1. Cell Biology
  2. Developmental Biology

Canonical NF-κB signaling maintains corneal epithelial integrity and prevents corneal aging via retinoic acid

  1. Qian Yu
  2. Soma Biswas
  3. Gang Ma
  4. Peiquan Zhao
  5. Baojie Li  Is a corresponding author
  6. Jing Li  Is a corresponding author
  1. Bio-X Institutes, Key Laboratory for the Genetics of Developmental and Neuropsychiatric Disorders, Ministry of Education, Shanghai Jiao Tong University, China
  2. Department of Ophthalmology, Xinhua Hospital affiliated to Shanghai Jiao Tong University School of Medicine, China
  3. Institute of Traditional Chinese Medicine and Stem Cell Research, School of Basic Medicine, Chengdu University of Traditional Chinese Medicine, China
https://doi.org/10.7554/eLife.67315
Share this article
Cite this article
  1. Qian Yu
  2. Soma Biswas
  3. Gang Ma
  4. Peiquan Zhao
  5. Baojie Li
  6. Jing Li
(2021)
Canonical NF-κB signaling maintains corneal epithelial integrity and prevents corneal aging via retinoic acid
eLife 10:e67315.
https://doi.org/10.7554/eLife.67315
  2. Download BibTeX
  3. Download .RIS

Abstract

Disorders of the transparent cornea affect millions of people worldwide. However, how to maintain and/or regenerate this organ remains unclear. Here, we show that Rela (encoding a canonical NF-κB subunit) ablation in K14+ corneal epithelial stem cells not only disrupts corneal regeneration but also results in age-dependent epithelial deterioration, which triggers aberrant wound-healing processes including stromal remodeling, neovascularization, epithelial metaplasia, and plaque formation at the central cornea. These anomalies are largely recapitulated in normal mice that age naturally. Mechanistically, Rela deletion suppresses expression of Aldh1a1, an enzyme required for retinoic acid synthesis from vitamin A. Retinoic acid administration blocks development of ocular anomalies in Krt14-Cre; Relaf/f mice and naturally aged mice. Moreover, epithelial metaplasia and plaque formation are preventable by inhibition of angiogenesis. This study thus uncovers the major mechanisms governing corneal maintenance, regeneration, and aging and identifies the NF-κB-retinoic acid pathway as a therapeutic target for corneal disorders.

Introduction

The cornea is a transparent organ composed of the epithelial, stromal, and endothelial layers (Yazdanpanah et al., 2017; Nowell and Radtke, 2017; Collinson et al., 2004), with the epithelial basement membrane separating the epithelial and the stroma layers and the Descemet’s basement membrane separating the stroma and endothelial layers (Wilson, 2020; Medeiros et al., 2018). While the epithelial layer undergoes constant turnover driven by corneal epithelial stem cells (CESCs), the stromal and endothelial layers are relatively quiescent in adults (Castro-Muñozledo, 2013; Majo et al., 2008; Schlötzer-Schrehardt and Kruse, 2005). Corneal transparency is attributable to the lack of keratin secretion by epithelial cells, the specific arrangement of stromal lamellae, expression of crystallins by keratocytes, and the lack of vasculature (Nowell and Radtke, 2017; Jester, 2008; Yam et al., 2020). The cornea contributes 65–75% of the eye’s total focusing power and provides a barrier to protect against environmental insults (Yazdanpanah et al., 2017). Thus, a clear and healthy cornea is a prerequisite for proper vision.

As the outermost part of the eye, the cornea is often challenged by external stimuli, including UV radiation, chemicals, traumatic abrasions, or bacterial infection (Nowell and Radtke, 2017; Lyu et al., 2020). In addition, contact lens usage and eye surgery can also cause corneal injuries (Toda, 2008). The damaged corneal epithelial layer is replenished by CESCs, which are mainly located in the limbal region in humans and genetically identified by ABCB2, ABCB5, keratin5/14, or p63 expression in mice (Schlötzer-Schrehardt and Kruse, 2005; Notara et al., 2010; Cotsarelis et al., 1989; Di Iorio et al., 2005; Ksander et al., 2014). Corneal repair often involves inflammation and activation of keratocytes and improper repair may cause epithelial degeneration and dystrophy, scar formation, neovascularization, and the loss of transparency, which affect millions of people worldwide, eventually necessitating corneal transplantation, which is limited by a lack of corneal donors (Wong et al., 2017; Ljubimov and Saghizadeh, 2015).

Several studies have revealed cross-talks between the stromal and epithelial layers during corneal development and regeneration (AbuSamra et al., 2019; Dziasko and Daniels, 2016). Growth factors secreted by keratocytes, particularly Wnt and EGF, promote epithelial cell proliferation via transcription factors such as β-catenin and Pax6 (Nakatsu et al., 2011; Ouyang et al., 2014; McClintock and Ceresa, 2010; Kumar and Duester, 2010). In addition, keratocytes and immune cells also secrete cytokines, such as IL6, to promote epithelial cell proliferation during repair (Notara et al., 2010). On the other hand, corneal epithelial cells secrete fibroblast growth factors (FGF) to promote stromal cell proliferation (Vauclair et al., 2007). Still, how corneal epithelial and stromal layers interact under pathological conditions is not well understood.

Many environmental insults to the cornea are potential activators of NF-κB, which is a central player in the inflammatory response and cell proliferation and survival (Taniguchi and Karin, 2018; Eluard et al., 2020). Previous studies have reported NF-κB activation in corneal epithelial cells, macrophages, and keratocytes, which is required for cytokine production, corneal regeneration, and fibrosis (Zhou et al., 2021; Nakano et al., 2018; Lennikov et al., 2018; Orita et al., 2013; Oh et al., 2012; Chen et al., 2016). NF-κB activation may promote corneal healing via upregulating the expression of CCCTC-binding factors in epithelial cells (Wang et al., 2013). To further understand the functions of the NF-κB pathway in corneal homeostasis and regeneration, we ablated Rela, which encodes a subunit of canonical NF-κB signaling complex, in K14+ CESCs or keratocytes. While Rela ablation in keratocytes did not affect corneal homeostasis or regeneration, Krt14-Cre; Relaf/f mice showed age-dependent deterioration in the epithelial layer at the central cornea, which triggered an aberrant repair response that led to inflammation, neovascularization, epithelial metaplasia, and plaque formation at the central cornea. Interestingly, these corneal phenotypes were largely recapitulated in naturally aged mice, associated with decreased NF-κB activation and RelA expression. Mechanistically, NF-κB positively regulated Aldh1a1 transcription and retinoic acid (RA) synthesis from vitamin A and that the development of corneal phenotypes in Rela-deficient mice or naturally aged mice was largely prevented by RA administration. While vitamin A deficiency is known to cause night blindness, corneal ulcers, and eye development defects, mainly in children (Smith et al., 2018; Fares-Taie et al., 2013; Srour et al., 2013; Yahyavi et al., 2013; Verhoeven et al., 2013), we show for the first time that RA, the metabolic product of vitamin A, is critical in corneal regeneration and aging in mice, implying that RA has the potential to improve corneal health in adult and aged individuals.

Results

Rela ablation in K14+ CESCs, but not stromal cells, impairs corneal regeneration

The ocular surface is constantly exposed to environmental stimuli, many of which are NF-κB activators (Eluard et al., 2020). Indeed, western blot analysis revealed activation of NF-κB in the corneal tissues of standard housed mice, as indicated by the presence of p-RelA and p-IKKα (Figure 1A). Immunohistochemical staining confirmed nuclear accumulation of RelA in the central region but not much in peripheral or limbal epithelial cells (Figure 1B). Activation of NF-κB signaling was also observed in corneal stromal cells, although to a reduced extent (Figure 1B). NF-κB activation was increased in both epithelial and stromal cells after alkaline burn (Figure 1A, B and Figure 1—figure supplement 1). This finding is consistent with the notion that the basal activity of NF-κB is low but activated during wound healing (Zhang et al., 2017) and suggests that NF-κB is involved in corneal regeneration.

Figure 1 with 3 supplements see all
Download asset Open asset
Rela ablation in K14+corneal epithelial stem cells impaired corneal regeneration.

(A) Representative western blot results showed enhanced activation of NF-κB in corneal samples during regeneration. The blots were probed with antibodies against RelA, p-RelA, IKKα, or p-IKKα/β. Right panel: quantitation results. n = 3 per group. (B) Representative immunohistochemical staining results showed nuclear localization of RelA in epithelial and stromal cells in normal and regenerating corneas. Arrowheads: RelA signals. Scale bar, 50 µm. Right panel: quantitation results. n = 3 views/sample × 3 samples per group. (C) Western blot results showed that RelA level was drastically reduced in Krt14-Cre; Relaf/f mouse corneal samples. Right panel: quantitation results. n = 3 per group. (D) Histological analyses revealed that cornea repair was defective in Krt14-Cre; Relaf/f mice. The cornea sections were stained with H/E or antibodies against PCNA, K12, or laminin. Scale bar, 50 µm. Upper panel: diagram showing the time of injury and mouse euthanization. Right panel: quantitation results. n = 6 per group. Data was presented as mean ± SEM. Unpaired two-tailed Student’s t-test was applied for (A, C), and two-way ANOVA was applied in (B, D). p-value<0.05 was considered as statistically significant.

Figure 1—source data 1

Numeric data used in Figure 1.

https://cdn.elifesciences.org/articles/67315/elife-67315-fig1-data1-v2.xlsx

We then crossed Relaf/f and Krt14-Cre mice to generate Krt14-Cre; Relaf/f mice to study the functions of canonical NF-κB signaling in corneal epithelial homeostasis. Consistent with previous studies (Zhao et al., 2008), lineage tracing with Krt14-Cre; ROSA26 fs-tdTomato mice showed Tomato+ labeling of corneal epithelial cells, limbal CESCs, conjunctiva, and meibomian glands, as well as the skin, oral mucosa, and trachea but not intestinal epithelial cells (Figure 1—figure supplement 2A, B). The corneas of young Krt14-Cre; Relaf/f mice appeared normal up to 6 weeks of age (Figure 1C , D), suggesting that the canonical NF-κB pathway is dispensable for corneal epithelial development and early postnatal growth. In the mutant mice, expression of K14, a CESC marker, was not affected in central or peripheral cornea or the limbus (Figure 1—figure supplement 2C), suggesting that the genetic manipulation of the Krt14 or Rela locus or Rela ablation does not affect K14 expression.

When 4-week-old Krt14-Cre; Relaf/f mice were subjected to alkaline burn on the ocular surface, severe defects in corneal wound healing were observed (Figure 1D). We used 4-week-old mice to exclude possible effects of corneal growth defects on regeneration as the corneas of Krt14-Cre; Relaf/f mice started to show anomalies at 6 weeks of age. Unlike the controls, the regenerated corneal epithelium lacked a basal layer and epithelial basement membrane (Figure 1D). Immunostaining revealed the absence of differentiation marker K12, decreased numbers of PCNA+ proliferating cells, and disrupted Laminin+ basement membrane at the injury sites, although these anomalies were not observed in the peripheral or limbal epithelia (Figure 1D and Figure 1—figure supplement 2D). Overall, these results indicate that Rela ablation impairs central corneal epithelial cell proliferation and differentiation during regeneration.

To study the function of RelA in keratocytes, we generated Prrx1-Cre; Relaf/f mice. Prrx1 is a marker for mesenchymal stromal cells, and the Prrx1-Cre mice have been widely used to study skeletal development (Logan et al., 2002). Our genetic tracing with Prrx1-Cre; ROSA26fs-tdTomato mice revealed that Prrx1 marked most corneal stromal cells (Figure 1—figure supplement 3A). Prrx1-Cre; Relaf/f mice had a normal corneal structure, and the healing process after alkaline burn injury was normal compared to that of controls (Figure 1—figure supplement 3B, C). A previous study showed that the deletion of Ikkb, which encodes a kinase required for activation of both canonical and noncanonical NF-κB pathways, in keratocytes (via Keratocan-Cre) impaired corneal repair but not maintenance (Chen et al., 2016). These results suggest that the non-canonical rather than the canonical NF-κB pathway in stromal cells plays a role in corneal regeneration.

Rela ablation causes age-dependent epithelial deterioration at the central cornea

Further analysis of Krt14-Cre; Relaf/f mice revealed age-dependent changes in corneal structures, including visible plaques at the central cornea by 6 months of age (Figure 2A). Histological analysis showed that the mutant mice had largely normal corneas up to 1.5 months of age. However, at 2 months of age, the mutant mice showed basal cell atrophy at the central cornea, and the degenerative changes expanded to suprabasal cells at the age of 2.5 months (Figure 2B). By 3 months of age, the central corneal epithelium had disappeared. In 2-month-old mutant mice, the central cornea had fewer PCNA+ or p63+ cells and showed decreased expression of K12 at the mRNA and protein levels (Figure 2C–E). However, the number of apoptotic cells, which were mainly detected at the central region, remained similar between the mutant and control mice (Figure 2—figure supplement 1). The integrity of the epithelial layer was disrupted as the corneal epithelial layer could be scraped off more easily in mutant mice than in control mice (Figure 2F). In addition, we observed drastic LC-biotin diffusion from outside the epithelial layer into the stroma in 2- but not 1-month-old mutant mice (Figure 2G).

Figure 2 with 2 supplements see all
Download asset Open asset
Rela ablation causes age-dependent epithelial deterioration and plaque formation at the central cornea.

(A) Representative images showed the plaques formed at the central cornea of all 6-month-old Krt14-Cre; Relaf/f mice. n = 10 per group. (B). Representative H/E staining results showed an age-dependent change in cornea structures of Krt14-Cre; Relaf/f mice. Scale bar, 50 µm. (C). Representative immunostaining results showed that both epithelial proliferation and differentiation were defective in 2-month-old Krt14-Cre; Relaf/f mice. Cornea sections were stained for PCNA, p63, or K12. Scale bar, 50 µm. (D). Quantitation data of PCNA+ proliferating cells. n = 6 per group. (E). qPCR analysis showed that K12 mRNA levels were decreased in 2-month-old Krt14-Cre; Relaf/f mouse corneal epithelial samples compared to control samples. n = 3 per group. (F). Corneal fragility assay showed that corneal epithelial layer was scraped off more easily in mutant mice than control mice. Scale bar, 50 µm. Right panel: quantitation results. n = 10 per group. (G). LC-biotin staining assays showed that the integrity of the epithelial layer was disrupted in 2- but not 1-month-old Krt14-Cre; Relaf/f mice. Scale bar, 50 µm. Right panel: quantitation results. n = 10 per group. Data was presented as mean ± SEM. Unpaired two-tailed Student’s t-test was applied in (D, E). p-value<0.05 was considered as statistically significant.

Figure 2—source data 1

Numeric data used in Figure 2.

https://cdn.elifesciences.org/articles/67315/elife-67315-fig2-data1-v2.xlsx

Interestingly, the peripheral and limbal regions appeared unaltered in Krt14-Cre; Relaf/f mice (Figure 2—figure supplement 2), and the numbers of PCNA+ proliferating cells and p63+ CESCs were similar to those of control mice (Figure 2c). Overall, these findings indicate that RelA is required for corneal epithelial cell proliferation and differentiation mainly at the central cornea under homeostatic and repair conditions. This is consistent with greater activation of NF-κB in the central cornea than the peripheral cornea and limbus (Figure 1B), which may be caused by constant exposure of the central cornea to external environment.

Stromal remodeling and neovascularization follow epithelial deterioration

The changes in the central corneal epithelium were followed by remodeling of the stroma underneath the epithelial layer in the mutant mice (Figure 2B). Beginning at 3 months of age, we found keratocyte hyperproliferation, leukocyte infiltration, and generation of blood and lymphatic channels, which progressed with advancing age. Immunofluorescent staining further supported the histological results, with the observation of cells that stained positive for CD31, Lyve1, or CD45 in the stroma (Figure 3A). The stromal cells expressed high levels of vimentin (a fibroblast marker) but not αSMA (a myofibroblast and smooth muscle marker) (Medeiros et al., 2018). It also showed increased expression of fibroblast-specific protein 1 (FSP1) and increased Picrosirius red staining signals (Figure 3A and Figure 3—figure supplement 1). These results suggest that stroma expansion was not typical fibrosis in Krt14-Cre; Relaf/f mice. Stromal remodeling has been observed in mouse models fed a vitamin A-deficient diet or with epithelial-specific Notch1 ablation (Toshino et al., 2005; Nowell et al., 2016). In Krt14-Cre; Relaf/f mice, stroma remodeling was likely secondary to deterioration of the epithelial layer as it only occurred after 3 months of age when the epithelial layer had been disrupted (Figure 3—figure supplement 2).

Figure 3 with 4 supplements see all
Download asset Open asset
Stroma remodeling, neovascularization, and metaplasia at central cornea in Krt14-Cre; Relaf/f mice.

(A) Representative immunostaining results showed that vimentin, αSMA, FSP1, CD31, Lyve1, and CD45 signals were increased in 6-month-old Krt14-Cre; Relaf/f mice compared to control mice. Scale bar, 50 µm. (B) Representative immunostaining results showed that PCNA and p63 signals were increased at the central cornea but not the limbus in 6-month-old Krt14-Cre; Relaf/f mice compared to control mice. Scale bar, 50 µm. Right panel: quantitation data. n = 6 per group. (C) Heatmap of top 2000 genes expressed in the corneal epithelia of 6-month-old Krt14-Cre; Relaf/f mice compared to control mice. n = 3 per group. (D) GO biological process analysis of upregulated genes in the mutant samples. (E) Heatmap of keratin genes expressed in corneal epithelial samples of 6-month-old Krt14-Cre; Relaf/f mice compared to control mice. n = 3 per group. (F) Representative immunostaining results for K12, K1, and Pax6 in the corneal epithelia of 6-month-old Krt14-Cre; Relaf/f mice. Scale bar, 50 µm. (G) Tracing of Tomato+ cells revealed that K1-expressing dermal-like cells were derived from K14+ cells. Six-month-old Krt14-Cre; Relaf/f; ROSA26fs-tdTomato mice were used. Scale bar, 50 µm. Data was presented as mean ± SEM. Unpaired two-tailed Student’s t-test was applied in (B). p-value<0.05 was considered as statistically significant.

Figure 3—source data 1

Numeric data used in Figure 3.

https://cdn.elifesciences.org/articles/67315/elife-67315-fig3-data1-v2.xlsx

Epithelial cells convert to epidermal cells and form plaques at the central cornea

Intriguingly, a new layer of epithelium formed at 5 months of age in the mutant mice. By 6 months, the central cornea was covered by a thick layer of keratin and epithelium with invagination into the underlying stroma (Figure 2B), which are features characteristic of hyperproliferative skin. This finding is consistent with our observation that more basal cells and cells immediately above the basal cells, but not limbal cells, were positive for PCNA (Figure 3B).

To examine the identity and features of the newly formed epithelium, we separated the epithelial layers of 6-month-old Krt14-Cre; Relaf/f and age-matched control mice and performed RNA-seq analysis (Figure 3C and Figure 3—figure supplement 3A, B). We found that the most highly enriched genes in the mutant samples were epidermal-related genes, in addition to protein synthesis and cell cycle genes (Figure 3D, E and Figure 3—figure supplement 3C). Immunostaining confirmed the switch from the expression of corneal epithelium-specific K12 to epidermal-specific K1 and loss of Pax6 expression (Figure 3F), confirming the occurrence of metaplasia in corneal epithelial cells.

Next, we generated Krt14-Cre; Relaf/f; ROSA26 fs-tdTomato mice. Tracing at 6 months of age revealed that the excessively proliferative dermal-like cells were all Tomato+ (Figure 3G), indicating that these cells were derived from either the remaining K14+ cells at the central cornea or K14+ cells at the peripheral cornea. Corneal cell metaplasia has been observed in mouse models of chronic inflammation, Pax6-deficient mice, or in mice fed a vitamin A-deficient diet and is believed to occur in stem cells or progenitor cells (Ouyang et al., 2014; Vauclair et al., 2007; Nowell et al., 2016; Chen et al., 2009). Collectively, these data suggest that epidermal-like cells originate from corneal epithelial progenitors, which undergo metaplastic changes in the central region in the presence of remodeling stroma in Krt14-Cre; Relaf/f mice.

Although genetic tracing showed the presence of K14-labeled epithelial cells in the conjunctiva, meibomian glands, and epithelial cells of many other organs (Figure 1—figure supplement 2A, B), Rela ablation did not affect conjunctiva or meibomian glands, as well as the overall structure of the skin, oral mucosa, trachea, or intestine epithelia (Figure 3—figure supplement 4A–C). These results suggest that the effects of RelA are restricted to the central cornea, which may be caused by mitogenic signals secreted by the remodeling stroma, in cooperation with environmental cues.

RelA is required for corneal epithelial proliferation and differentiation in vitro

To validate the roles of RelA in corneal epithelial cell proliferation and differentiation, we isolated corneal epithelial cells and briefly expanded them in proliferation medium (KSFM) before switching them to the differentiation medium. We found that Rela-/- cells showed drastic defects in proliferation, as indicated by a reduction in the number of PCNA+ cells, and differentiation, as indicated by decreased expression of K12 at the mRNA and protein levels (Figure 4—figure supplement 1A, B). However, the epidermal markers K1 and K10 were not detectable in Rela-/- or control cultures (Figure 4—figure supplement 1C). These results confirm the positive roles of RelA in corneal epithelial cell proliferation and differentiation and suggest that the subsequent epidermal conversion and plaque formation may not be cell autonomous. Rather, niche molecules provided by the stroma may play an important role in these events.

Rela ablation suppresses Aldh1a1 expression and RA synthesis

To further understand the mechanisms underlying Rela deletion-induced corneal defects, we isolated mRNA from the corneal epithelial cells of 2-month-old Krt14-Cre; Relaf/f and control mice and performed bulk RNA-seq analysis. Rela ablation drastically affected the gene expression of corneal epithelial cells (Figure 4A). Gene ontology (GO) and kyoto encyclopedia of genes and genomes (KEGG) analyses revealed that Rela ablation led to a severe reduction in the expression of the RA synthesis enzyme Aldh1a1, as well as pathways that control cell proliferation, wound healing, and inflammation (Figure 4B, C), consistent with our in vivo results. RA is synthesized from vitamin A via two steps, and the first step is catalyzed by ADH/RDH, while the second step is catalyzed by Aldh1a1-3 (Ghyselinck and Duester, 2019). RA binds to RA receptors (RARs) and RA X receptors (RXRs) to control gene expression. RA is known to play important roles in corneal development and epithelial cell differentiation, and vitamin A deficiency causes night blindness, corneal ulcers, and keratomalacia, mainly in children (Kastner et al., 1994; Lassen et al., 2007; Kim et al., 2012; Macsai et al., 1998). Whole-body deletion of Aldh1a genes causes xerophthalmia, as well as thinning of the stromal layer in young mice, which is followed by reduced proliferation and increased apoptosis of epithelial cells (Kumar et al., 2017). We confirmed that the mRNA levels Aldh1a1 were decreased in Rela-deficient corneal samples (Figure 4D). Western blot and immunostaining confirmed decreased Aldh1a1 expression at the protein level in Rela-deficient samples (Figure 4E, F). These results suggest that RA synthesis is defective in the corneas of Krt14-Cre; Relaf/f mice. Immunostaining revealed reduced expression of Aldh1a1 in the limbus and conjunctiva while the meibomian glands do not express Aldh1a1 (Figure 4F and Figure 4—figure supplement 2). The observation that the limbus and conjunctiva did not show obvious defects in Krt14-Cre; Relaf/f mice indicates that the function of RA is also restricted to the central cornea.

Figure 4 with 2 supplements see all
Download asset Open asset
Rela ablation suppresses expression of retinoic acid synthesis enzyme Aldh1a1.

(A) Heatmap of transcriptomes of corneal epithelial samples of 2-month-old Krt14-Cre; Relaf/f and control mice. n = 3 per group. (B) KEGG analysis and GO analysis of corneal epithelial cells of 2-month-old Krt14-Cre; Relaf/f and control mice. Both upregulated (up) and downregulated (down) pathways or modules were presented. (C) Heatmap of retinoic acid synthesis genes in corneal epithelial cells of 2-month-old Krt14-Cre; Relaf/f mice compared to control mice. n = 3 per group. (D) Quantitative PCR showed downregulation of Aldh1a1 expression in corneal epithelial samples of Krt14-Cre; Relaf/f mice. n = 3 per group. (E) Representative western blot results showed that Aldh1a1 protein level was reduced in corneal samples of Krt14-Cre; Relaf/f mice. Right panel: quantitation data. n = 3 per group. (F) Representative immunostaining results showed downregulation of Aldh1a1 in Krt14-Cre; Relaf/f mouse cornea. Scale bar, 50 µm. (G) Sequence logos of 10-mer RelA-binding motif. (H) Schematic presentation of the putative RelA-binding site in the promoter region of Aldh1a1. (I) Quantitative PCR analysis of the immunoprecipitated DNA showed that Aldh1a1 promoter had a RelA-binding site. n = 3 per group. Data was presented as mean ± SEM. Unpaired two-tailed Student’s t-test was applied in (D, E, I). p-value<0.05 was considered as statistically significant.

Figure 4—source data 1

Numeric data used in Figure 4.

https://cdn.elifesciences.org/articles/67315/elife-67315-fig4-data1-v2.xlsx

We also confirmed the decrease in Aldh1a1 mRNA in cultured Rela-/- corneal epithelial cells compared to control cells (Figure 4—figure supplement 1B). Furthermore, we found that the promoter of Aldh1a1 contained a putative NF-κB binding site (G/CGGA/GATTTCC) between −1164 and −1155 (Figure 4G, H). We then performed chromatin immunoprecipitation (ChIP) assays using anti-RelA antibodies in primary corneal epithelial cells. The ChIP results verified the presence of the NF-κB binding site in the Aldh1a1 promoter (Figure 4I). Overall, these findings indicate that RelA directly regulates Aldh1a1 expression in corneal epithelial cells.

RA rescues Rela deletion-induced corneal homeostatic and regenerative defects

In cultured Rela-/- corneal epithelial cells, we found that the defects in cell proliferation and differentiation were rescued by adding RA to the medium (Figure 4—figure supplement 1A, B). Moreover, in cultures of normal corneal epithelial cells, addition of an RA receptor inhibitor impaired cell proliferation and differentiation (Figure 4—figure supplement 1D, E). These results indicate that RA mediates the effect of Rela deletion on corneal epithelial cell proliferation and differentiation.

To determine whether RA rescues Rela ablation-induced corneal phenotypes in vivo, we treated Krt14-Cre; Relaf/f and control mice with RA for 4.5 months starting at 1.5 months of age. Macroscopically, no corneal plaques were seen in RA-treated mice (Figure 5A). Histological and immunological analyses revealed that 6-month-old RA-treated mutant mice showed normal corneal epithelial and stromal structures (Figure 5B–D). In addition, 1.5 months of RA treatment, starting at 1.5 months of age, prevented thinning and dissolution of the epithelial layer at the central cornea (Figure 5—figure supplement 1A). These results suggest that a reduction in RA synthesis mediates the defects in the central cornea caused by Rela ablation. Moreover, when we administered RA to 4-week-old Krt14-Cre; Relaf/f and control mice with alkaline-induced injury, RA-treated mutant mice were able to regenerate the epithelial layer as effectively as normal mice (Figure 5E, F). Note that the peripheral cornea and limbus were not affected by the injury (Figure 5—figure supplement 1B). Collectively, these findings indicate that canonical NF-κB signaling regulates corneal epithelial homeostasis and regeneration by promoting RA synthesis.

Figure 5 with 4 supplements see all
Download asset Open asset
Retinoic acid (RA) diminishes homeostatic and regenerative defects caused by Rela ablation.

(A) Representative images showed that RA blocked Rela ablation-induced plaque formation in Krt14-Cre; Relaf/f mice. Upper panel: diagram showing the time of RA administration and mouse euthanization. Right panel: quantitation data. n = 10 per group. (B) Representative H/E staining results showed restoration of corneal structures by RA in Krt14-Cre; Relaf/f mice. Scale bar, 50 µm. (C) Representative immunostaining results showed that epidermal fate conversion (K1 and K12), overproliferation (PCNA and p63), stromal remodeling (vimentin), angiogenesis (CD31), and leukocyte infiltration (CD45) were all diminished by RA administration. Scale bar, 50 µm. (D) The percentage of PCNA+ proliferating cells. n = 6 per group. (E) Representative histological results showed that RA rescued corneal regeneration defects in Krt14-Cre; Relaf/f mice. Upper panel: diagram showing the time of injury and RA administration. (F) The percentage of PCNA+ proliferating cells. n = 6 per group. Data was presented as mean ± SEM. Two-way ANOVA was applied in (D, F). p-value<0.05 was considered as statistically significant.

Figure 5—source data 1

Numeric data used in Figure 5.

https://cdn.elifesciences.org/articles/67315/elife-67315-fig5-data1-v2.xlsx

However, treatment of Krt14-Cre; Relaf/f with RA at 3 months of age, after epithelial layer disruption, failed to prevent central corneal epithelial cell metaplasia, stromal remodeling, and plaque development (Figure 5—figure supplement 1C), indicating that RA could not reverse corneal epithelial metaplasia. Overall, these findings suggest that the primary epithelial defects (deterioration) caused by Rela deletion are attributable to a reduction in RA synthesis, whereas epithelial metaplasia and plaque formation are not directly caused by RA deficiency.

The VEGFR inhibitor axitinib alleviates angiogenesis and epidermal metaplasia

Consistent with new blood vessel formation, the stroma showed an increase in expression of Vegfa but not Vegfb, Vegfc, or Vegfd in 3-month-old Krt14-Cre; Relaf/f mice (Figure 5—figure supplement 2A). VEGFA may underlie neovascularization and increased proliferation of corneal epithelial cells. To test this, we treated the mutant and control mice with VEGFR inhibitor axitinib, an approved drug for treating renal cell carcinoma that has been studied in the treatment of other cancer types (Motzer et al., 2019), for 4.5 months starting at 1.5 months of age. Axitinib not only prevented corneal angiogenesis but also suppressed epithelial cell overproliferation and metaplasia (Figure 5—figure supplement 2B), confirming the importance of VEGFA-VEGFR in these events. However, the central corneal epithelial layer remained disrupted, accompanied by decreased cell proliferation, with the epithelial layer being similar to that of 3-month-old Krt14-Cre; Relaf/f mice without treatment (Figure 5—figure supplement 2B and Figure 2B). The results suggested that axitinib did not affect development of early corneal epithelial defects caused by RelA ablation.

Consistent with hyperproliferation of metaplastic cells, western blot analysis revealed enhanced activation of the mitogenic Erk and Stat3 pathways but not Akt1 or β-catenin in corneal samples (Figure 5—figure supplement 3A). While VEGFA secreted by the stroma may contribute to activation of some of these signaling molecules, we found enhanced phosphorylation of EGFRs in the skin-like epithelial tissue (Figure 5—figure supplement 3A), which has an established role in corneal epithelial cell proliferation (McClintock and Ceresa, 2010). Immunostaining confirmed activation of EGFR, as well as Erk and Stat3 in metaplastic cells (Figure 5—figure supplement 3B). EGFs might be synthesized by remodeling stromal cells or brought in by newly formed blood vessels via blood circulation as it is well known that plasma contains high levels of EGF molecules (Sánchez-Vizcaíno et al., 2010).

Antibiotic treatment shows little effect on corneal phenotypes

NF-κB is an important inflammatory signaling molecule, and chronic inflammation has been shown to induce corneal stromal remodeling and epithelial metaplasia (Nowell et al., 2016). We then examined whether bacterial infection played a role in the full spectrum of changes in the corneas of Krt14-Cre; Relaf/f mice as the mice showed open wounds in the cornea (Figure 2B). We treated mutant and control mice with levofloxacin, an antibiotic used to kill various types of bacteria, for 4.5 months starting at 1.5 months of age. While immune cell infiltration was largely blocked, stroma remodeling, angiogenesis, epidermal fate conversion, and plaque formation were not obviously affected (Figure 5—figure supplement 4A, B). Interestingly, we found that levofloxacin treatment did not affect NF-κB activation during regeneration in normal mice (Figure 5—figure supplement 4C). These results indicate that bacterial infection plays a minimal role in corneal defects of Krt14-Cre; Relaf/f mice.

Natural aging induces corneal phenotypes similar to those of Krt14-Cre; Relaf/f mice

The above results revealed age-dependent corneal anomalies in Krt14-Cre; Relaf/f mice. Interestingly, thinning of the central corneal epithelium and skin-like keratinization were also observed in naturally aged mice, which had the same genetic background and were maintained in the same animal facility as Krt14-Cre; Relaf/f mice. Approximately 12% of 24-month-old normal mice showed thinning of the corneal epithelial layer (hereafter designated moderate anomaly), 28% of mice showed epithelial overgrowth and plaque formation at the central cornea (hereafter designated severe anomaly), although 20-month-old mice showed no changes (Figure 6A, B). The observation that only a portion of aged mice showed corneal anomalies suggests the involvement of environmental factors in corneal aging. It is possible that thinning of the epithelial layer precedes plaque formation in aged mice. The thin corneal epithelium of 24-month-old mice showed a decrease in the numbers of proliferating cells and p63+ CESCs and decreased expression of K12 and Pax6 but no change in apoptotic cells (Figure 6C, D and Figure 6—figure supplement 1). In corneas with plaque formation, the epithelial cells were K1-positive, and the thickened stroma was positive for FSP1 and vimentin, accompanied by neovascularization, lymphatic vessel formation, and immune cell infiltration (Figure 6D). However, the peripheral cornea and limbus region appeared normal in both groups of mice (Figure 6C and Figure 6—figure supplement 2). Similar changes in corneal thickness and corneal epithelial keratinization have been observed in aged humans, although they do not progress to plaque formation or blindness (Yang et al., 2014; Blackburn et al., 2019).

Figure 6 with 2 supplements see all
Download asset Open asset
Natural aging produces similar corneal phenotypes as Krt14-Cre; Relaf/f mice.

(A) The percentages of mice showing corneal epithelial layer thinning (moderate) and plaque formation (severe) at 24 months of age compared to young mice. n = 50. (B) Representative histological images showed thinning of corneal epithelial layer or overgrowth of corneal epithelial layer in old mice. Scale bar, 50 µm. (C) Representative immunostaining results showed alterations in the number of PCNA+ cells and p63+ cells while the limbus showed no alteration in 24-month-old mice (with cornea defects). Scale bar, 50 µm. Lower panel: quantitation data of PCNA+ cells. n = 6 per group. (D) Representative immunostaining results showed alterations in the expression of differentiation marker K12, Pax6, epidermal marker K1, stromal cell marker vimentin, FSP1 and αSMA, blood vessel marker CD31, lymphatic vessel marker Lyve1, and immune cell marker CD45 in 24-month-old mice (with plaque formation). Scale bar, 50 µm. Lower panel: quantitation data. n = 6 per group. Data was presented as mean ± SEM. Unpaired two-tailed Student’s t-test was applied in (C, D). p-value<0.05 was considered as statistically significant.

Figure 6—source data 1

Numeric data used in Figure 6.

https://cdn.elifesciences.org/articles/67315/elife-67315-fig6-data1-v2.xlsx

RA prevents the development of aging-like corneal phenotypes in normal mice

We found that in the thin corneal samples of 24-month-old mice expression of RelA and Aldh1a1 and activation of NF-κB were significantly reduced compared to those of corneal samples from young mice (Figure 7A). qPCR analysis confirmed reduced expression of Rela and Aldh1a1 at the mRNA level (Figure 7B). Immunohistochemical staining of RelA and immunostaining of Aldh1a1 confirmed the reductions in these two proteins in the central cornea (Figure 7C, D).

Figure 7 with 1 supplement see all
Download asset Open asset
Retinoic acid (RA) supplementation prevents development of aging-like corneal phenotypes.

(A) Representative western blot results showed decreased levels of RelA, p-RelA, and Aldh1a1 in the corneal samples of 24-month-old mice (with thinner epithelial layer) compared to young mice. Right panel: quantitation data. n = 3 per group. (B) Quantitative PCR analysis confirmed the decrease of Rela and Aldh1a1 mRNA levels in the corneal epithelial samples of aged mice. n = 3 per group. (C) Representative immunohistochemical staining showed that the levels of RelA were decreased in the cornea of 24-month-old mice. Scale bar, 50 µm. (D) Representative immunostaining showed that levels of Aldh1a1 were drastically reduced in corneal samples of aged mice. Scale bar, 50 µm. (E) Administration of RA to 20-month-old normal mice alleviated the aging-related corneal phenotypes. n = 20 per group. (F) Representative histological results showed that RA prevented corneal defects in aged mice. Scale bar, 50 µm. Right panel: quantitation data. n = 6 per group. Data was presented as mean ± SEM. Unpaired two-tailed Student’s t-test was applied in (A, B), and two-way ANOVA was applied in (F). p-value<0.05 was considered as statistically significant.

Figure 7—source data 1

Numeric data used in Figure 7.

https://cdn.elifesciences.org/articles/67315/elife-67315-fig7-data1-v2.xlsx

To examine whether a reduction in RA synthesis is involved in age-related corneal degeneration, we treated 20-month-old normal mice with RA for 4 months and examined their corneas. None of the RA-treated mice developed corneal plaques, and the percentage of mice with thinned corneas was greatly reduced (Figure 7E). Moreover, the alteration in histological structure and expression of epidermal marker genes in the aged cornea was also rescued (Figure 7F and Figure 7—figure supplement 1). These results confirm a critical role of RA in natural aging of the cornea and suggest the RA-containing ointment may be applied to the central cornea to slow down the development of aging-related corneal anomalies.

Discussion

Corneal injuries are common due to the increasing use of contact lenses, laser-assisted in situ keratomileusis, air pollution, allergies, and infections (Vashist et al., 2016). Aberrant repair often leads to impaired vision, and under severe conditions, blindness becomes inevitable, and corneal replacement is needed (Notara et al., 2010). Thus, a complete understanding of the biology of corneal homeostasis and regeneration is imperative for developing regimens to preserve the cornea and treat cornea-related disorders. In this study, we established NF-κB, which responds to many extracellular stimuli and injury, as a critical regulator of corneal epithelial maintenance and regeneration. While the absence of Rela in K14+ CESCs did not affect corneal development, it caused defective epithelial cell proliferation and differentiation and led to epithelial disruption at the central cornea in a cell-autonomous manner, which triggered inflammatory responses and led to epithelial metaplasia and plaque formation. This study thus uncovered the important mechanisms governing corneal homeostasis and regeneration.

The findings of our study suggest that centrally located CESCs play a role in corneal homeostasis and regeneration. We showed that activation of NF-κB was stronger in the central cornea than in the limbus. Deletion of Rela in K14+ cells caused thinning and disruption of the corneal epithelium at the central cornea but not the limbus. Subsequently, epidermal fate conversion and plaque formation occurred at the central cornea without affecting limbal CESCs. Furthermore, aging-related corneal phenotypes developed at the central cornea. If limbal CESCs were solely responsible for corneal regeneration, exhaustion of limbal CESCs should have occurred in Krt14-Cre; Relaf/f mice. Overall, these findings indicate that central CESCs play an important role in corneal homeostasis and regeneration (Majo et al., 2008; Chang et al., 2011; Nasser et al., 2018; West, 2015; Sun et al., 2010). The differential responses to Rela deletion in the central and limbal CESCs are likely due to their distinct niches as the central cornea is constantly exposed to the external cues including UV lights, infectious particles, chemicals, and dirt and is under different mechanical strains, compared to limbal cells (Nowell et al., 2016). Moreover, we show that Rela ablation does not affect other organs/tissues marked by K14 in mice.

Mechanistically, we showed that NF-κB promoted corneal epithelial progenitor proliferation and differentiation by controlling RA synthesis. NF-κB directly regulated the expression of Aldh1a1, a rate-limiting enzyme in the RA synthesis pathway. Previous studies have shown that RA plays a role in eye development, likely via the Wnt-β-catenin pathway (Smith et al., 2018; Niederreither and Dollé, 2008; Larange and Cheroutre, 2016), which is involved in corneal stromal cells (Kumar and Duester, 2010; Smith et al., 2018; Nowell et al., 2016). Vitamin A deficiency in humans causes xerophthalmia, night blindness, corneal ulcers, and other symptoms, especially in children. Our study highlights the importance of RA, a vitamin A metabolite, in maintaining healthy corneas in adults and in preventing corneal aging. RA has been approved to treat skin disorders including psoriasis and acne as well as acute lymphatic leukemia (Tang and Gudas, 2011; Ferreira et al., 2020). In addition, ablation of Notch1 in corneal epithelial cells also caused epithelial metaplasia and plaque formation (Vauclair et al., 2007). There are a few differences between these two mouse models. The Notch1-deficient mice show a loss of meibomian glands and much reduced expression of retinol transporting protein CRBP1 but no thinning or loss of the epithelial layer compared to Krt14-Cre; Relaf/f mice. Despite these differences, both models underscore the importance of RA pathway in cornea maintenance and regeneration.

Notably, RA appears to play an insignificant role in subsequent wound healing events, including epithelial metaplasia and plaque formation. Instead, we showed that stroma-secreted VEGF and/or neovascularization play a causal role in these events. Our findings reinforce the importance of preventing neovascularization in maintaining healthy corneas and suggest that in patients already showing corneal epithelial metaplasia VEGFR inhibitors may help to slow the pathological progression.

Our findings indicate that NF-κB signaling plays an anti-aging role in mouse cornea. On the other hand, NF-κB activation can increase the expression of senescence-associated secretory phenotype cytokines, including IL-6, IL-1β, and TNF-α, which promote inflammation and aging in many tissues (Taniguchi and Karin, 2018). Thus, the activity of NF-κB must be fine-tuned in corneal epithelial cells. What causes the decline in Rela expression and activation in aged corneal epithelial cells? As a transcription factor regulating various cellular events, NF-κB is tightly controlled via multiple mechanisms including feedback regulatory circuits (Taniguchi and Karin, 2018). Constant activation of the pathway by pro-aging factors, for example, reactive oxygen species and chronic inflammation, may disrupt the regulatory circuits and lead to reduced expression and activation of RelA. This certainly warrants further investigation.

In human, although corneal epithelia thinning and keratinization have been observed in the elderly, corneal plaque formation and loss of vision rarely occur (Yang et al., 2014; Blackburn et al., 2019). One explanation is that aging-related decrease in RA synthesis may be made up for by RA-rich nutrients. Alternatively, age-related corneal problems may be diagnosed early and are treated successfully.

In summary, this study uncovers the important mechanisms governing corneal epithelium homeostasis, regeneration, and aging, and suggests that the canonical NF-κB-RA pathway may be a target to improve corneal health.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent (Mus musculus)Relaf/fThe Jackson LaboratoryRRID:IMSR_JAX:024342Stock No: 024342
Genetic reagent (M. musculus)Krt14-creThe Jackson LaboratoryRRID:IMSR_JAX:004782Stock No: 004782
Genetic reagent (M. musculus)Prrx1-creThe Jackson LaboratoryRRID:IMSR_JAX:005584Stock No: 005584
Genetic reagent (M. musculus)ROSA26fs-tdTomatoThe Jackson LaboratoryRRID:IMSR_JAX:007914Stock No: 007914
AntibodyRabbit monoclonal to K12AbcamCat# ab185627, RRID:AB_2889825IF(1:200)
AntibodyRabbit monoclonal to vimentinAbcamCat# ab92547, RRID:AB_10562134IF(1:100)
AntibodyRabbit polyclonal to ɑSMAAbcamCat# ab5694, RRID:AB_2223021IF(1:100)
AntibodyRat monoclonal to CD31AbcamCat# ab56299, RRID:AB_940884IF(1:100)
AntibodyRabbit polyclonal to CD45AbcamCat# ab10558, RRID:AB_442810IF(1:100)
AntibodyRabbit monoclonal to p63AbcamCat# ab124762, RRID:AB_10971840IF(1:100)
AntibodyRabbit monoclonal to FSP1AbcamCat# ab197896, RRID:AB_2728774IF(1:100)
AntibodyRabbit monoclonal to p-EGF receptor (Tyr1068)Cell Signaling TechnologyCat# 3777, RRID:AB_2096270IF(1:100)
WB(1:1000)
AntibodyRabbit monoclonal to p-Stat3 (Tyr705)Cell Signaling TechnologyCat# 9145, RRID:AB_2491009IF(1:100)
WB(1:1000)
AntibodyMouse monoclonal to Stat3Cell Signaling TechnologyCat# 9139, RRID:AB_331757WB(1:1000)
AntibodyRabbit monoclonal to p-Erk1/2 (Thr202/Tyr204)Cell Signaling TechnologyCat# 9101, RRID:AB_331646IF(1:100)
WB(1:1000)
AntibodyMouse monoclonal to Erk1/2Cell Signaling TechnologyCat# 9107, RRID:AB_10695739WB(1:1000)
AntibodyRabbit monoclonal to RelACell Signaling TechnologyCat# 8242, RRID:AB_10859369IHC(1:100)
CHIP(1:100)
AntibodyRabbit monoclonal to p-RelA (Ser536)Cell Signaling TechnologyCat# 3033, RRID:AB_331284WB(1:1000)
AntibodyRabbit monoclonal to RelACell Signaling TechnologyCat# 4764, RRID:AB_823578WB(1:1000)
AntibodyRabbit monoclonal to p-Akt (Ser473)Cell Signaling TechnologyCat# 4060, RRID:AB_2315049WB(1:1000)
AntibodyRabbit monoclonal to AktCell Signaling TechnologyCat# 9272, RRID:AB_329827WB(1:1000)
AntibodyRabbit monoclonal to p-IKKɑ/β (Ser176/180)Cell Signaling TechnologyCat# 2697, RRID:AB_2079382WB(1:1000)
AntibodyRabbit polyclonal to IKKɑCell Signaling TechnologyCat# 2682, RRID:AB_331626WB(1:1000)
AntibodyRabbit polyclonal to K1BioLegendCat# 905601, RRID:AB_2565051IF(1:200)
AntibodyRabbit polyclonal to Pax6BioLegendCat# 901302, RRID:AB_2749901IF(1:200)
AntibodyMouse monoclonal to LYVE-1ReliatechCat#103PA50AG, RRID:AB_2876870IF(1:100)
AntibodyRabbit polyclonal to ALDH1A1ProteintechCat# 15910-1-AP, RRID:AB_2305276IF(1:100)
AntibodyRabbit polyclonal to Ki-67Thermo Fisher ScientificCat# PA5-19462, RRID:AB_10981523IF(1:100)
AntibodyMouse monoclonal to PCNASanta Cruz BiotechnologyCat# sc-56, RRID:AB_628110IF(1:100)
AntibodyRabbit polyclonal to β-cateninSanta Cruz BiotechnologyCat# sc-7199, RRID:AB_634603WB(1:1000)
AntibodyMouse monoclonal to β-actinSanta Cruz BiotechnologyCat# sc-47778, RRID:AB_626632WB(1:5000)
AntibodyAnti-rabbit IgG, HRP-linked AntibodyCell Signaling TechnologyCat# 7074, RRID:AB_2099233WB(1:5000)
AntibodyAnti-mouse IgG, HRP-linked AntibodyCell Signaling TechnologyCat# 7076, RRID:AB_330924WB(1:5000)
AntibodyGoat anti-Rabbit IgG Secondary Antibody, Alexa Fluor488Thermo Fisher ScientificCat# A-11008, RRID:AB_143165IF(1:200)
AntibodyGoat anti-Mouse IgG Secondary Antibody, Alexa Fluor488Thermo Fisher ScientificCat# A-11001, RRID:AB_2534069IF(1:200)
AntibodyGoat anti-Rat IgG Secondary Antibody, Alexa Fluor488Thermo Fisher ScientificCat# A-11006, RRID:AB_2534074IF(1:200)
Sequence-based reagentRT-qPCR primersThis paperSee Table 1
Sequence-based reagentCHIP primersThis paperSee Table 2
Commercial assay or kitPrimeScript RT reagent KitTAKARARR037A
Commercial assay or kitFast Start Universal SYBR Green Master kitRoche04887352001
Commercial assay or kitSimpleChIP Enzymatic Chromatin IP KitCell Signaling Technology#9002
Chemical compound, drugRetinoic acidSigma-AldrichCat# R2625
Chemical compound, drugBMS493Sigma-AldrichCat# B6688
Chemical compound, drugAxitinibSelleck ChemicalsCat# S1005
Chemical compound, drug0.5% Levofloxacin Eye DropsSantenN/A
Chemical compound, drugEZ-Link Sulfo-NHS-LC-BiotinThermo Fisher ScientificCat# A39257
Software, algorithmImageJ(http://imagej.nih.gov/ij/)
Software, algorithmGraphPad Prism 8https://www.graphpad.comRRID:SCR_015807Version 8

Mouse lines and maintenance

Request a detailed protocol

All the mouse work was carried out following the recommendations by the National Research Council Guide for the Care and Use of Laboratory Animals, with the protocols approved by the Institutional Animal Care and Use Committee of Shanghai, China [SYXK(SH)2011-0112]. ROSA26fs-tdTomato, Relaf/f, Krt14-Cre, Prrx1-Cre mouse lines were purchased from The Jackson Laboratory. Theses mice were crossed to B6 mice for at least five times. The young and aged normal mice were on B6 background and maintained at the same facility as the engineered mice.

H/E staining, Alcian blue staining, and Picrosirius red staining

Request a detailed protocol

After the mice were euthanized, the whole eyeball was fixed in 4% paraformaldehyde overnight. Samples were then dehydrated, embedded in paraffin, sectioned at 4-µm-thick, and prepared for staining. H/E staining, Alcian blue staining and Picrosirius red staining were carried out following the standard protocols.

Lineage tracing

Request a detailed protocol

All the lineage tracing experiments were done in both male and female adult mice with similar results obtained. To trace tdTomato-positive cells, cryostat sections were used. Mouse eyeballs were fixed and embedded in OCT (Leica) and frozen in liquid nitrogen. Sections were cut at 5 µm thick at −20°C, which were counterstained with DAPI solution and the images were taken under Microscope (Nikon ECLIPSE 80i).

Immunofluorescent microscopy

Request a detailed protocol

The paraffin sections were dewaxed and rehydrated, then permeabilized with Triton X100 (0.1%) in PBS for 10 min. Antigen retrieval was performed with heated sodium citrate solution. The samples were blocked with 10% goat serum at room temperature (RT) for 1 hr, then incubated with primary antibodies at 4°C overnight. For cryostat section, the frozen sections were rewarmed, washed, permeabilized with Triton X100 (0.1%) in PBS for 10 min, blocked with 10% goat serum at RT for 1 hr, and incubated with primary antibody at 4°C overnight. The next day, after washing, the samples were incubated with secondary antibody at 37°C for 1 hr, then counterstained with DAPI solution, and the images were taken under Microscope (Nikon ECLIPSE 80i). The antibodies are listed in Key resources table. Apoptosis was determined by TUNEL assay (In Situ Cell Death Detection Kit Fluorescein, Roche) following the standard protocols.

Immunohistochemical staining

Request a detailed protocol

The paraffin sections were dewaxed and rehydrated. The samples were treated with 3% H2O2 for 10 min to quench the endogenous peroxidase activity, permeabilized with Triton X100 (0.1%) in PBS for 10 min. Antigen retrieval was performed with heated sodium citrate solution. The samples were blocked, then incubated with primary antibodies, secondary antibodies and third antibodies that conjugated to horseradish peroxidase (HRP). The samples were incubated with DAB solution (Boster), washed, and then counterstained with hematoxylin solution. The slides were then dehydrated, cleared, and mounted with resin for observation. See Key resources table for antibodies used. To quantify the RelA signals, cells with different DAB signal intensities were given the following scores: high (Collinson et al., 2004), positive (Nowell and Radtke, 2017), low positive (Yazdanpanah et al., 2017), and negative (0). We took the average score of all cells in the field as an indicator of RelA expression.

Immunoblotting

Request a detailed protocol

Immunoblotting was performed with standard procedures. Proteins were extracted from the whole cornea or the epithelial layers using RIPA lysis buffer supplemented with protease inhibitor and phosphatase inhibitor. Samples were separated with 10% SDS-PAGE and transferred onto PVDF membranes (Millipore). Membranes were blocked with 5% milk for 1 hr and incubated with specific antibodies overnight at 4°C. The primary antibodies are listed in Key resources table. To quantify western blot data, we measured the density of each band by ImageJ, which was normalized to the loading control of the sample. The average of the experimental group samples was normalized to that of the normal or Veh-treated samples.

Model of corneal alkaline burn

Request a detailed protocol

The mice were anesthetized with sodium pentobarbital (Sigma-Aldrich). A 1.0-mm-diameter circular piece of filter paper, soaked in 1 N NaOH, was placed on the central surface of the cornea for 10 s. After alkali exposure, the ocular surface was rinsed with sterile saline solution for 60 s. We used 3–6 mice per group based on similar studies in the literature.

Corneal fragility assay

Request a detailed protocol

Experimental animals were anesthetized with intraperitoneal injections of sodium pentobarbital (Sigma-Aldrich). Under a stereomicroscope, a partial epithelial defect was created in both eyes by brushing with a wet Microsponge (Alcon) as described by Kao et al., 1996. Then eyeballs were removed and embedded in paraffin for histology. H/E-stained cornea sections were analyzed.

Corneal tight junction integrity

View detailed protocol

Hutcheon et al., 2007 described a functional assay of corneal epithelial cell tight junction integrity using LC-biotin, which does not penetrate through the epithelium in the presence of intact tight junctions, whereas defective tight junctions allow penetration through the epithelium and into the corneal stroma. In brief, 10 μl LC-biotin staining solution (EZ-Link-Sulfo-NHS-LC-Biotin, 10 mM, Thermo Fisher Scientific) was applied to the cornea of wild-type and Rela-deficient mice for 15 min at the time of euthanasia. Eyeballs were rinsed with PBS, enucleated, and placed in OCT for frozen sectioning. Sections were stained with FITC-streptavidin to detect the presence of LC-biotin and then quantified based on FITC signals.

RA and inhibitor administration

Request a detailed protocol

For in vitro experiments, RA (Sigma-Aldrich) and BMS493 (Sigma-Aldrich) were dissolved in dimethyl sulfoxide and applied at a final concentration of 10 mM and 5 mM in cell culture medium, respectively. For in vivo experiments, RA was dissolved in corn oil while axitinib (Selleck Chemicals) was dissolved in dimethyl sulfoxide, which were reconstituted in PEG300/Tween80/Water mixed solution. Mice were treated with 1 mg/kg RA or 10 mg/kg axitinib with the diluent as a control through intragastric administration every other day, following the experimental protocols. For antibiotic treatment, two drops of 0.5% Levofloxacin Eye Drops (Santen) were applied into each eye every day.

Mouse primary corneal epithelial cell culture

Request a detailed protocol

Briefly, corneas were carefully dissected to ensure that conjunctival and iris tissues were not included and cut into two pieces and placed into a cell culture dish. After 10 min, the proliferation medium (Defined Keratinocyte-serum free medium [KSFM with growth factors], Life Technologies) was added into dish and cultured at 37°C in a 5% CO2 incubator. Epithelial cells began to climb out from the tissue blocks. The proliferation medium was changed every 3 or 4 days. For differentiation, the cells were switched to differentiation medium (DMEM/F12 plus 10% FBS).

Quantitative PCR analysis

Request a detailed protocol

Corneas were placed in 50 μl RNA stabilization reagent (RNAlater, Sigma-Aldrich), and later incubated in 250 μl 20 mM EDTA (sterile, pH 7.4) at 37°C for 30 min. The epithelial layer was then teased apart from the stromal layer. Total RNA was extracted from corneal epithelia, stroma or cultured cells samples with Trizol Reagent (Invitrogen) following the manufacturer’s instruction. cDNA was reversed transcribed using PrimerScript RT reagent Kit (Takara), and quantitative PCR was carried out using the Roche Light Cycle 480II detection system (Roche). Primer sequences are shown in Table 1.

Table 1
Quantitative PCR primer sequences used in the study.
GeneForward primerReverse primer
Krt12CATGGCTGAGCAAAATCGGAACAGGGACGACTTCATGGCG
RelaAGGCTTCTGGGCCTTATGTGTGCTTCTCTCGCCAGGAATAC
Aldh1a1ATACTTGTCGGATTTAGGAGGCTGGGCCTATCTTCCAAATGAACA
Krt1TGGGAGATTTTCAGGAGGAGGGCCACACTCTTGGAGATGCTC
Krt10CGAAGAGCTGGCCTACCTAAAGGGCAGCGTTCATTTCCAC
VegfaGCACATAGGAGAGATGAGCTTCCCTCCGCTCTGAACAAGGCT
VegfbGCCAGACAGGGTTGCCATACGGAGTGGGATGGATGATGTCAG
VegfcGAGGTCAAGGCTTTTGAAGGCCTGTCCTGGTATTGAGGGTGG
VegfdTTGAGCGATCATCCCGGTCGCGTGAGTCCATACTGGCAAG

ChIP assay

Request a detailed protocol

The ChIP assay was carried out following the manufacturer’s protocol (SimpleChIP Enzymatic Chromatin IP Kit, Cell Signaling, 9002). Briefly, primary corneal epithelial cells were crosslinked with 1% formaldehyde and blocked with glycine, washed, and digested by micrococcal nuclease. The nuclear pellet was suspended in ChIP buffer and sheared by sonication. An aliquot of sheared chromatin sample was set aside as input control. The remained chromatin was then incubated with anti-RelA antibody (Cell Signaling, 8242). Normal Rabbit IgG (Cell Signaling, 2729) was used as a negative control. The immunoprecipitated chromatins were then eluted with ChIP elution buffer. The DNA fragments were released by treatment with proteinase K at 65°C. The released DNA fragments were purified with columns and amplified by site-specific primers by quantitative PCR assay. The data were analyzed by the following formula: percent (%) input recovery = (100/(input fold dilution/bound fold dilution)) × 2(input CT - bound CT). Pairs of primers designed to amplify the specific target sequences of the putative promoters are listed in Table 2.

Table 2
Primer sequences used for chromatin immunoprecipitation assays.
GenePredictive binding siteForward sequenceReverse sequence
Aldh1a1S1: GCGAATTTCCAACATCTTGGGGTGCATTGCTAGCTAGGGGAGGAACAGGG
S2: GGGACTTTTCATGATTCACAAGTGCACGCACAGAATCTTCGCATTGTCTTTGT
S3: GGGATCTTCCTGTTTGGGAATTGGCCTGAGAGCCTGCTTCTCTCTCTCTC

RNA sequencing

Request a detailed protocol

To perform RNA sequencing, corneal epithelial layer was separated and total RNA was extracted from three independent biological samples. rRNA depletion was performed using Ribo-Zero Gold rRNA removal kit H/M/R (Illumina). Agilent RNA 6000 Nano Kit on 2100 Bioanalyzer (Agilent) was used to do total RNA sample QC. Libraries were constructed with a series of standard steps, included RNA fragment and reverse transcription to double-strand cDNA, end repair, tailing and adaptor ligation, PCR amplification, denaturation, and cyclization. The final library was single-strand circle DNA (ssCir DNA) and was amplified with phi29 (Thermo Fisher Scientific) to make DNA nanoball (DNB). DNBs were transformed to single-end 50 bases reads and sequenced on BGISEQ-500 platform (BGI-Shenzhen, China).

RNA-seq analysis

Request a detailed protocol

We used SOAPnuke (v1.5.2) to filter reads and generate FASTQ format (Cock et al., 2010). We aligned clean reads to the reference mouse genome using the Bowtie2 (v2.2.5) with default parameters and calculated gene expression level with RSEM (v1.2.12) (Langmead and Salzberg, 2012; Li and Dewey, 2011). Statistically significant genes (adjusted p-value≤0.001) with large expression changes (fold change ≥2) were defined as differentially expressed genes (DEGs) (Wang et al., 2010). In GO analysis and pathway analysis, DEGs were classified according to official classification with the GO or KEGG annotation results and phyper (a function of R) was performed in GO and pathway functional enrichment. The false discovery rate (FDR) was calculated for each p-value with FDR ≤ 0.01 defined as significantly enriched.

Statistical analysis

Request a detailed protocol

Numerical data and histograms were expressed as the mean ± SEM. The number of mice used for each experiment was specified in the figure legends. For histology analysis, at least three mutant and control mice were used and representative results were presented and the number of mice used for each experiment was based on previously reported studies. Quantitative PCR was performed using RNA isolated from three mice. Western blot was performed using samples from three mice as well. Comparisons between two groups were analyzed using two-tailed unpaired Student’s t-test, and p-value<0.05 was considered as statistically significant. All the experiments were repeated at least three times.

Data availability

Sequencing data have been deposited in GEO database (NCBI) under the accession Series GSE161433.

The following data sets were generated
    1. Yu Q
    2. Biswas S
    3. Ma G
    4. Zhao P
    5. Li B
    6. Li J
    (2021) NCBI Gene Expression Omnibus
    ID GSE161433. Next Generation Sequencing Facilitates Quantitative Analysis of Wild Type and RELA-/- Cornea Transcriptomes.
    https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE161433

References

    1. Castro-Muñozledo F
    (2013)
    Review: corneal epithelial stem cells, their niche and wound healing
    Molecular Vision 19:1600–1613.
    1. Chen YT
    2. Li S
    3. Nikulina K
    4. Porco T
    5. Gallup M
    6. McNamara N
    (2009)
    Immune profile of squamous metaplasia development in autoimmune regulator-deficient dry eye
    Molecular Vision 15:563–576.
    1. Kao WW
    2. Liu CY
    3. Converse RL
    4. Shiraishi A
    5. Kao CW
    6. Ishizaki M
    7. Doetschman T
    8. Duffy J
    (1996)
    Keratin 12-deficient mice have fragile corneal epithelia
    Investigative Ophthalmology & Visual Science 37:2572–2584.
    1. Verhoeven VJ
    2. Hysi PG
    3. Wojciechowski R
    4. Fan Q
    5. Guggenheim JA
    6. Höhn R
    7. MacGregor S
    8. Hewitt AW
    9. Nag A
    10. Cheng CY
    11. Yonova-Doing E
    12. Zhou X
    13. Ikram MK
    14. Buitendijk GH
    15. McMahon G
    16. Kemp JP
    17. Pourcain BS
    18. Simpson CL
    19. Mäkelä KM
    20. Lehtimäki T
    21. Kähönen M
    22. Paterson AD
    23. Hosseini SM
    24. Wong HS
    25. Xu L
    26. Jonas JB
    27. Pärssinen O
    28. Wedenoja J
    29. Yip SP
    30. Ho DW
    31. Pang CP
    32. Chen LJ
    33. Burdon KP
    34. Craig JE
    35. Klein BE
    36. Klein R
    37. Haller T
    38. Metspalu A
    39. Khor CC
    40. Tai ES
    41. Aung T
    42. Vithana E
    43. Tay WT
    44. Barathi VA
    45. Chen P
    46. Li R
    47. Liao J
    48. Zheng Y
    49. Ong RT
    50. Döring A
    51. Evans DM
    52. Timpson NJ
    53. Verkerk AJ
    54. Meitinger T
    55. Raitakari O
    56. Hawthorne F
    57. Spector TD
    58. Karssen LC
    59. Pirastu M
    60. Murgia F
    61. Ang W
    62. Mishra A
    63. Montgomery GW
    64. Pennell CE
    65. Cumberland PM
    66. Cotlarciuc I
    67. Mitchell P
    68. Wang JJ
    69. Schache M
    70. Janmahasatian S
    71. Janmahasathian S
    72. Igo RP
    73. Lass JH
    74. Chew E
    75. Iyengar SK
    76. Gorgels TG
    77. Rudan I
    78. Hayward C
    79. Wright AF
    80. Polasek O
    81. Vatavuk Z
    82. Wilson JF
    83. Fleck B
    84. Zeller T
    85. Mirshahi A
    86. Müller C
    87. Uitterlinden AG
    88. Rivadeneira F
    89. Vingerling JR
    90. Hofman A
    91. Oostra BA
    92. Amin N
    93. Bergen AA
    94. Teo YY
    95. Rahi JS
    96. Vitart V
    97. Williams C
    98. Baird PN
    99. Wong TY
    100. Oexle K
    101. Pfeiffer N
    102. Mackey DA
    103. Young TL
    104. van Duijn CM
    105. Saw SM
    106. Bailey-Wilson JE
    107. Stambolian D
    108. Klaver CC
    109. Hammond CJ
    110. Consortium for Refractive Error and Myopia (CREAM)
    111. Diabetes Control and Complications Trial/Epidemiology of Diabetes Interventions and Complications (DCCT/EDIC) Research Group
    112. Wellcome Trust Case Control Consortium 2 (WTCCC2)
    113. Fuchs' Genetics Multi-Center Study Group
    (2013) Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia
    Nature Genetics 45:314–318.
    https://doi.org/10.1038/ng.2554

Decision letter

  1. Lois Smith
    Reviewing Editor; Boston Children's Hospital/Harvard Medical School, United States
  2. Kathryn Song Eng Cheah
    Senior Editor; The University of Hong Kong, Hong Kong

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Acceptance summary:

This study thus uncovers major mechanisms governing maintenance of corneal transparency, regeneration and aging involving the retinoic acid pathway. The authors identify retinoic acid as a potential therapeutic for corneal disorders.

Decision letter after peer review:

Thank you for submitting your article "Canonical NF-κB signaling maintains corneal epithelial integrity and prevents corneal aging via retinoic acid" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, and the evaluation has been overseen by a Reviewing Editor and Kathryn Cheah as the Senior Editor. The reviewers have opted to remain anonymous.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

The manuscript by Yu and co-authors investigates the effects of ablating Rela (a subunit of NF-ƙB) in K14+ basal cells then studying how corneas heal after inflicting a chemical wound and the pathology seen after a substantial follow-up period. Some of the features that develop in the mutant mice seem to be recapitulated in a fraction of normal aged mice, implying that this factor is a key regulatory element in supporting corneal homeostasis. The authors provide a wealth of data using a wide array of techniques in relations to characterizing the pathways and pathway elements that partake in the interesting phenomenon. The major concerns are:

1. The lack of clear organization of the paper makes it difficult to follow and to understand the significance. Rewriting the introduction, study design, results and discussion as well as addressing missing or inappropriate controls, animal numbers, statistics and general clarifications would help to improve the quality and impact of this study.

2. The introduction should lead the reader into understanding why the study was done. In the discussion authors should not reiterate results but talk about 1. mechanism 2. significance with respect to human disease as age-related corneal dysfunction is not really a problem in humans without an underlying disease 3. how specific this discovery really is to the eye given that the mutation is global i.e. it presumably affects all 14+ basal epithelial cells through the body 4. The study indicates that there is a change in the level of Rela over time and that rescue can occur by administering retinoic acid. It does not explain why the enzyme decreases or is suppressed with age, nor does it describe why it is region specific.

3. The paper's organization may also be improved by moving some studies to supplemental data.

The studies on vegf and those on the treatment with antibiotics should be in the supplemental data as nothing more is done with them.

The studies on aged mice are interesting but in showing that the response is similar without doing RNA seq on both tissues and comparing them, the reader is left hanging. These could be moved to supplemental data.

4. Many references are missing.

5. Quantification of data is missing in some instances and some controls are missing as noted in the reviews. The specific comments in the reviews should help guide the authors.

Reviewer # 1:

This is a well executed study on the significance of knocking out Rela, that encodes a NFkB subunit in K14+ corneal epithelial stem cells in mice. This knockout results in aberrant wound healing, neovascularization, epithelial metaplasia, and plaque formation in the central cornea. Vitamin A deficiency is known to cause corneal dysfunction defects. Here the authors demonstrate that retinoic acid, a metabolic product of vitamin A, is important for regeneration and aging. The data provided by the authors largely support their conclusions. The main strength of the paper is novelty of demonstrating a RA-related defect in the central cornea but not the limbus. Furthermore, that normal aged corneas in mice have a similar defect to young Rela null mice, both of which are rescued with RA treatment.

In summary, the Rela KO did not affect corneal development. However, at 4 weeks when wounded with an alkaline burn, compared to control corneas, the Rela null mice demonstrate a loss of K12 and reduced PCNA in the cornea. Furthermore, after 2 months of aging (without injury), Rela null mice displayed large central plaque formation with neovascularization and metaplasia that increased in severity with aging. The limbus was not affected. These data suggest that Rela is required for maintaining corneal homeostasis mainly in the central cornea. Furthermore, RNA-seq analysis of the epithelial layers confirmed differentiation of epithelium into epidermis and cell cycle genes supporting excessive proliferation. Furthermore, using a K14-Cre; Relaf/f; Tomato mouse, the authors found that the epidermal genes were derived from K14+ cells. RA supplementation rescues the defect. Natural aging of mice demonstrates similar corneal defects to Rela null mice, which are rescued by treatment with RA.

The article could be strengthened in several ways. For example the interrogation of the importance of the VEGF pathway in plaque formation and metaplasia seems out of place. The authors treat for 6 months with an VEGFR inhibitor, although it does prevent neovascularization and metaplasia, it also prevents epithelial stratification. The analysis of these experiments would need to be clarified. Also, the VEGFR experiments are difficult to assimilate into the overall story and could be removed. In addition, the antibiotic treatment without an infection is difficult to comprehend and coordinate into the overall story. Finally, it would be helpful to propose how aging mouse corneas could compare to human corneal aging and if there is any data on corneal problems solely because of aging in humans.

Please mention that transparency in the cornea is also from the secretion of crystallins.

Please reference, limited by a lack of corneal donors, line 18.

The basement membrane is a critical contributor to the maintenance of epithelial/stromal biology. This should be incorporated into the introduction with references to papers by Steve Wilson, a leader in the basement membrane literature.

A fairer way to quantify western blot is to take the average of the control (which can then have standard error) and then find the values for experimental/ave control. Even though control will still be 1, it will have incorporated the error into control lanes. For the western in 1a, it would be Control/actin and then experimental/actin divided by ave of control/actin. By setting the control to 1 all error is being eliminated. A small graph might work better.

Mouse cornea is not fully developed until 6 weeks, the reason for NaOH at 4 weeks is not clear.

There are many studies on corneal alkaline injury and the role of NFkB, please better reference these studies.

It would have helpful to stain for scarring markers to understand more about the fibrotic response. There can be little SMA but still a large scar.

I'm not sure that one can conclude that (page 13 line 20) primary defects are caused by RA deletion and that the later effects are RA independent because these defects are not observed when the RA is supplied earlier.

Typo figure 7 "tatal".

Age-related corneal dysfunction is not really a problem in humans without an underlying disease. Please discuss.

Reviewer #2:

The authors used a number of approaches in studying the function of NFKB signaling in corneal epithelial homeostasis in control and K14-Cre;Relaf/f mice. To generate these mice, Relaf/f mice and K14-Cre mice were crossed and the following approaches were used to examine the mice over time and after injury; RNAseq, genetic analysis and lineage tracing, along with more traditional analyses of ChIP, molecular approaches and conventional immunohistochemistry. The authors showed that after an alkali injury there was a decrease in K12 and PCNA in the central cornea, that was not detected in the peripheral and limbal epithelium. Additional experiments supported the observation that the central cornea responds uniquely. When the authors examined the response in the stroma underlying the epithelium, they found that while there was an increase in thickness there was no fibrosis and they speculated that the response was secondary to the epithelium as it was not generated or detected until the epithelial changes occurred. RNA seq data of the cells where Rela was ablated demonstrated that there was a significant reduction in the expression of Aldh1a1 and ChIP verified the presence of the NFKB binding site on the Aldh1a1 promoter.

Further analyses demonstrated that the abnormal cells were all tomato+ indicating that the cells in the center were derived from K14; however it is not understood why the other K14 labelled cells in the cornea or in basal skin were not affected by RelA deletion. The authors showed that the response could be rescued when corneas were treated with retinoic acid before thinning and plaque development was detected. Conversely, there was no rescue if treated after thinning occurred. The authors also performed confirmatory experiments in vitro and found that cultured epithelial cells that were Rela-/- displayed decreased proliferation and K12 and these could also be rescued with retinoic acid. These all indicate that NFKB signaling appears to regulate epithelial homeostasis and that the biological changes are presumably caused by a decrease in the enzyme, Aldh1a1, and can be rescued with exogenous retinoic acid. In addition these indicate that the environment of the central corneal cells is unique and the authors suggest that the stroma plays a major role but their investigation into this question are relatively limited and a mixture of questions are asked. That being said, the study up to this point is extremely interesting and suggests that the pathology is dynamic and "flexible" up until a certain point. While this does demonstrate that the study is not complete, it also suggests that there are many facets to further investigate, most specifically the role of the stroma.

As mentioned above, the weakness of the study occurred when the authors performed a number of experiments to understand the source of the factor. These included an analysis of expression of VEGF isoforms along with an inhibitor of VEGFR and an antibiotic. Neither of these altered the specific response and so only provided more questions. That being said, a simple ageing study revealed a very interesting observation and that is there was a natural thinning of the corneal thinning by 24 months of age that was similar to that induced by ablation of RelA in the mice. The authors showed that the changes were not detected at 20 months and demonstrated that if mice were treated with retinoic acid at 20 months for four months, they could delayed or inhibit thinning or plaque development.

The study is quite interesting where a normal ageing study is compared to changes that occur when RelA is ablated. The study indicates that there is a change in the level of enzyme over time and that rescue can occur by administering retinoic acid. It does not explain why the enzyme decreases or is suppressed with age, nor does it describe why it is region specific. The manuscript would be improved by:

1. Higher magnification of central and peripheral corneal images of the exact time pts where thinning occurs for the different conditions: Rela ablation, alkali burn, ageing in the presence or absence of RA. Digital expansion revealed a certain level of resolution but was not sufficient.

2. Supplement figures 1 and 2 should go in text to show the regions of the cornea that are affected. They confirm and are important.

3. Add the data in supplement figure 3 of corneal defects to figure 2 as it rules out a number of questions that occurs while the manuscript is being read and it completes the data.

4. The experiments on Vegf and antibiotics might fit better in supplement as they did not describe the mechanism.

5. The summary sentence of the result is weak and similarly for the discussion. It is quite an interesting and complex study and additional explanations should be explored! It appears that the canonical NFKb signaling pathway is a potential target, but it is complex as expression of K12 is not the only predictor as cells that are affected are in the central cornea and not peripheral or limbal.

Reviewer #3:

The manuscript by Yu and co-authors details an investigation into the effects of ablating Rela (a subunit of NF-ƙB) in K14+ basal cells then studying how corneas heal after inflicting a chemical wound and the pathology that ensure after a substantial follow-up period. Some of the features that develop in the mutant mice seem to be recapitulated is a fraction of physicologically aged (normal) mice, implying that this factor is a key regulatory element in supporting corneal homeostasis. The authors provide a wealth of data using a wide array of techniques in relations to characterizing the pathways and pathway elements that partake in the interesting phenomenon. This reviewer wondered how specific to the eye this discovery really is, given the mutation is global i.e. it presumably affects all 14+ basal epithelial cells through the body.

I have several concerns related to the writing of several section, study design, omission or inappropriate controls, animal numbers, statistics and general clarifications that should be addressed to improve the quality and impact of this study.

1. Introduction, page 4, paragraph 2, lines 7-8: "We hypothesized that NF-ƙB signaling plays important physiological roles in the cornea" Are there prior notifications in the literature that support this proposition? If so, the authors should elaborate and cite the relevant literature.

2. Introduction, page 4, paragraph 2, lines 8-22: This entire commentary is devoted to rehashing the results of the study. Overall, I felt the Introduction was poorly written because it provided little or no direction as to where the research was heading.

3. Results, page 6, lines 3-4: This first statement is an example of what is needed in the Introduction. This is to inform the reader of what is to come in the manuscript.

4. Results, related to Figure 1, lines 7 and 9: "but not much" and "reduced extent" We do not know for certain whether these results are significant or not because they are descriptive. I suggest some form of quantitation be performed.

5. Results, related to Figure 1, line 10: In reference to 'stromal' cells; what is their phenotype, i.e. are they resident keratocytes or infiltrating inflammatory cells?

6. Results, related to Figure 1, page 7, lines 1 and 2: "lacked a basal layer and basement membrane" How do the authors reconcile the absence of a BM without having stained for BM components or indeed performing ultrastructural (i.e. EM) investigations?

7. Figure 1: Please provide the graphical representation for the Western Blot in panel a and the appropriate statistics. In relation to Figure 1 panel b please provide the appropriate data from the isotype controls, this will establish specificity of the Rel A staining. IN relation to Figure 1 panel c. Please provide the quantification and the number of independent replicate this blot represents.

8. Results, related to Figure 2, line 8: 'Prrx1-cre', perhaps I missed it in my read but was this line ever explained?

9. Results, related to Figure 2, page 8, paragraph 1: In relation to the K14-Cre Relaf/f line are there any aberrations in other organs apart from the eye/cornea after all there are K14+ basal cells that are present in other organs, skin, nasal, oral mucosa, conjunctiva, intestine, etc. I realise that they have investigated the skin of these mice and found not abnormalities (Suppl Figure S5) but how old were these mice compared to those which develop corneal defects?

10. Results, related to Figure 3, page 8, line 20: "we found stromal cell hyperproliferation, leukocyte infiltration,.…." How were stromal cells marked, and were they activated fibroblasts i.e. myofibroblasts?

11. Results, page 9, line 12: "which are features characteristic of hyperproliferative skin" One way of confirming the phenotypic switch is to stain for pax6.

12. Results, related to Figure 3, page 10, paragraph 1: The authors should stain for K14 in wt and their mutant mice to confirm that the expression of this marker is not altered due to the genetic alteration in mutant mice.

13. Results, related to Figure 4, page 12, paragraph 1, line 8: Is RA synthesis defective in any other ocular tissue of body organ or (again) is this a cornea specific anomaly? The authors should screen other sites.

14. Results: In relation to Figure 5, none of the observations have been quantified, an effect is assumed based on visual inspection.

15. Results, related to Figure 6b, page 14, paragraph 1, lines 9-12: Axitinib had multiple affects e.g it 'suppressed epithelial cell metaplasia' In this setting it may have suppressed K1 but did K12 expression did not return. Therefore, what are these epithelial cells lining the cornea? Please identify and please quantify all features displayed in Figure 6b.

16. Results, related to Figure 7, page 16, paragraph 1: In relation to the data presented in Figure 7 are the naturally aged normal mice non-genetically manipulated (i.e. truly wt) and are they bread on the same background to the mutant mice? If not, this is a major flaw in the study. Did any BV or lymphatics form in the physiologically aged mice that developed corneal lesions and what is the pax6 status of these corneas? Likewise, some quantification of the data presented in panel d is necessary. In the third column of panel d what is vimentin detecting versus the α-SMA?

17. Results, related to Figure 7: In general, if mutant mice were aged (without wounding) would they develop the same corneal lesions (and in the same proportion of individuals) as their physiologically aged counterparts?

18. Results, related to Figure 8: In relation to opacity, how was this feature defined and measured. I suggest the authors identify the phenotype of the epithelium covering the cornea after RA treatment (K12/pax6/K14/ etc)

19. Discussion, general comment: How different is the corneal pathology in Notch mutant mice (see reference 21) compared to the defects that develop in the line being described herein?

20. Discussion, page 20, paragraph 2, lines 5 and 13: Does the expression of epidermal-specific genes revert to corneal-like genes after RA application? In other words, once cells have committed switch phenotype, are they able to revert back to their original lineage? Likewise, addition of VEGFR inhibitors seems to restore some of the pathological features but can this treatment restore corneal epithelial phenotype? This information is important.

21. Materials and methods, IF microscopy, IHC staining, Immunoblotting, pages 22-24: Information related to antibodies usage should be tabulated, informing the reader of the dilution and or final concentration of primary and secondary Abs used in each assay.

22. Materials and methods, alkaline burn model, page 24: How many mice in total were used and how was this number (per group) arrived at?

23. Materials and methods, corneal tight junction integrity, page 25: Why was this readout not quantifiable?

24. Materials and methods, RA and VEGF inhibitor administration, page 25: What were the diluent controls. Were they DMSO and corn oil respectively?

https://doi.org/10.7554/eLife.67315.sa1

Author response

Essential revisions:

The manuscript by Yu and co-authors investigates the effects of ablating Rela (a subunit of NF-ƙB) in K14+ basal cells then studying how corneas heal after inflicting a chemical wound and the pathology seen after a substantial follow-up period. Some of the features that develop in the mutant mice seem to be recapitulated in a fraction of normal aged mice, implying that this factor is a key regulatory element in supporting corneal homeostasis. The authors provide a wealth of data using a wide array of techniques in relations to characterizing the pathways and pathway elements that partake in the interesting phenomenon. The major concerns are:

1. The lack of clear organization of the paper makes it difficult to follow and to understand the significance. Rewriting the introduction, study design, results and discussion as well as addressing missing or inappropriate controls, animal numbers, statistics and general clarifications would help to improve the quality and impact of this study.

We have addressed these concerns accordingly in the revised manuscript. We have rewritten the introduction to highlight the study design, and the discussion. We have moved some of the results into the supplementary data, added the required controls, the numbers of mice used, and the statistics analysis results, and made some required clarifications.

2. The introduction should lead the reader into understanding why the study was done. In the discussion authors should not reiterate results but talk about 1.mechanism 2.significance with respect to human disease as age-related corneal dysfunction is not really a problem in humans without an underlying disease 3. how specific this discovery really is to the eye given that the mutation is global i.e. it presumably affects all 14+ basal epithelial cells through the body 4. The study indicates that there is a change in the level of Rela over time and that rescue can occur by administering retinoic acid. It does not explain why the enzyme decreases or is suppressed with age, nor does it describe why it is region specific.

We have shortened the description of the results and expanded the 4 aspects mentioned by the editor, in the discussion.

3. The paper's organization may also be improved by moving some studies to supplemental data.

The studies on vegf and those on the treatment with antibiotics should be in the supplemental data as nothing more is done with them.

The studies on aged mice are interesting but in showing that the response is similar without doing RNA seq on both tissues and comparing them, the reader is left hanging. These could be moved to supplemental data.

We have moved the results regarding VEGF and antibiotics into the supplementary information.

Regarding the aging-related studies, we think that it is an important part of the manuscript and hope to leave them in the main figures.

4. Many references are missing.

We have added 12 more references.

5. Quantification of data is missing in some instances and some controls are missing as noted in the reviews. The specific comments in the reviews should help guide the authors.

We have added the quantitation data wherever possible throughout the main and supplemental figures. Note that some of the staining results, for examples, extracellular proteins, are difficult to quantify.

Reviewer # 1:

This is a well executed study on the significance of knocking out Rela, that encodes a NFkB subunit in K14+ corneal epithelial stem cells in mice. This knockout results in aberrant wound healing, neovascularization, epithelial metaplasia, and plaque formation in the central cornea. Vitamin A deficiency is known to cause corneal dysfunction defects. Here the authors demonstrate that retinoic acid, a metabolic product of vitamin A, is important for regeneration and aging. The data provided by the authors largely support their conclusions. The main strength of the paper is novelty of demonstrating a RA-related defect in the central cornea but not the limbus. Furthermore, that normal aged corneas in mice have a similar defect to young Rela null mice, both of which are rescued with RA treatment.

In summary, the Rela KO did not affect corneal development. However, at 4 weeks when wounded with an alkaline burn, compared to control corneas, the Rela null mice demonstrate a loss of K12 and reduced PCNA in the cornea. Furthermore, after 2 months of aging (without injury), Rela null mice displayed large central plaque formation with neovascularization and metaplasia that increased in severity with aging. The limbus was not affected. These data suggest that Rela is required for maintaining corneal homeostasis mainly in the central cornea. Furthermore, RNA-seq analysis of the epithelial layers confirmed differentiation of epithelium into epidermis and cell cycle genes supporting excessive proliferation. Furthermore, using a K14-Cre; Relaf/f; Tomato mouse, the authors found that the epidermal genes were derived from K14+ cells. RA supplementation rescues the defect. Natural aging of mice demonstrates similar corneal defects to Rela null mice, which are rescued by treatment with RA.

The article could be strengthened in several ways. For example the interrogation of the importance of the VEGF pathway in plaque formation and metaplasia seems out of place. The authors treat for 6 months with an VEGFR inhibitor, although it does prevent neovascularization and metaplasia, it also prevents epithelial stratification. The analysis of these experiments would need to be clarified. Also, the VEGFR experiments are difficult to assimilate into the overall story and could be removed. In addition, the antibiotic treatment without an infection is difficult to comprehend and coordinate into the overall story. Finally, it would be helpful to propose how aging mouse corneas could compare to human corneal aging and if there is any data on corneal problems solely because of aging in humans.

We appreciate the reviewer’s comments and suggestions. We have moved the results of VEGFR experiments and antibiotic experiments to the supplementary data.

We have clarified why epithelial stratification was rescued. We found that stroma of the mutant mice expressed much higher levels of VEGFA, which could stimulate proliferation of epithelial or epidermal cells, in addition to promoting angiogenesis. This phenomenon has been observed in liver/liver cancer cells and other tissues.

The reason why we did antibiotics experiments is that the cornea of the mutant mice have open wounds due to disruption of the epithelial layer, this will increase the risk of infection. Indeed, we found immune cell infiltration in the cornea, which was suppressed by antibiotics treatment.

We also compared cornea aging in mice and human in the discussion. There are a couple of studies showing corneal thinning and keratinization in aged individuals, although they do not show progression into plaque formation or blindness. One possible explanation is that retinoic acid deficiency is uncommon due to balanced diet in human. Another possibility is that aging-induced eye defects may be diagnosed early and are successfully treated.

Please mention that transparency in the cornea is also from the secretion of crystallins.

We appreciate the reviewer’s suggestion and added the information in the introduction.

Please reference, limited by a lack of corneal donors, line 18.

We have added the references.

The basement membrane is a critical contributor to the maintenance of epithelial/stromal biology. This should be incorporated into the introduction with references to papers by Steve Wilson, a leader in the basement membrane literature.

We appreciate the reviewer’s suggestion and added the information on basement membranes and cited Steve Wilson’ papers.

A fairer way to quantify western blot is to take the average of the control (which can then have standard error) and then find the values for experimental/ave control. Even though control will still be 1, it will have incorporated the error into control lanes. For the western in 1a, it would be Control/actin and then experimental/actin divided by ave of control/actin. By setting the control to 1 all error is being eliminated. A small graph might work better.

We appreciate the reviewer’s suggestions. We have quantified all the western blot results in the way suggested by the reviewer and presented the data in the revised manuscript (Figure 1A, Figure 1C, Figure 4E and Figure 7A).

Mouse cornea is not fully developed until 6 weeks, the reason for NaOH at 4 weeks is not clear.

We appreciate the reviewer’s concern. The Rela knockout mice developed corneal defects at 6 weeks of age. We wanted to test the effect of Rela ablation on corneal regeneration before they show any defects. That was why we did the NaOH treatment at the age of 4 weeks and analyzed the mice at 6 weeks of age. We have clarified this issue in the revised manuscript.

There are many studies on corneal alkaline injury and the role of NFkB, please better reference these studies.

We appreciate the reviewer’s suggestion and added more related references.

It would have helpful to stain for scarring markers to understand more about the fibrotic response. There can be little SMA but still a large scar.

We appreciate the reviewer’s suggestion. We have performed immunostaining of FSP1 and picrosirius red staining to show the fibrotic response. The new results were included in the revised manuscript (Figure 3A, Figure 3—figure supplement 1, and Figure 6D).

I'm not sure that one can conclude that (page 13 line20) primary defects are caused by RA deletion and that the later effects are RA independent because these defects are not observed when the RA is supplied earlier.

We appreciate the reviewer’s comments. What we meant was that metaplasia and plaque formation were not directly caused by RA deficiency. We have rewritten this part of text to clarify this.

Typo figure 7 "tatal".

We have corrected this error.

Age-related corneal dysfunction is not really a problem in humans without an underlying disease. Please discuss.

We appreciate the reviewer’s suggestion and have expanded this part of the discussion.

Reviewer #2:

The authors used a number of approaches in studying the function of NFKB signaling in corneal epithelial homeostasis in control and K14-Cre;Relaf/f mice. To generate these mice, Relaf/f mice and K14-Cre mice were crossed and the following approaches were used to examine the mice over time and after injury; RNAseq, genetic analysis and lineage tracing, along with more traditional analyses of ChIP, molecular approaches and conventional immunohistochemistry. The authors showed that after an alkali injury there was a decrease in K12 and PCNA in the central cornea, that was not detected in the peripheral and limbal epithelium. Additional experiments supported the observation that the central cornea responds uniquely. When the authors examined the response in the stroma underlying the epithelium, they found that while there was an increase in thickness there was no fibrosis and they speculated that the response was secondary to the epithelium as it was not generated or detected until the epithelial changes occurred. RNA seq data of the cells where Rela was ablated demonstrated that there was a significant reduction in the expression of Aldh1a1 and ChIP verified the presence of the NFKB binding site on the Aldh1a1 promoter.

Further analyses demonstrated that the abnormal cells were all tomato+ indicating that the cells in the center were derived from K14; however it is not understood why the other K14 labelled cells in the cornea or in basal skin were not affected by RelA deletion. The authors showed that the response could be rescued when corneas were treated with retinoic acid before thinning and plaque development was detected. Conversely, there was no rescue if treated after thinning occurred. The authors also performed confirmatory experiments in vitro and found that cultured epithelial cells that were Rela-/- displayed decreased proliferation and K12 and these could also be rescued with retinoic acid. These all indicate that NFKB signaling appears to regulate epithelial homeostasis and that the biological changes are presumably caused by a decrease in the enzyme, Aldh1a1, and can be rescued with exogenous retinoic acid. In addition these indicate that the environment of the central corneal cells is unique and the authors suggest that the stroma plays a major role but their investigation into this question are relatively limited and a mixture of questions are asked. That being said, the study up to this point is extremely interesting and suggests that the pathology is dynamic and "flexible" up until a certain point. While this does demonstrate that the study is not complete, it also suggests that there are many facets to further investigate, most specifically the role of the stroma.

As mentioned above, the weakness of the study occurred when the authors performed a number of experiments to understand the source of the factor. These included an analysis of expression of VEGF isoforms along with an inhibitor of VEGFR and an antibiotic. Neither of these altered the specific response and so only provided more questions. That being said, a simple ageing study revealed a very interesting observation and that is there was a natural thinning of the corneal thinning by 24 months of age that was similar to that induced by ablation of RelA in the mice. The authors showed that the changes were not detected at 20 months and demonstrated that if mice were treated with retinoic acid at 20 months for four months, they could delayed or inhibit thinning or plaque development.

We thought that the findings that VEGFR inhibitor could suppress corneal epithelial metaplasia and plaque formation may have some clinical implications. The reason why we did the antibiotics-related study is that we saw open wounds in the cornea of the mutant mice, which would increase the risk of infection. Indeed we see immune cell infiltration in the stroma of the mutant mice was suppressed by antibiotics treatment.

Nevertheless, we have moved these results into the supplementary data.

The study is quite interesting where a normal ageing study is compared to changes that occur when RelA is ablated. The study indicates that there is a change in the level of enzyme over time and that rescue can occur by administering retinoic acid. It does not explain why the enzyme decreases or is suppressed with age, nor does it describe why it is region specific. The manuscript would be improved by:

We have discussed the possibility why Rela expression is suppressed in the aged corneal epithelia. This is an important question and is definitely worth studying in the future.

1. Higher magnification of central and peripheral corneal images of the exact time pts where thinning occurs for the different conditions: Rela ablation, alkali burn, ageing in the presence or absence of RA. Digital expansion revealed a certain level of resolution but was not sufficient.

We appreciate the reviewer’s suggestions. We have mended the figures and uploaded high magnification images in the figures mentioned (Figure 1D, Figure 1—figure supplement 2D, Figure 2B, Figure 2—figure supplement 2, Figure 5E, Figure 5—figure supplement 1B, Figure 6B, Figure 6—figure supplement 2).

2. Supplement figures 1 and 2 should go in text to show the regions of the cornea that are affected. They confirm and are important.

We have fixed the figures as suggested.

3. Add the data in supplement figure 3 of corneal defects to figure 2 as it rules out a number of questions that occurs while the manuscript is being read and it completes the data.

We appreciate the reviewer’s suggestion and have moved these figures into the main Figure 2 in the revised manuscript.

4. The experiments on Vegf and antibiotics might fit better in supplement as they did not describe the mechanism.

We appreciate the reviewer’s recommendations. We have moved the results on Vegf and antibiotics to the supplementary data.

5. The summary sentence of the result is weak and similarly for the discussion. It is quite an interesting and complex study and additional explanations should be explored! It appears that the canonical NFKb signaling pathway is a potential target, but it is complex as expression of K12 is not the only predictor as cells that are affected are in the central cornea and not peripheral or limbal.

We appreciate the reviewer’s suggestions. We have rewritten the result summary sentences and the discussion. In addition, we have toned down the notion that RA is a target for treatment of related ocular diseases and proposed the use of RA-containing ointment to the central cornea.

Reviewer #3:

The manuscript by Yu and co-authors details an investigation into the effects of ablating Rela (a subunit of NF-ƙB) in K14+ basal cells then studying how corneas heal after inflicting a chemical wound and the pathology that ensure after a substantial follow-up period. Some of the features that develop in the mutant mice seem to be recapitulated is a fraction of physicologically aged (normal) mice, implying that this factor is a key regulatory element in supporting corneal homeostasis. The authors provide a wealth of data using a wide array of techniques in relations to characterizing the pathways and pathway elements that partake in the interesting phenomenon. This reviewer wondered how specific to the eye this discovery really is, given the mutation is global i.e. it presumably affects all 14+ basal epithelial cells through the body.

We have analyzed a few tissues where epithelial cells are known to be marked by K14 and found that these tissues did not show obvious defects in the knockout mice, indicating that the effect of Rela ablation is rather specific to the central cornea. This may be attributable to constant exposure of the cornea, especially the central region, to external environment including UV lights, infectious particles, chemicals, and dirt.

I have several concerns related to the writing of several section, study design, omission or inappropriate controls, animal numbers, statistics and general clarifications that should be addressed to improve the quality and impact of this study.

1. Introduction, page 4, paragraph 2, lines 7-8: "We hypothesized that NF-ƙB signaling plays important physiological roles in the cornea" Are there prior notifications in the literature that support this proposition? If so, the authors should elaborate and cite the relevant literature.

We appreciate the reviewer’s comments. We have rewritten this part of the introduction and added more references.

2. Introduction, page 4, paragraph 2, lines 8-22: This entire commentary is devoted to rehashing the results of the study. Overall, I felt the Introduction was poorly written because it provided little or no direction as to where the research was heading.

We appreciate the reviewer’s concern. We have rewritten this part of the introduction by shortening the description of the results and stressing the logic behind the study design.

3. Results, page 6, lines 3-4: This first statement is an example of what is needed in the Introduction. This is to inform the reader of what is to come in the manuscript.

We appreciate the reviewer’s concern. We have rewritten this part of the introduction and cited more papers.

4. Results, related to Figure 1, lines 7 and 9: "but not much" and "reduced extent" We do not know for certain whether these results are significant or not because they are descriptive. I suggest some form of quantitation be performed.

We appreciate the reviewer’s suggestions. We have added the quantitation data wherever possible.

5. Results, related to Figure 1, line 10: In reference to 'stromal' cells; what is their phenotype, i.e. are they resident keratocytes or infiltrating inflammatory cells?

They are keratocytes. We have clarified this in the revised text.

6. Results, related to Figure 1, page 7, lines 1 and 2: "lacked a basal layer and basement membrane" How do the authors reconcile the absence of a BM without having stained for BM components or indeed performing ultrastructural (i.e. EM) investigations?

We appreciate the reviewer’s concern. We have performed immunostaining of laminin (a marker of basement membrane) and the results support the disruption of the basement membranes (Figure 1D).

7. Figure 1: Please provide the graphical representation for the Western Blot in panel a and the appropriate statistics. In relation to Figure 1 panel b please provide the appropriate data from the isotype controls, this will establish specificity of the Rel A staining. IN relation to Figure 1 panel c. Please provide the quantification and the number of independent replicate this blot represents.

We appreciate the reviewer’s suggestions. We have quantified all western blot results and added the statistics data. We also added isotype control for RelA antibody and the information about the number of mice used in the experiments (Figure 1A-C).

8. Results, related to Figure 2, line 8: 'Prrx1-cre', perhaps I missed it in my read but was this line ever explained?

We have added information about Prrx1 and Prrx1-Cre mice.

9. Results, related to Figure 2, page 8, paragraph 1: In relation to the K14-Cre Relaf/f line are there any aberrations in other organs apart from the eye/cornea after all there are K14+ basal cells that are present in other organs, skin, nasal, oral mucosa, conjunctiva, intestine, etc. I realise that they have investigated the skin of these mice and found not abnormalities (Suppl Figure S5) but how old were these mice compared to those which develop corneal defects?

In our initial submissions, we have analyzed the conjunctiva and meibomian glands in 6-month-old mice. In the revised manuscript, we have added the results for oral mucosa, intestine and trachea (see tracing results in Figure 1—figure supplement 2B and histological studies of Rela knockout mice in Figure 3—figure supplement 4C). There are no anomalies in these organs in 6-month-old mutant mice, confirming the effect of Rela ablation is rather specific to the central cornea. We have discussed the possibility for this tissue-specific effects in the revised manuscript.

10. Results, related to Figure 3, page 8, line 20: "we found stromal cell hyperproliferation, leukocyte infiltration,.…." How were stromal cells marked, and were they activated fibroblasts i.e. myofibroblasts?

We used Vimentin and FSP1 (new data) to mark stromal cells and αSMA to mark activated fibroblasts including myofibroblasts (Figure 3A).

11. Results, page 9, line 12: "which are features characteristic of hyperproliferative skin" One way of confirming the phenotypic switch is to stain for pax6.

We appreciate the reviewer’s suggestion. We have done immunostaining of Pax6 and found that Pax6 expression is drastically reduced in the corneas of the mutant mice (Figure 3F).

12. Results, related to Figure 3, page 10, paragraph 1: The authors should stain for K14 in wt and their mutant mice to confirm that the expression of this marker is not altered due to the genetic alteration in mutant mice.

We appreciate the reviewer’s suggestion. We have performed immunostaining of K14 on eye sections and found that K14 expression is normal in young mice before they develop corneal phenotypes (Figure 1—figure supplement 2C), suggesting that K14 is not affected by Cre insertion or Rela deletion. We also stained cultured corneal epithelial cells from WT and the mutant mice and found that K14 expression is unaltered (data not shown due to space limit).

13. Results, related to Figure 4, page 12, paragraph 1, line 8: Is RA synthesis defective in any other ocular tissue of body organ or (again) is this a cornea specific anomaly? The authors should screen other sites.

We appreciate the reviewer’s comments. We have done immunostaining of Aldh1a1 and found that expression of this enzyme was reduced in the limbus and conjunctiva of the mutant mice, yet, meibomian glands express undetectable levels of this enzyme in WT or mutant mice (Figure 4F, and Figure 4—figure supplement 2).

14. Results: In relation to Figure 5, none of the observations have been quantified, an effect is assumed based on visual inspection.

We appreciate the reviewer’s suggestions. We have added the quantification data (Figure 5A, 5D, and 5F)

15. Results, related to Figure 6b, page 14, paragraph 1, lines 9-12: Axitinib had multiple affects e.g it 'suppressed epithelial cell metaplasia' In this setting it may have suppressed K1 but did K12 expression did not return. Therefore, what are these epithelial cells lining the cornea? Please identify and please quantify all features displayed in Figure 6b.

We appreciate the reviewer’s concerns. There are no epithelial cells lining the cornea after axitinib treatment as epithelial layer disruption was not rescued by Axitinib. We have added quantification data and clarified this issue in the revised manuscript (Figure 5—figure supplement 2B).

16. Results, related to Figure 7, page 16, paragraph 1: In relation to the data presented in Figure 7 are the naturally aged normal mice non-genetically manipulated (i.e. truly wt) and are they bread on the same background to the mutant mice? If not, this is a major flaw in the study. Did any BV or lymphatics form in the physiologically aged mice that developed corneal lesions and what is the pax6 status of these corneas? Likewise, some quantification of the data presented in panel d is necessary. In the third column of panel d what is vimentin detecting versus the α-SMA?

We appreciate the reviewer’s suggestions. The naturally aged normal mice are non-genetically manipulated, on the same background as the mutant mice (B6), and maintained in the same animal facility. We have done immunostaining of CD31 and lyve1 and detected BV and lymphatics in the physiologically aged mice. We also immunostained Pax6 and found a defect in Pax6 expression as well. In addition, we have added the quantification data (Figure 6D). Vimentin and FSP1 were used to stain fibroblasts while aSMA was used to stain activated fibroblasts (myofibroblasts).

17. Results, related to Figure 7: In general, if mutant mice were aged (without wounding) would they develop the same corneal lesions (and in the same proportion of individuals) as their physiologically aged counterparts?

All the mutant mice develop corneal epithelial thinning at 2 months of age and plaque formation/metaplasia at 6 months of age, although the mice did show some variation in the severity of these phenotypes. The thinning of the epithelial layer precedes stromal remodeling and plaque formation. Our study suggest that the decreases in Rela expression and RA synthesis underly natural aging of the cornea. The decline in Rela expression is likely affected by both intrinsic and extrinsic factors during the aging process, for example, by ROS and chronic inflammation, two important pro-aging factors. We have discussed this point in the revised manuscript.

18. Results, related to Figure 8: In relation to opacity, how was this feature defined and measured. I suggest the authors identify the phenotype of the epithelium covering the cornea after RA treatment (K12/pax6/K14/ etc)

We appreciate the reviewer’s suggestions. The opacity can be affected by many factors and is not easy to define in mice. We have tried to use this word and designated corneal thinning/disruption-only mice as “moderate” and mice with corneal plaque formation as “severe”. We have added more immunostaining results in the revised manuscript, which suggest that the epithelium covering the cornea is keratinized skin-like cells (Figure 7F, Figure 7—figure supplement 1).

19. Discussion, general comment: How different is the corneal pathology in Notch mutant mice (see reference 21) compared to the defects that develop in the line being described herein?

We appreciate the reviewer’s suggestion. We have added the comparison in the discussion of the revised manuscript. There are a few differences between these two mouse models. The Notch1 deficient mice show a loss of meibomian glands and much reduced expression of retinol transporting protein CRBP1 but not thinning or loss of the epithelial layer, compared to K14-Cre; Relaf/f mice. Despite the differences, both models underscore the importance of RA pathway in cornea maintenance and regeneration.

20. Discussion, page 20, paragraph 2, lines 5 and 13: Does the expression of epidermal-specific genes revert to corneal-like genes after RA application? In other words, once cells have committed switch phenotype, are they able to revert back to their original lineage? Likewise, addition of VEGFR inhibitors seems to restore some of the pathological features but can this treatment restore corneal epithelial phenotype? This information is important.

The expression of epidermal-specific genes could not revert to corneal-like genes after RA application based on treatment of K14-Cre; Relaf/f mice with RA at 3 months of age, suggesting that RA cannot reverse the metaplasia process. VEGFR inhibitors could not restore corneal epithelial phenotype either. However, RA could prevent the conversion of epithelial to epidermal cells. We have clarified this issue in the revised manuscript.

21. Materials and methods, IF microscopy, IHC staining, Immunoblotting, pages 22-24: Information related to antibodies usage should be tabulated, informing the reader of the dilution and or final concentration of primary and secondary Abs used in each assay.

We appreciate the reviewer’s suggestions. We have generated a table to include all the information of all the antibodies used in this study.

22. Materials and methods, alkaline burn model, page 24: How many mice in total were used and how was this number (per group) arrived at?

We used 3-6 mice per group. We chose this number based on reported studies in the literature.

23. Materials and methods, corneal tight junction integrity, page 25: Why was this readout not quantifiable?

This readout was quantifiable and we have added quantification data.

24. Materials and methods, RA and VEGF inhibitor administration, page 25: What were the diluent controls. Were they DMSO and corn oil respectively?

For RA, the diluent control was DMSO/corn oil (1:19). For Axitinib, the diluent control was DMSO/ PEG300/Tween80/Water (1:8:1:8). The diluent was used as Veh. We have included the information in the revised manuscript.

https://doi.org/10.7554/eLife.67315.sa2

Article and author information

Author details

  1. Qian Yu

    Bio-X Institutes, Key Laboratory for the Genetics of Developmental and Neuropsychiatric Disorders, Ministry of Education, Shanghai Jiao Tong University, Shanghai, China
    Contribution
    Conceptualization, Data curation, Formal analysis, Validation, Investigation, Visualization, Methodology, Project administration, Writing - review and editing
    Competing interests
    No competing interests declared

  2. Soma Biswas

    Department of Ophthalmology, Xinhua Hospital affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai, China
    Contribution
    Methodology, Writing - review and editing
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-1427-2678

  3. Gang Ma

    Bio-X Institutes, Key Laboratory for the Genetics of Developmental and Neuropsychiatric Disorders, Ministry of Education, Shanghai Jiao Tong University, Shanghai, China
    Contribution
    Resources, Writing - review and editing
    Competing interests
    No competing interests declared

  4. Peiquan Zhao

    Department of Ophthalmology, Xinhua Hospital affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai, China
    Contribution
    Writing - review and editing
    Competing interests
    No competing interests declared

  5. Baojie Li

    1. Bio-X Institutes, Key Laboratory for the Genetics of Developmental and Neuropsychiatric Disorders, Ministry of Education, Shanghai Jiao Tong University, Shanghai, China
    2. Institute of Traditional Chinese Medicine and Stem Cell Research, School of Basic Medicine, Chengdu University of Traditional Chinese Medicine, Chengdu, China
    Contribution
    Conceptualization, Supervision, Funding acquisition, Writing - original draft, Project administration, Writing - review and editing
    For correspondence
    libj@sjtu.edu.cn
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-3913-1062

  6. Jing Li

    Department of Ophthalmology, Xinhua Hospital affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai, China
    Contribution
    Conceptualization, Supervision, Project administration, Writing - review and editing
    For correspondence
    lijing@xinhuamed.com.cn
    Competing interests
    No competing interests declared

Funding

National Key Research and Development Program of China (2018YFA0800801)

  • Jing Li

National Key Research and Development Program of China (2018YFA0800803)

  • Baojie Li

National Natural Science Foundation of China (91749201)

  • Baojie Li

National Science Foundation of China (81873679)

  • Jing Li

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

The work was supported by the National Key Scientific Program (2018YFA0800801 and 2018YFA0800803) and the National Natural Science Foundation of China (81520108012 and 91749201).

Ethics

Animal experimentation: All the mouse work was carried out following the recommendations by the National Research Council Guide for the Care and Use of Laboratory Animals, with the protocols approved by the Institutional Animal Care and Use Committee of Shanghai, China [SYXK(SH)2011-0112].

Senior Editor

  1. Kathryn Song Eng Cheah, The University of Hong Kong, Hong Kong

Reviewing Editor

  1. Lois Smith, Boston Children's Hospital/Harvard Medical School, United States

Version history

  1. Received: February 7, 2021
  2. Accepted: June 4, 2021
  3. Accepted Manuscript published: June 4, 2021 (version 1)
  4. Version of Record published: June 10, 2021 (version 2)

Copyright

© 2021, Yu et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,168
    Page views
  • 200
    Downloads
  • 5
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Qian Yu
  2. Soma Biswas
  3. Gang Ma
  4. Peiquan Zhao
  5. Baojie Li
  6. Jing Li
(2021)
Canonical NF-κB signaling maintains corneal epithelial integrity and prevents corneal aging via retinoic acid
eLife 10:e67315.
https://doi.org/10.7554/eLife.67315

Categories and tags

Research organism

Further reading

    1. Biochemistry and Chemical Biology
    2. Cell Biology

    Genetically engineered mesenchymal stem cells as a nitric oxide reservoir for acute kidney injury therapy

    Haoyan Huang, Meng Qian ... Zongjin Li
    Research Article Updated

    Nitric oxide (NO), as a gaseous therapeutic agent, shows great potential for the treatment of many kinds of diseases. Although various NO delivery systems have emerged, the immunogenicity and long-term toxicity of artificial carriers hinder the potential clinical translation of these gas therapeutics. Mesenchymal stem cells (MSCs), with the capacities of self-renewal, differentiation, and low immunogenicity, have been used as living carriers. However, MSCs as gaseous signaling molecule (GSM) carriers have not been reported. In this study, human MSCs were genetically modified to produce mutant β-galactosidase (β-GALH363A). Furthermore, a new NO prodrug, 6-methyl-galactose-benzyl-oxy NONOate (MGP), was designed. MGP can enter cells and selectively trigger NO release from genetically engineered MSCs (eMSCs) in the presence of β-GALH363A. Moreover, our results revealed that eMSCs can release NO when MGP is systemically administered in a mouse model of acute kidney injury (AKI), which can achieve NO release in a precise spatiotemporal manner and augment the therapeutic efficiency of MSCs. This eMSC and NO prodrug system provides a unique and tunable platform for GSM delivery and holds promise for regenerative therapy by enhancing the therapeutic efficiency of stem cells.

    1. Biochemistry and Chemical Biology
    2. Cell Biology

    The FAM104 proteins VCF1/2 promote the nuclear localization of p97/VCP

    Maria Körner, Susanne R Meyer ... Alexander Buchberger
    Research Article Updated

    The ATPase p97 (also known as VCP, Cdc48) has crucial functions in a variety of important cellular processes such as protein quality control, organellar homeostasis, and DNA damage repair, and its de-regulation is linked to neuromuscular diseases and cancer. p97 is tightly controlled by numerous regulatory cofactors, but the full range and function of the p97–cofactor network is unknown. Here, we identify the hitherto uncharacterized FAM104 proteins as a conserved family of p97 interactors. The two human family members VCP nuclear cofactor family member 1 and 2 (VCF1/2) bind p97 directly via a novel, alpha-helical motif and associate with p97-UFD1-NPL4 and p97-UBXN2B complexes in cells. VCF1/2 localize to the nucleus and promote the nuclear import of p97. Loss of VCF1/2 results in reduced nuclear p97 levels, slow growth, and hypersensitivity to chemical inhibition of p97 in the absence and presence of DNA damage, suggesting that FAM104 proteins are critical regulators of nuclear p97 functions.

    1. Cell Biology
    2. Neuroscience

    Removal of extracellular human amyloid beta aggregates by extracellular proteases in C. elegans

    Elisabeth Jongsma, Anita Goyala ... Collin Yvès Ewald
    Research Article Updated

    The amyloid beta (Aβ) plaques found in Alzheimer’s disease (AD) patients’ brains contain collagens and are embedded extracellularly. Several collagens have been proposed to influence Aβ aggregate formation, yet their role in clearance is unknown. To investigate the potential role of collagens in forming and clearance of extracellular aggregates in vivo, we created a transgenic Caenorhabditis elegans strain that expresses and secretes human Aβ1-42. This secreted Aβ forms aggregates in two distinct places within the extracellular matrix. In a screen for extracellular human Aβ aggregation regulators, we identified different collagens to ameliorate or potentiate Aβ aggregation. We show that a disintegrin and metalloprotease a disintegrin and metalloprotease 2 (ADM-2), an ortholog of ADAM9, reduces the load of extracellular Aβ aggregates. ADM-2 is required and sufficient to remove the extracellular Aβ aggregates. Thus, we provide in vivo evidence of collagens essential for aggregate formation and metalloprotease participating in extracellular Aβ aggregate removal.