
Source data for Figure 7.
- https://cdn.elifesciences.org/articles/66483/elife-66483-fig7-data1-v2.xlsx
Figure 8 with 2 supplements
Contact interactions between dorsal forerunner cells (DFCs) couple the motion of attached and detached cells promoting a clustered collective movement.
(A) Spatial distribution patterns of DFCs in dorsal views of wild-type embryos at shield stage revealed by foxj1a mRNA expression. During DFC formation, these cells are organised at the dorsal …
-
Figure 8—source data 1
Source data for Figure 8.
- https://cdn.elifesciences.org/articles/66483/elife-66483-fig8-data1-v2.xlsx
Figure 8—video 1
Long polarised protrusions promote the initiation of adhesive contacts between dorsal forerunner cells (DFCs) (related to Figure 8).
Time-lapse video of confocal microscopy z-stack maximum projections of a Tg(sox17::GFP) embryo, with an inverted lookup table, showing DFCs at the edge of the cluster producing long polarised …
Figure 8—video 2
Polarised protrusions promote the establishment of adhesive contacts and coalescence of small dorsal forerunner cell (DFC) clusters before losing apical attachments (related to Figure 8J).
Time-lapse movie of confocal microscopy z-stack maximum projections of a Tg(sox17::utrn-GFP) embryo, showing a small cluster of DFCs in the vicinity of a larger central DFC cluster. DFCs at the edge …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Danio rerio, both sex) | AB wild type | ICBM-University of Chile | RRID:ZDB-GENO-960809-7 | |
| Genetic reagent (Danio rerio, both sex) | Tg(sox17::utrn-GFP) | Woo et al., 2012 DOI: 10.1083/jcb.201203012. | RRID:ZFIN-ALT-120911-1 | |
| Genetic reagent (Danio rerio, both sex) | Tg(sox17::GFP) | Sakaguchi et al., 2006 DOI: 10.1242/dev.02581 | RRID:ZFIN-ALT-061228-2 | |
| Genetic reagent (Danio rerio, both sex) | Tg(β-actin::HRAS-EGFP) | Cooper et al., 2005 DOI: 10.1002/dvdy.20252 | ||
| Genetic reagent (Danio rerio, both sex) | Tg(actb1::myl12.1-eGFP) | Behrndt et al., 2012 DOI: 10.1126/science.1224143 | RRID:ZFIN-ALT-130108-2 | |
| Genetic reagent (Danio rerio, both sex) | Tg(actb1::mCherry-utrCH) | Behrndt et al., 2012 DOI: 10.1126/science.1224143 | ||
| Antibody | (Mouse monoclonal) anti-ZO1 | Thermo Fisher Scientific | Cat# 339100 RRID:AB_2533147 | (1:200) |
| Antibody | (Rabbit polyclonal) anti-Phospho-Myosin Light Chain 2 (Ser19) | Cell Signaling | Cat# 3671 RRID:AB_330248 | (1:200) |
| Antibody | (Rabbit polyclonal) anti-Cdh1 | Maitre et al., 2012 DOI: 10.1126/science.1225399 | MPI-CBG (#174) | (1:200) |
| Antibody | (Goat polyclonal) anti-mouse Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-11001 RRID:AB_2534069 | (1:200) |
| Antibody | (Goat polyclonal) anti-rabbit Alexa Fluor 568 | Thermo Fisher Scientific | Cat# A-11011 RRID:AB_143157 | (1:200) |
| Recombinant DNA reagent | pCS2-Gap43-RFP (plasmid) | Reig et al., 2017 DOI: 10.1038/ncomms15431 | Membrane-bound RFP | |
| Recombinant DNA reagent | pCS2-lifeACT-RFP (plasmid) | Behrndt et al., 2012 DOI: 10.1126/science.1224143 | Actin-RFP | |
| Recombinant DNA reagent | pCS2-GFP-zo1-1b (plasmid) | Schwayer et al., 2019 DOI: 10.1016/j.cell.2019.10.006 | Directed to apical junctions | |
| Recombinant DNA reagent | N-ter(1-300aa)-Mypt1 (plasmid) | Jayashankar et al., 2013 DOI: 10.1371/journal.pone.0075766 | Inhibits actomyosin network | |
| Recombinant DNA reagent | pCS2-h2b-GFP (plasmid) | Keller et al., 2008 DOI: 10.1126/science.1162493 | Nuclear GFP | |
| Recombinant DNA reagent | pCS2-foxj1a (plasmid) | Neugebauer et al., 2009 DOI: 10.1038/nature07753 | TAAATCGCAGCTCTTCCTTCCAACG | Foxj1a sequence in pCS2 backbone for riboprobe synthesis |
| Sequence-based reagent | Cadherin-1 (cdh1 MO) | This paper | Gene Tools | TAAATCGCAGCTCTTCCTTCCAACG |
| Commercial assay or kit | mMESSAGE mMACHINE SP6 Transcription Kit | Thermo Fisher Scientific | Cat# AM1340 | |
| Software, algorithm | Fiji | Schindelin et al., 2012 DOI: 10.1038/nmeth.2019 | RRID:SCR_002285 | https://imagej.net/Fiji |
| Software, algorithm | MATLAB | MATLAB Software | RRID:SCR_001622 | https://la.mathworks.com/products/matlab.html |
| Software, algorithm | Volocity | Quorum Technologies Inc | RRID:SCR_002668 | https://quorumtechnologies.com/ |
| Software, algorithm | Origin | OriginLab | RRID:SCR_014212 | https://www.originlab.com/ |
