De novo macrocyclic peptides dissect energy coupling of a heterodimeric ABC transporter by multimode allosteric inhibition
- Institute of Biochemistry, Biocenter, Goethe University Frankfurt, Germany
- Department of Chemistry, Graduate School of Science, The University of Tokyo, Japan
- Institute of Physical and Theoretical Chemistry, Goethe University Frankfurt, Germany
Figures
Figure 1 with 1 supplement
Selection of macrocyclic peptides (CPs) by random nonstandard peptide integrated discovery (RaPID).
(A) RaPID selection of CPs. Starting from a DNA library, macrocyclic peptides were generated through transcription and ribosomal translation using the Flexible In-vitro Translation (FIT) system. …
-
Figure 1—source data 1
Sequencing Data for Section of CPs.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig1-data1-v2.zip
Figure 1—figure supplement 1
Selection and synthesis of CPs.
(A) TmrAEQB was reconstituted in lipid nanodiscs composed of biotinylated (B) MSP. Reconstituted nanodiscs were isolated by size-exclusion chromatography (SEC). Empty nanodiscs without TmrAEQB were …
Figure 2 with 2 supplements
CPFs specifically interact with TmrAB displaying nanomolar binding affinities.
(A, B) Equilibrium binding analysis. Fluorescence anisotropy of CPFs (50 nM) was determined at λex/em = 485/520 nm with increasing concentrations of TmrAB which was reconstituted in liposomes. TmrAB …
-
Figure 2—source data 1
Source data for Figure 2.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig2-data1-v2.docx
Figure 2—figure supplement 1
CPs specifically bind to TmrAB.
(A) CPBs-mediated isolation of solubilized TmrAB. Streptavidin matrices were loaded with CPBs (1 µM) and incubated with purified TmrAB (60 nM) for 1 hr at 4°C. Beads without CPBs served as control …
-
Figure 2—figure supplement 1—source data 1
Source Data for Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig2-figsupp1-data1-v2.docx
Figure 2—figure supplement 2
Analysis of CPF-TmrAB complexes by native mass spectrometry.
TmrAB (4 µM) was buffer exchanged to ESI buffer and incubated with a 2-fold molar excess of CPFs for 10 min on ice. Protein complexes were investigated by ESI-TOF-mass spectrometry. (A) CP6F-TmrAB …
Figure 3
CPFs are potent inhibitors of ATP turnover and substrate transport.
(A) Experimental scheme of ATP hydrolysis and peptide transport by TmrAB. (B) CPFs inhibit ATP hydrolysis. TmrAB in liposomes (100 nM) was incubated with ATP (2 mM, traced with [γ32P]-ATP), and MgCl2…
-
Figure 3—source data 1
Source data for Figure 3.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig3-data1-v2.docx
Figure 4
CPs do not affect peptide or ATP binding of TmrAB.
(A) CPFs binding TmrAB is not affected by substrate peptide binding. After the addition of TmrAB (0.6 µM for CP6F and CP13F, 0.7 µM for CP12F, 0.5 µM for CP14F), fluorescence anisotropy of CPFs (50 …
-
Figure 4—source data 1
Source data for Figure 4.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig4-data1-v2.docx
Figure 5 with 1 supplement
CPs bind preferentially to IF- und OF conformation and stabilize nucleotide occlusion.
Conformation-specific preference of CPs. (A, B) CP6F (A) or CP13F (B, 50 nM each) were incubated with increasing concentrations of detergent-solubilized inward-facing TmrAB (in the absence of …
-
Figure 5—source data 1
Source Data for Figure 5.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig5-data1-v2.docx
Figure 5—figure supplement 1
Conformational arrest of TmrAB by CPFs.
(A) CPFs (50 nM each) were incubated with increasing concentrations of detergent-solubilized IF TmrAB in the inward-facing (IF) conformation (absence of Mg-ATP) or TmrAEQB populated in the …
-
Figure 5—figure supplement 1—source data 1
Source Data for Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig5-figsupp1-data1-v2.docx
Figure 6 with 1 supplement
CPs block multiple-turnover transport monitored by quantitative flow cytometry.
(A) Single turnover by IF-to-OF switch monitored by single-liposome flow cytometry. TmrAB in liposomes (0.4 µM) were incubated with C4ATTO655 peptide (1 µM), ATP/ADP (3 mM), MgCl2 (5 mM), and CPFs …
-
Figure 6—source data 1
Source data for Figure 6.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig6-data1-v2.docx
Figure 6—figure supplement 1
Linear regression of quantitative flow cytometry analysis.
(A) Gating strategy. Liposomes were selected according to side and forward scatter areas. Single liposomes were gated based on the height of forward scatter correlated to the area of forward …
-
Figure 6—figure supplement 1—source data 1
Source Data for Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/67732/elife-67732-fig6-figsupp1-data1-v2.docx
Figure 7
Substrate translocation precedes ATP hydrolysis in a heterodimeric ABC transporter.
In the resting IF state, TmrAB binds nucleotides and substrates independently, which is not affected by CPs. ATP binding induces an IF-to-OF switch, which drives unidirectional substrate …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Monoclonal α-His antibody | Sigma-Aldrich | SAB1305538 | Mouse origin. Final dilution: 1/2,000 (v/v) |
| Antibody | α-Mouse-HRP conjugate | Sigma-Aldrich | AP130P | Goat origin. Final dilution: 1/20,000 (v/v) |
| Chemical compound, drug | β-n-Dodecyl β-D-maltoside (DDM) | Carl Roth | CN26.5 | |
| Chemical compound, drug | Bovine brain lipid extract | Sigma-Aldrich | B1502 | |
| Chemical compound, drug | [2,5’,8-3H(N)]-ATP (3H-ATP) | PerkinElmer | NET118900 | |
| Chemical compound, drug | [α32P]-ATP | Hartmann Analytic | FP-207 | |
| Chemical compound, drug | Copper-chelated PVT SPA beads | PerkinElmer | RPNQ0095 | |
| Chemical compound, drug | ClAc-D-Tyr-CME | Synthesized according to DOI: 10.1021/cb200388k | ||
| Chemical compound, drug | Fmoc-protected amino acids | Merck Millipore/Watanabe Chemical Industries | various | |
| Chemical compound, drug | HBTU | Watanabe Chemical Industries | A00149 | |
| Chemical compound, drug | HOBt | Watanabe Chemical Industries | A00014 | |
| Chemical compound, drug | NovaPEG Rink Amide resin | Merck Millipore | 855047 | |
| Chemical compound, drug | N,N-Diisopropylethylamine | Nacalai Tesque | 14014–55 | |
| Chemical compound, drug | N,N-Dimethylformamide | Nacalai Tesque | 13016–23 | |
| Chemical compound, drug | 5/6-Carboxyfluorescein succinimidyl ester | Thermo Fisher Scientific | 46410 | |
| Chemical compound, drug | Acetonitrile | Wako Chemicals | 015–08633 | |
| Chemical compound, drug | Trifluoroacetic acid | Nacalai Tesque | 3483305 | |
| Chemical compound, drug | D-Biotin | Nacalai Tesque | 04822–91 | |
| Chemical compound, drug | Pluronic F127 | Sigma-Aldrich | P2443 | |
| Chemical compound, drug | Albumin, Bovine, Acetylated | Nacalai Tesque | 01278–44 | |
| Chemical compound, drug | NTPs | Jena Bioscience | NU-1010 NU-1011 NU-1012 NU-1013 | |
| Chemical compound, drug | Dynabeads M-280 Streptavidin | Thermo Fisher Scientific | 11206 | |
| Sequence-based reagent | T7g10M.F46 | Eurofins Genomics K.K. (Japan) | PCR primer | TAATACGACTCACTATAGGGTTAACTTTAAGAAGGAGATATACATA |
| Sequence-based reagent | NNK(n).R(3n + 45)n = 10–15 | Eurofins Genomics K.K. (Japan) | PCR primer for DNA library | GCTGCCGCTGCCGCTGCCGCA(MNN)nCATATGTATATCTCCTTCTTAAAG |
| Sequence-based reagent | CGS3an13.R36 | Eurofins Genomics K.K. (Japan) | PCR primer | TTTCCGCCCCCCGTCCTAGCTGCCGCTGCCGCTGCC |
| Sequence-based reagent | Ini-3'.R20-Me | Gene Design Inc (Japan) | PCR primer for tRNAfMetCAU assembly | TGmGTTGCGGGGGCCGGATTT (Gm = 2'-Methoxylated G) |
| Sequence-based reagent | Ini-3'.R38 | Eurofins Genomics K.K. (Japan) | PCR primer for tRNAfMetCAU assembly | TGGTTGCGGGGGCCGGATTTGAACCGACGATCTTCGGG |
| Sequence-based reagent | Ini1-1G-5'.F49 | Eurofins Genomics K.K. (Japan) | PCR primer for tRNAfMetCAU assembly | GTAATACGACTCACTATAGGCGGGGTGGAGCAGCCTGGTAGCTCGTCGG |
| Sequence-based reagent | Ini cat.R44 | Eurofins Genomics K.K. (Japan) | PCR primer for tRNAfMetCAU assembly | GAACCGACGATCTTCGGGTTATGAGCCCGACGAGCTACCAGGCT |
| Sequence-based reagent | Fx5'.F36 | Eurofins Genomics K.K. (Japan) | PCR primer for eFx assembly | GTAATACGACTCACTATAGGATCGAAAGATTTCCGC |
| Sequence-based reagent | eFx.R45 | Eurofins Genomics K.K. (Japan) | PCR primer for eFx assembly | ACCTAACGCTAATCCCCTTTCGGGGCCGCGGAAATCTTTCGATCC |
| Sequence-based reagent | eFx.R18 | Eurofins Genomics K.K. (Japan) | PCR primer for eFx assembly | ACCTAACGCTAATCCCCT |
| Sequence-based reagent | T7e × 5 .F22 | Eurofins Genomics K.K. (Japan) | PCR primer for eFx assembly | GGCGTAATACGACTCACTATAG |
| Sequence-based reagent | DNA-PEG-puromycin | Gene Design Inc, Osaka, Japan | linker for mRNA display | CTCCCGCCCCCCGTCC-(PEG18)5-CC-Pu |
| Gene | TmrA | Q72J05 | TTC0976 | Species: Thermus thermophilus |
| Gene | TmrB | Q72J04 | TTC0977 | Species: Thermus thermophilus |
| Peptide, recombinant protein | RRY-C*-KSTEL | This study (methods and material) | C* denotes fluorescein-labeled Cys | |
| Peptide, recombinant protein | Macrocyclic peptides CP6, CP12, C13 and CP14 | This study (methods and material) | ||
| Peptide, recombinant protein | KOD DNA Polymerase | Prepared in house (methods and material) | ||
| Peptide, recombinant protein | T7 RNA polymerase | Prepared in house (methods and material) | ||
| Peptide, recombinant protein | T4 RNA ligase | Prepared in house (methods and material) | ||
| Peptide, recombinant protein | FIT system | Prepared in house according to DOI: 10.1038/nprot.2015.082 | 50 mM HEPES-KOH (pH 7.6), 12 mM magnesium acetate, 100 mM potassium acetate, 2 mM spermidine, 20 mM creatine phosphate, 2 mM DTT,2 mM ATP, 2 mM GTP, 1 mM CTP,1 mM UTP, 0.5 mM 19 proteinogenic amino acids other than Met, 1.5 mg/ml E. coli total tRNA, 0.73 µM AlaRS, 0.03 µM ArgRS, 0.38 µM AsnRS, 0.13 µM AspRS,0.02 µM CysRS, 0.06 µM GlnRS, 0.23 µM GluRS, 0.09 µM GlyRS, 0.02 µM HisRS,0.4 µM IleRS, 0.04 µM LeuRS, 0.11 µM LysRS, 0.03 µM MetRS, 0.68 µM PheRS,0.16 µM ProRS, 0.04 µM SerRS, 0.09 µM ThrRS, 0.03 µM TrpRS, 0.02 µM TyrRS,0.02 µM ValRS, 0.6 µM MTF, 2.7 µM IF1,0.4 µM IF2, 1.5 µM IF3,0.26 µM EF-G, 10 µM EF-Tu,10 µM EF-Ts, 0.25 µM RF2,0.17 µM RF3, 0.5 µM RRF,0.1 µM T7 RNA polymerase, 4 µg/ml creatine kinase, 3 µg/ml myokinase,0.1 µM pyrophosphatase, 0.1 µM nucleotide-diphosphatase kinase, 1.2 µM ribosome | |
| Recombinant DNA reagent | pET-22b | Merck Millipore | 69744 | Vector for protein expression in E. coli |
| Strain, strain background (Escherichia coli) | BL21(DE3) | Thermo Fisher | C600003 | Chemically competent cells |
| Software, Algorithm | Prism 5 | GraphPad | ||
| Software, algorithm | Cytoscape | Shannon P et al. Genome Research 2003 13(11) 2498–504 | ||
| Software, algorithm | EFI-EST | Gerlt JA et al. Biochim Biophys Acta 1854: 1019-37 | ||
| Software, algorithm | WebLogo | Crooks GE et al. Genome 561 Res 14: 1188–90 |
