Canonical NF-κB signaling maintains corneal epithelial integrity and prevents corneal aging via retinoic acid
- Bio-X Institutes, Key Laboratory for the Genetics of Developmental and Neuropsychiatric Disorders, Ministry of Education, Shanghai Jiao Tong University, China
- Department of Ophthalmology, Xinhua Hospital affiliated to Shanghai Jiao Tong University School of Medicine, China
- Institute of Traditional Chinese Medicine and Stem Cell Research, School of Basic Medicine, Chengdu University of Traditional Chinese Medicine, China
Figures
Figure 1 with 3 supplements
Rela ablation in K14+corneal epithelial stem cells impaired corneal regeneration.
(A) Representative western blot results showed enhanced activation of NF-κB in corneal samples during regeneration. The blots were probed with antibodies against RelA, p-RelA, IKKα, or p-IKKα/β. …
-
Figure 1—source data 1
Numeric data used in Figure 1.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
The corneal regeneration process after alkaline burn.
Histological analysis showed the regeneration process of the cornea following NaOH burn in normal mice. Scale bar, 50 µm.
Figure 1—figure supplement 2
Tracing results of Krt14-Cre; ROSA26fs-tdTomato mice.
(A) Lineage tracing in Krt14-Cre; ROSA26fs-tdTomato mice confirmed marking of corneal epithelial cells, limbal corneal epithelial stem cells, conjunctiva, and meibomian glands. Scale bar, 50 µm. (B) …
Figure 1—figure supplement 3
Deletion of Rela in stromal cells did not affect corneal homeostasis or regeneration.
(A) Genetic tracing experiments using Prrx1-Cre; ROSA26fs-tdTomato mice revealed that Prrx1 marked corneal stromal cells. Scale bar, 50 µm. (B) The histology of the cornea was normal in adult Prrx1-C…
Figure 2 with 2 supplements
Rela ablation causes age-dependent epithelial deterioration and plaque formation at the central cornea.
(A) Representative images showed the plaques formed at the central cornea of all 6-month-old Krt14-Cre; Relaf/f mice. n = 10 per group. (B). Representative H/E staining results showed an …
-
Figure 2—source data 1
Numeric data used in Figure 2.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Corneal epithelia shown no alteration in apoptosis in Krt14-Cre; Relaf/f mice.
TUNEL analysis showed normal apoptosis rate in the cornea of 2-month-old Krt14-Cre; Relaf/f mice. Scale bar, 50 µm. n = 6 per group. Data was presented as mean ± SEM. Unpaired two-tailed Student’s …
-
Figure 2—figure supplement 1—source data 1
Numeric data used in Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig2-figsupp1-data1-v2.xlsx
Figure 2—figure supplement 2
The peripheral and limbal regions appeared normal in Krt14-Cre; Relaf/f mice.
Representative H/E staining results showed no changes in peripheral and limbal structures of Krt14-Cre; Relaf/f mice. Scale bar, 50 µm.
Figure 3 with 4 supplements
Stroma remodeling, neovascularization, and metaplasia at central cornea in Krt14-Cre; Relaf/f mice.
(A) Representative immunostaining results showed that vimentin, αSMA, FSP1, CD31, Lyve1, and CD45 signals were increased in 6-month-old Krt14-Cre; Relaf/f mice compared to control mice. Scale bar, …
-
Figure 3—source data 1
Numeric data used in Figure 3.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Krt14-Cre; Relaf/f mice showed fibrosis in the cornea.
Representative Picrosirius sating results of the corneas of the mutant and control mice at 6 months of age. Scale bar, 50 µm.
Figure 3—figure supplement 2
Krt14-Cre; Relaf/f mice showed blood vessels formation and immune cell infiltration at 3 but not 2 months of age.
Representative immunostaining revealed that Krt14-Cre; Relaf/f mice showed blood vessels (CD31+) formation and immune cell infiltration (CD45+) at 3 but not 2 months of age. Scale bar, 50 µm.
Figure 3—figure supplement 3
RNA-seq results of corneal samples of 6-month-old Krt14-Cre; Relaf/f and control mice.
(A) GO biological process analysis of downregulated genes in the corneal epithelial samples of the mutant mice. (B) KEGG disease analysis of up- or downregulated genes in the corneal epithelial …
-
Figure 3—figure supplement 3—source data 1
Numeric data used in Figure 3—figure supplement 3.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig3-figsupp3-data1-v2.xlsx
Figure 3—figure supplement 4
Other tissues marked by K14 were normal in 6-month-old Krt14-Cre; Relaf/f mice.
(A) Alcian blue staining showed that Rela ablation did not affect the structure of the conjunctiva. Right panel: quantitation data of goblet cells. Scale bar, 50 µm. n = 6 per group. (B) H/E …
-
Figure 3—figure supplement 4—source data 1
Numeric data used in Figure 3—figure supplement 4.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig3-figsupp4-data1-v2.xlsx
Figure 4 with 2 supplements
Rela ablation suppresses expression of retinoic acid synthesis enzyme Aldh1a1.
(A) Heatmap of transcriptomes of corneal epithelial samples of 2-month-old Krt14-Cre; Relaf/f and control mice. n = 3 per group. (B) KEGG analysis and GO analysis of corneal epithelial cells of …
-
Figure 4—source data 1
Numeric data used in Figure 4.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
RelA was required for corneal epithelial cell proliferation and differentiation in vitro.
(A) Representative immunostaining showed defects of proliferation (PCNA) and differentiation (K12) of Rela-/- corneal epithelial cells when cultured in the differentiation medium, which were rescued …
-
Figure 4—figure supplement 1—source data 1
Numeric data used in Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig4-figsupp1-data1-v2.xlsx
Figure 4—figure supplement 2
Effects of Rela ablation on Aldha1 expression in conjunctiva and meibomian glands.
Representative immunostaining results of 2-month-old mouse samples. Scale bar, 50 µm.
Figure 5 with 4 supplements
Retinoic acid (RA) diminishes homeostatic and regenerative defects caused by Rela ablation.
(A) Representative images showed that RA blocked Rela ablation-induced plaque formation in Krt14-Cre; Relaf/f mice. Upper panel: diagram showing the time of RA administration and mouse …
-
Figure 5—source data 1
Numeric data used in Figure 5.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Retinoic acid (RA) rescued early epithelial defects but not stroma remodeling or epithelia metaplasia.
(A) Representative histological results showed that RA rescued thinning and disruption of corneal epithelial layer after 1.5 months of treatment. Upper panel: diagram showing the time of RA …
Figure 5—figure supplement 2
Axitinib alleviates epidermal metaplasia and plaque formation in Krt14-Cre; Relaf/f mice.
(A) Quantitative PCR analysis revealed that Vegfa but no other Vegf molecules was increased in corneal stroma samples of Krt14-Cre; Relaf/f mice. n = 3 per group. (B) Representative histological …
-
Figure 5—figure supplement 2—source data 1
Numeric data used in Figure 5—figure supplement 2.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig5-figsupp2-data1-v2.xlsx
Figure 5—figure supplement 3
Enhanced activation of EGFR, Erks, and Stat3 in the metaplastic corneal tissues.
(A) Representative western blot results showed enhanced activation of the Erks, Stat3, and EGFR but not Akt or β-catenin in corneal samples of 6-month-old Krt14-Cre; Relaf/f mice. (B) Representative …
Figure 5—figure supplement 4
Antibiotic levofloxacin did not rescue Rela ablation-induced corneal phenotypes.
(A) Representative H/E staining showed that levofloxacin could not rescue the corneal defects of Krt14-Cre; Relaf/f mice. Upper panel: diagram showing the time of levofloxacin administration and …
Figure 6 with 2 supplements
Natural aging produces similar corneal phenotypes as Krt14-Cre; Relaf/f mice.
(A) The percentages of mice showing corneal epithelial layer thinning (moderate) and plaque formation (severe) at 24 months of age compared to young mice. n = 50. (B) Representative histological …
-
Figure 6—source data 1
Numeric data used in Figure 6.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Apoptosis rate was not affected in the cornea of 24-month-old mice.
TUNEL analysis showed that apoptosis rate was not affected in the cornea of 24-month-old mice compared to young mice. Right panel: quantitation data. Scale bar, 50 µm. n = 6 per group. Data was …
-
Figure 6—figure supplement 1—source data 1
Numeric data used in Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig6-figsupp1-data1-v2.xlsx
Figure 6—figure supplement 2
The peripheral and limbal regions appeared unaltered in aged mice.
Representative H/E staining results showed no changes in peripheral and limbal structures of aged mice. Scale bar, 50 µm.
Figure 7 with 1 supplement
Retinoic acid (RA) supplementation prevents development of aging-like corneal phenotypes.
(A) Representative western blot results showed decreased levels of RelA, p-RelA, and Aldh1a1 in the corneal samples of 24-month-old mice (with thinner epithelial layer) compared to young mice. Right …
-
Figure 7—source data 1
Numeric data used in Figure 7.
- https://cdn.elifesciences.org/articles/67315/elife-67315-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
Retinoic acid (RA) prevented increase of K14 in aged mice.
Representative immunostaining showed that RA prevented increase of K14 in aged mice. Scale bar, 50 µm.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | Relaf/f | The Jackson Laboratory | RRID:IMSR_JAX:024342 | Stock No: 024342 |
| Genetic reagent (M. musculus) | Krt14-cre | The Jackson Laboratory | RRID:IMSR_JAX:004782 | Stock No: 004782 |
| Genetic reagent (M. musculus) | Prrx1-cre | The Jackson Laboratory | RRID:IMSR_JAX:005584 | Stock No: 005584 |
| Genetic reagent (M. musculus) | ROSA26fs-tdTomato | The Jackson Laboratory | RRID:IMSR_JAX:007914 | Stock No: 007914 |
| Antibody | Rabbit monoclonal to K12 | Abcam | Cat# ab185627, RRID:AB_2889825 | IF(1:200) |
| Antibody | Rabbit monoclonal to vimentin | Abcam | Cat# ab92547, RRID:AB_10562134 | IF(1:100) |
| Antibody | Rabbit polyclonal to ɑSMA | Abcam | Cat# ab5694, RRID:AB_2223021 | IF(1:100) |
| Antibody | Rat monoclonal to CD31 | Abcam | Cat# ab56299, RRID:AB_940884 | IF(1:100) |
| Antibody | Rabbit polyclonal to CD45 | Abcam | Cat# ab10558, RRID:AB_442810 | IF(1:100) |
| Antibody | Rabbit monoclonal to p63 | Abcam | Cat# ab124762, RRID:AB_10971840 | IF(1:100) |
| Antibody | Rabbit monoclonal to FSP1 | Abcam | Cat# ab197896, RRID:AB_2728774 | IF(1:100) |
| Antibody | Rabbit monoclonal to p-EGF receptor (Tyr1068) | Cell Signaling Technology | Cat# 3777, RRID:AB_2096270 | IF(1:100) WB(1:1000) |
| Antibody | Rabbit monoclonal to p-Stat3 (Tyr705) | Cell Signaling Technology | Cat# 9145, RRID:AB_2491009 | IF(1:100) WB(1:1000) |
| Antibody | Mouse monoclonal to Stat3 | Cell Signaling Technology | Cat# 9139, RRID:AB_331757 | WB(1:1000) |
| Antibody | Rabbit monoclonal to p-Erk1/2 (Thr202/Tyr204) | Cell Signaling Technology | Cat# 9101, RRID:AB_331646 | IF(1:100) WB(1:1000) |
| Antibody | Mouse monoclonal to Erk1/2 | Cell Signaling Technology | Cat# 9107, RRID:AB_10695739 | WB(1:1000) |
| Antibody | Rabbit monoclonal to RelA | Cell Signaling Technology | Cat# 8242, RRID:AB_10859369 | IHC(1:100) CHIP(1:100) |
| Antibody | Rabbit monoclonal to p-RelA (Ser536) | Cell Signaling Technology | Cat# 3033, RRID:AB_331284 | WB(1:1000) |
| Antibody | Rabbit monoclonal to RelA | Cell Signaling Technology | Cat# 4764, RRID:AB_823578 | WB(1:1000) |
| Antibody | Rabbit monoclonal to p-Akt (Ser473) | Cell Signaling Technology | Cat# 4060, RRID:AB_2315049 | WB(1:1000) |
| Antibody | Rabbit monoclonal to Akt | Cell Signaling Technology | Cat# 9272, RRID:AB_329827 | WB(1:1000) |
| Antibody | Rabbit monoclonal to p-IKKɑ/β (Ser176/180) | Cell Signaling Technology | Cat# 2697, RRID:AB_2079382 | WB(1:1000) |
| Antibody | Rabbit polyclonal to IKKɑ | Cell Signaling Technology | Cat# 2682, RRID:AB_331626 | WB(1:1000) |
| Antibody | Rabbit polyclonal to K1 | BioLegend | Cat# 905601, RRID:AB_2565051 | IF(1:200) |
| Antibody | Rabbit polyclonal to Pax6 | BioLegend | Cat# 901302, RRID:AB_2749901 | IF(1:200) |
| Antibody | Mouse monoclonal to LYVE-1 | Reliatech | Cat#103PA50AG, RRID:AB_2876870 | IF(1:100) |
| Antibody | Rabbit polyclonal to ALDH1A1 | Proteintech | Cat# 15910-1-AP, RRID:AB_2305276 | IF(1:100) |
| Antibody | Rabbit polyclonal to Ki-67 | Thermo Fisher Scientific | Cat# PA5-19462, RRID:AB_10981523 | IF(1:100) |
| Antibody | Mouse monoclonal to PCNA | Santa Cruz Biotechnology | Cat# sc-56, RRID:AB_628110 | IF(1:100) |
| Antibody | Rabbit polyclonal to β-catenin | Santa Cruz Biotechnology | Cat# sc-7199, RRID:AB_634603 | WB(1:1000) |
| Antibody | Mouse monoclonal to β-actin | Santa Cruz Biotechnology | Cat# sc-47778, RRID:AB_626632 | WB(1:5000) |
| Antibody | Anti-rabbit IgG, HRP-linked Antibody | Cell Signaling Technology | Cat# 7074, RRID:AB_2099233 | WB(1:5000) |
| Antibody | Anti-mouse IgG, HRP-linked Antibody | Cell Signaling Technology | Cat# 7076, RRID:AB_330924 | WB(1:5000) |
| Antibody | Goat anti-Rabbit IgG Secondary Antibody, Alexa Fluor488 | Thermo Fisher Scientific | Cat# A-11008, RRID:AB_143165 | IF(1:200) |
| Antibody | Goat anti-Mouse IgG Secondary Antibody, Alexa Fluor488 | Thermo Fisher Scientific | Cat# A-11001, RRID:AB_2534069 | IF(1:200) |
| Antibody | Goat anti-Rat IgG Secondary Antibody, Alexa Fluor488 | Thermo Fisher Scientific | Cat# A-11006, RRID:AB_2534074 | IF(1:200) |
| Sequence-based reagent | RT-qPCR primers | This paper | See Table 1 | |
| Sequence-based reagent | CHIP primers | This paper | See Table 2 | |
| Commercial assay or kit | PrimeScript RT reagent Kit | TAKARA | RR037A | |
| Commercial assay or kit | Fast Start Universal SYBR Green Master kit | Roche | 04887352001 | |
| Commercial assay or kit | SimpleChIP Enzymatic Chromatin IP Kit | Cell Signaling Technology | #9002 | |
| Chemical compound, drug | Retinoic acid | Sigma-Aldrich | Cat# R2625 | |
| Chemical compound, drug | BMS493 | Sigma-Aldrich | Cat# B6688 | |
| Chemical compound, drug | Axitinib | Selleck Chemicals | Cat# S1005 | |
| Chemical compound, drug | 0.5% Levofloxacin Eye Drops | Santen | N/A | |
| Chemical compound, drug | EZ-Link Sulfo-NHS-LC-Biotin | Thermo Fisher Scientific | Cat# A39257 | |
| Software, algorithm | ImageJ | (http://imagej.nih.gov/ij/) | ||
| Software, algorithm | GraphPad Prism 8 | https://www.graphpad.com | RRID:SCR_015807 | Version 8 |
Table 1
Quantitative PCR primer sequences used in the study.
| Gene | Forward primer | Reverse primer |
|---|---|---|
| Krt12 | CATGGCTGAGCAAAATCGGAA | CAGGGACGACTTCATGGCG |
| Rela | AGGCTTCTGGGCCTTATGTG | TGCTTCTCTCGCCAGGAATAC |
| Aldh1a1 | ATACTTGTCGGATTTAGGAGGCT | GGGCCTATCTTCCAAATGAACA |
| Krt1 | TGGGAGATTTTCAGGAGGAGG | GCCACACTCTTGGAGATGCTC |
| Krt10 | CGAAGAGCTGGCCTACCTAAA | GGGCAGCGTTCATTTCCAC |
| Vegfa | GCACATAGGAGAGATGAGCTTCC | CTCCGCTCTGAACAAGGCT |
| Vegfb | GCCAGACAGGGTTGCCATAC | GGAGTGGGATGGATGATGTCAG |
| Vegfc | GAGGTCAAGGCTTTTGAAGGC | CTGTCCTGGTATTGAGGGTGG |
| Vegfd | TTGAGCGATCATCCCGGTC | GCGTGAGTCCATACTGGCAAG |
Table 2
Primer sequences used for chromatin immunoprecipitation assays.
| Gene | Predictive binding site | Forward sequence | Reverse sequence |
|---|---|---|---|
| Aldh1a1 | S1: GCGAATTTCC | AACATCTTGGGGTGCATTGC | TAGCTAGGGGAGGAACAGGG |
| S2: GGGACTTTTC | ATGATTCACAAGTGCACGCA | CAGAATCTTCGCATTGTCTTTGT | |
| S3: GGGATCTTCC | TGTTTGGGAATTGGCCTGAG | AGCCTGCTTCTCTCTCTCTC |
