Retinoic acid signaling is directly activated in cardiomyocytes and protects mouse hearts from apoptosis after myocardial infarction
- Université Côte d'Azur, Inserm, CNRS, iBV, France
- IGBMC, Inserm U1258, UNISTRA CNRS, France
Figures
Figure 1 with 1 supplement
A novel RARECreERT2 line recapitulates endogenous RA signaling in mouse embryos.
(A) Scheme illustrating the strategy used to test the novel RARECreERT2 line during various stages of embryonic development. The RARECreERT2 line was crossed with the Rosa26LacZ (R26L) or the membrane targeted tandem dimer Tomato membrane targeted green fluorescent protein (mTmG) reporter lines and recombination was induced via tamoxifen (TAM) administration at multiple time-points. Gray arrowheads represent loxP sites. (B) Whole-mount X-gal staining of RARECreERT2 R26L embryos induced at embryonic day 6.5 (E6.5) or E7.5 followed by respective analyses at E9.5 or E10.5 demonstrates efficient labeling with the lacZ reporter. Notice the labeling of the forelimbs (Li) with the E7.5 pulse. (C) Whole-mount GFP IF of RARECreERT2 embryos crossed with the mTmG reporter, pulsed with tamoxifen at E7.5 and sacrificed at E10.5 reveals specific forebrain (Fo) labeling. (D) GFP IF on sagittal sections of E11.5 embryos pulsed with tamoxifen at E7.5 and E8.5. Labeling is detected in various organs and tissues with well described RA activity such as the heart (He), spinal cord (SC), hepatic primordium (HP), lung bud (LB), and developing somites (So). Heads were removed for analysis. (E) Co-IF with GFP and Myoblast determination protein (MYOD) antibodies reveals RA-responsive cells in developing somites when pulsed at E8.5 and analyzed at E11.5. (F) Embryos pulsed with tamoxifen at E7.5 and E8.5 and analyzed at E11.5 display efficient labeling of the neural retina (NR), lens (L) and retinal pigment epithelium (RPE) of the eye as determined by GFP IF. Data information: For all experiments, n = 3 embryos were analyzed and representative embryos shown. See also Figure 1—figure supplement 1.
Figure 1—figure supplement 1
The RARECreERT2 line points to a reduced response at later time-points in embryonic development.
(A) GFP IF on a RARECreERT2; mTmG embryo pulsed with tamoxifen at E8.5 and sacrificed at E11.5 reveals partial labeling of the neural retina (NR), lens (L) and retinal pigment epithelium (RPE) cells in the developing eye (n = 3 embryos analyzed). (B) Whole-mount X-gal staining of a RARECreERT2; R26L embryo pulsed at E8.5 and sacrificed at E10.5 reveals minor labeling of segments of the forebrain (Fo), heart (He) and somites (So) (n = 3 embryos analyzed). (C) GFP IF on a sagittal section of a RARECreERT2; mTmG embryo pulsed at E8.5 and analyzed at E11.5. Recombination is detected in the forebrain, heart, and a subset of somites (n = 3 embryos analyzed). (D) Light sheet microscopy (maximal projection) of a GFP immunostained RARECreERT2; mTmG embryo pulsed at E10.5 and analyzed at E12.5 (Scale bar 1000 µm) (n = 1 embryo analyzed).
Figure 2 with 1 supplement
Cardiomyocytes are highly responsive to RA signaling during embryonic development.
(A) Whole-mount X-gal staining of RARECreERT2 embryos pulsed with tamoxifen at E6.5 and sacrificed at E9.5 reveals strong labeling of venous pole derivatives of the heart (outflow tract (OFT) and atria (AT)). Minimal labeling is detected in the right ventricle (RV) and left ventricle (LV) of hearts (n = 2 embryos analyzed). (B) Whole-mount X-gal staining of embryos pulsed with tamoxifen at E10.5 and sacrificed at E13.5 reveals strong ventral (v) and dorsal (d) labeling of the heart ventricles with minimal labeling of the atria and outflow tract (n = 2 embryos analyzed). (C) Administration of tamoxifen (TAM) at E9.5 to RARECreERT2; mTmG embryos followed by analysis at E11.5 reveals specific labeling of the epicardium (GFP+WT1+ cells) and myocardium (GFP+MF20+ cells) in developing hearts (n = 3 embryos analyzed). (D) Tamoxifen administration at E10.5 followed by analysis at E13.5 reveals strong labeling of the compact myocardium (C) and minor labeling of the trabecular layer (T) in developing hearts. Minimal labeling of the epicardium (WT1+ cells, inset) is detected at this time-point. Insets shown are from right ventricle of representative heart (n = 3 embryos analyzed). (E) Exogenous supplementation of all-trans Retinoic acid (RA) (10 mg/kg) to pregnant dams 4 hr prior to tamoxifen induction leads to increased labeling of the trabecular myocardium and epicardium (WT1+ cells, inset) in developing hearts at E13.5 when compared to non-RA-treated embryos in (D) (n = 3 embryos analyzed). (F) Supplementation of the RAR reverse agonist BMS493 (5 mg/kg) to pregnant dams 4 hr before and 4 hr after tamoxifen induction (extra two doses given in 8 hour interval 1 day after TAM induction) drastically reduces the number of GFP+ cells in RARECreERT2 hearts (n = 3 embryos analyzed). (G) Schematic illustrating strategy for isolating primary cardiomyocytes (CMs) from hearts of E18.5 RARECreERT2; mTmG embryos followed by 48 hr treatment with 1 µM RA. (H) RARECreERT2; mTmG primary cardiomyocytes respond directly to RA treatment as demonstrated by co-IF for GFP and Troponin T. No GFP staining is detected in DMSO-treated control (CTL) cells. (I) Dose-response relationship of primary cardiomyocytes to RA. Cells were isolated form neonatal RARECreERT2; mTmG hearts using the neonatal cardiomyocyte isolation kit (Miltenyi) and treated for 48 hr with varying doses of RA. Each data point represents the percentage of GFP+ cells from a single well. Columns are means ± SEM (at least nine technical replicates per treatment). See also Figure 2—source data 1. Data information: WT1 = Wilms’ tumour protein, TRO = Troponin T, MF20 = Myosin heavy chain. Scale bars mosaics: 100 µM, Close ups: 40 µM. See also Figure 2—figure supplement 1.
-
Figure 2—source data 1
Numerical source data for Figure 2I.
- https://cdn.elifesciences.org/articles/68280/elife-68280-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
The RARECreERT2 line is active in the venous pole of the heart during early stages of development and in the myocardium during later stages, and myocardial labeling during mid-gestation is detected with the RARECreERT2 line B.
(A) X-gal and Eosin staining on sections of a RARECreERT2; R26L heart pulsed at E6.5 and sacrificed at E9.5 (from wholemount stainings in Figure 1). (B) X-gal and Eosin staining on sections of a RARECreERT2; R26L heart pulsed at E10.5 and sacrificed at E13.5 (from wholemount stainings in Figure 1). (C) qPCR analysis of primary cardiomyocytes isolated from E18.5 RARECreERT2; mTmG hearts and treated with 1 µM RA reveals upregulation of RA transcriptional targets (Rarb, Rbp1, Cyp2a1). Data are expressed as fold change vs. controls and columns are means ± SEM (n = 3 technical replicates). (D) Forty-eight hours treatment with increasing doses of RA on primary cardiomyocytes isolated from E18.5 RARECreERT2; mTmG hearts followed by Tomato (not activated RA) and GFP (activated by RA) analysis. Higher doses of RA lead to increased numbers of GFP+ cells. GFP+ cells can be detected with very low doses of RA (0.1 nM) (white arrow). Cardiomyocytes were isolated using the neonatal cardiomyocyte isolation kit (Miltenyi). (E) Administration of tamoxifen at E10.5 to embryos from a second RARECreERT2 line (line B) crossed with the mTmG line demonstrates a strong GFP response in the compact myocardium when analyzed at E14.5 (n = 3 embryos analyzed). Scale bars mosaic: 100 µM, close up 40 µm. Data information: AVC = atrioventricular canal, OFT = outflow tract, My = myocardium, Ep = epicardium, TOM = Tomato, TRO = Troponin T. p = 0.0047 (C, Rarb), p = 0.034 (C, Rbp1), p = 0.032 (C, Cyp26a1).
Figure 3
Cardiomyocyte-specific RA signaling is active during late stages of heart development.
(A) Administration of tamoxifen (TAM) to RARECreERT2; mTmG embryos at E14.5 followed by analysis at E18.5 reveals cardiomyocyte-specific (MF20+) labeling in developing hearts. Cardiomyocytes located deep within the ventricular wall are also labeled (white arrows). (B) Tamoxifen administration at E15.5 labels cardiomyocytes deep within the ventricular wall (white arrows) when analyzed only 2 days later at E17.5. (C) IF analysis reveals ALDH1A2 protein is restricted to the epicardium of the developing heart at E12.5. At E14.5 ALDH1A2 protein is detected within the ventricular wall (white arrow). High ALDH1A2 protein levels are detected in the ventricular wall at E16.5 and E18.5 (at least three embryos analyzed per time-point). (D) Co-IF with Vimentin (VIM) and PECAM (PEC) antibodies reveals ALDH1A2 (ALD2) is produced by cardiac fibroblasts/connective tissue (VIM+) and not by endothelial cells (VIM+PEC+, white arrowheads) in the developing heart. Images taken from representative region of interventricular septum. (E) Administration of tamoxifen to embryos carrying the WT1CreERT2 (epicardial-specific CreERT2 line) and mTmG alleles followed by analysis at E16.5 reveals many of the ALDH1A2+ cells within the ventricular wall of the developing heart are derived from the epicardium (GFP+). (F) Scheme illustrating pattern of ALDH1A2 production and RA activity in the myocardium during mid-late stages of cardiac development. Image created with Biorender software. Epi = epicardium, My = myocardium, End = endocardium. Data information: Scale bars mosaics: 100 µM, Close ups: 40 µM. For all experiments at least three hearts were analyzed and representative hearts shown.
Figure 4
The RARECreERT2 line labels several cell-types, including cardiomyocytes, in adult hearts subjected to myocardial infarction.
(A) Schematic illustrating the lineage tracing experiments performed in RARECreERT2; mTmG mice subjected to myocardial infarction (MI). Tamoxifen was administered twice (30 min and 48 hr after surgery) and hearts were analyzed 6 days post MI. (B) IF on infarct and sham hearts from RARECreERT2 mice reveals ALDH1A2 and GFP are highly enriched in and around the infarct zone (IZ) (marked by Sirius Red staining, dotted black line) while minimal ALDH1A2 and GFP staining is detected in sham hearts. BZ = border zone of injury. (C) qPCR analysis on RNA extracted from infarct and sham hearts reveals Aldh1a1,2 and 3 and Rbp1 are upregulated after MI. The RA targets Rarb and Cyp26a1 are not significantly altered. Data are expressed as fold change vs controls and columns are means ± SEM (n = 4 hearts). (D) Co-IF for ALDH1A2 and GFP demonstrates minimal co-staining in RARECreERT2 MI hearts. (E) Co-IF for GFP plus αSMA, PECAM1 or Troponin T demonstrates an RA response in activated fibroblasts/smooth muscle cells, coronary vessels, and cardiomyocytes respectively in RARECreERT2 MI hearts. (F) Closer analysis of RARECreERT2 infarct hearts reveals ALDH1A2 protein localization to the infarct zone and border zone. GFP+ cells also localize to both regions, and many of the GFP cells in the border zone are cardiomyocytes as demonstrated by co-IF for Troponin T (white arrows). Data information: TRO = Troponin T, SMA = smooth muscle actin, PEC = PECAM1. All statistics two tailed t-test assuming unequal variance, *p < 0.05, **p < 0.01, ns = not significant. Scale bars: mosaics 100 µM, close ups 40 µM. p = 0.017 (C, Aldh1a1), p = 0.042 (C, Aldh1a2), p = 0.048 (C, Aldh1a3), p = 0.0033 (C, Rbp1), p = 0.11 (C, Cyp26a1).
Figure 5 with 3 supplements
Depletion of RA signaling leads to larger infarct zones and increased apoptosis.
(A) Schematic illustrating strategy used to delete floxed alleles of the Aldh1a1,2,3 (Ald1,2,3) enzymes with the CAGGCreER line (mutant mice referred to as RAKOs). Five daily doses of tamoxifen were administered 1 week prior to surgery and operated hearts were analyzed 6 days post MI. (B) IF analysis reveals a significant decrease of ALDH1A2 protein in RAKOs when compared to CAGGCreER negative (control (CTL)) hearts. (C) qPCR analysis of RNA extracted from infarct hearts reveals significant decreases in Aldh1a1 and Aldh1a2 expression in RAKOs when compared to controls. Aldh1a3 expression is also reduced, though not significantly. Data are expressed as fold change vs. controls and columns are means ± SEM (n = 3 hearts). (D) Sirius red detection of collagen deposition demonstrates increased infarct size in RAKO hearts when compared to controls. See Figure 5—figure supplement 2A for representative images of all hearts analyzed. (E) Quantification of infarct size in RAKO and control hearts. The infarct areas were measured with ImageJ software and were normalized to the total area of the left ventricle. Columns are means ± SEM (n = 10 hearts). See also Figure 5—source data 1. (F) Active caspase three and TUNEL stainings reveal increased apoptosis in RAKO hearts when compared to controls. RAKO hearts have visible ‘patches’ of apoptotic cells (lower middle panel; white outline in lower right panel (magnified in inset)). (G) Quantification of TUNEL+ cells in RAKO and control infarct hearts using ImageJ software. Columns are means ± SEM (n = 6 hearts). See also Figure 5—source data 2. Data information: CASP3 = active caspase 3, TUN = TUNEL, IZ = infarct zone. All statistics two tailed t-test assuming unequal variance, *p < 0.05, ns = not significant. Scale bars: mosaics 100 µM, close ups 40 µM. p = 0.011 (C, Aldh1a1), p = 0.026 (C, Aldh1a2), p = 0.26 (C, Aldh1a3), p = 0.028 (E, RAKO), p = 0.010 (G, RAKO). See also Figure 5—figure supplements 1–3.
-
Figure 5—source data 1
Numerical source data for Figure 5E.
- https://cdn.elifesciences.org/articles/68280/elife-68280-fig5-data1-v2.xlsx
-
Figure 5—source data 2
Numerical source data for Figure 5G.
- https://cdn.elifesciences.org/articles/68280/elife-68280-fig5-data2-v2.xlsx
Figure 5—figure supplement 1
The CAGGCreER line is highly active in adult hearts but leads to incomplete excision of Aldh1a floxed alleles during MI, and Aldh1a2 is efficiently deleted during late cardiac development.
(A) Schematic of strategy to generate Aldh1a1,2,3 mutant E18.5 (RAKO) embryos during late cardiac development by tamoxifen injections at E13.5 and E14.5 followed by analysis at E18.5. (B) IF for ALDH1A2 reveals a dramatic reduction in ALDH1A2 immunoreactivity in RAKO E18.5 hearts when compared to controls. Very few cells are ALDH1A2+ (white arrow) in RAKO hearts. Representative images are from left ventricles (n = 3 hearts analyzed). (C) qPCR analysis of RNA from E18.5 hearts reveals a drastic reduction of Aldh1a2 expression in RAKO hearts when compared to controls. Data are expressed as fold change vs. controls and columns are means ± SEM (n = 6 embryos, 2 litters). Two tailed t-test assuming unequal variance, ***p < 0.001. p = 0.00030. (D–E) PCR analysis of genomic heart DNA from RAKO adults subjected to MI reveals excision of floxed Aldh1a2 (D) and Aldh1a3 (E) alleles (red arrowheads). Amplification of the non-excised alleles (green arrowheads) still occurs indicating incomplete recombination in RAKO hearts. (F) Schematic illustrating strategy used to test the recombination efficiency of the CAGGCreER line with the mTmG reporter allele. Tamoxifen was administered five times to CAGGCreER; mTmG adult males and hearts were analyzed 13 days after the final injection. Grey arrowheads represent loxP sites. (G) GFP IF on CAGGCreER; mTmG hearts reveals very efficient recombination in nearly all cell types. Two representative CAGGCreER; mTmG hearts shown.
Figure 5—figure supplement 2
Increased infarct zones in RAKO hearts subjected to myocardial infarction.
(A) Sirius red staining of various MI hearts reveals consistently larger infarct sizes (depicted by black dashed lines) in RAKO hearts when compared to control (CTL) (Aldh1a1/a2/a3fl CAGGCreER-negative mice) hearts. For each heart representative image from largest portion of infarct shown. (B) RAKO sham hearts do not display adverse remodeling defects or apoptosis as shown by sirius red staining (left) and active caspase 3 (CASP3) IF (right) (n = 3 hearts analyzed). (C) Co-IF for active caspase three and MF20 reveals that the apoptotic patches observed in RAKO mice after MI are cardiomyocytes. (D) Table showing that RAKO MI hearts exhibit a higher incidence of early death (prior to analysis at 6 days post MI) and more ‘apoptotic patches’.
Figure 5—figure supplement 3
MAP kinase signaling is not significantly altered in RAKO infarcted hearts.
(A) IF for phospho-ERK1/2 (pERK) reveals no major differences in RAKO MI hearts when compared to controls (CTL). (B) Quantification of pERK levels reveals no significant differences between RAKO and control hearts. Phospho-ERK pixel area was measured using ImageJ software and was normalized to total infarct area (estimated by DAPI staining). Columns are means ± SEM (n = 3 hearts). See also Figure 5—figure supplement 3—source data 1. (C) qPCR analysis of primary cardiomyocytes treated with RA (1 µM) for 48 hr demonstrates no significant difference in Adam10 expression. Data are expressed as fold change vs controls and columns are means ± SEM (n = 3 technical replicates). (D) qPCR analysis of primary cardiomyocytes treated with the RAR reverse agonist BMS493 (1 µM) for 48 hr demonstrates no significant difference in Adam10 expression. Data are expressed as fold change vs controls and columns are means ± SEM (n = 3). Data information: For all statistics, two tailed t-test assuming unequal variance, ns = not significant. p = 0.99 (B, RAKO), p = 0.84 (C, RA), p = 0.48 (D, BMS).
-
Figure 5—figure supplement 3—source data 1
Numerical source data for Figure 5—figure supplement 3B.
- https://cdn.elifesciences.org/articles/68280/elife-68280-fig5-figsupp3-data1-v2.xlsx
Figure 6 with 2 supplements
RA treatment in embryonic cardiomyocytes promotes a notable transcriptional response and regulates genes involved in cardiac repair such as Tgm2 and Ace1.
(A) Schematic illustrating the strategy used to isolate primary cardiomyocytes from E18.5 hearts. Cultured cardiomyocytes were treated for 48 hr with 100 nM RA. RNA was extracted, libraries were prepared with oligo (dT) primers and single end sequencing was performed on RA-treated and DMSO-treated cells (n = 4 biological replicates). (B) Volcano plot analysis of RNA sequencing results performed with Graphpad software. Dotted line represents significance threshold equivalent to p < 0.05. Several canonical RA targets (Rarb; Cyp26a1; Cyp26b1; red) are significantly upregulated. Genes involved in cardiac repair such as Transglutaminase 2 (Tgm2) (red) and Angiotensin converting enzyme 1 (Ace1) (blue) are also significantly altered. DESeq analysis of genome aligned reads was performed using proprietary Genomatix software. Only the top 500 genes were included in the volcano plot analysis. Blue dots represent downregulated genes. (C) Gene ontology (GO) analysis of biological processes using Gorilla software. Only the top 500 genes were included in the GO analysis. (D) qPCR analysis confirms upregulation of Tgm2 and repression of Ace1 mRNA levels in primary cardiomyoctes treated with 1 µM RA for 48 hr (n = 3 technical replicates). (E) Acute nine hour 1 µM RA treatment in primary cardiomyocytes promotes Tgm2 upregulation and Ace1 repression as shown by qPCR analysis (n = 3 technical replicates). (F) Treatment of primary cardiomyocytes with the RAR signaling reverse agonist BMS493 (1 µM) for 48 hr reveals a decrease in Tgm2 expression and an increase in Ace1 expression levels as shown by qPCR analysis (n = 5, experiment performed once in triplicate and once in duplicate). (G) Removal of endothelial cells (endo) with CD31-magnetic beads followed by 48 hr 1 µM RA treatment on purified primary cardiomyocytes reveals significant repression of Ace1 expression as shown by qPCR analysis (n = 3 technical replicates). Data information: For all graphs data are expressed as fold change vs. controls and columns are means ± SEM. Tgm2 = Transglutaminase 2, Ace = angiotensin converting enzyme. All statistics two tailed t-test assuming unequal variance, *p < 0.05, **p < 0.01. p = 0.0046 (D, Rarb), p = 0.0025 (D, Tgm2), p = 0.011 (D, Ace), p = 0.0093 (E, Rarb), p = 0.0093 (E, Tgm2), p = 0.043 (E, Ace), p = 0.0041 (F, Rarb), p = 0.015 (F, Tgm2), p = 0.0020 (F, Ace), p = 0.0012 (G, Rarb), p = 0.0091 (G, Ace). See also Figure 6—figure supplements 1–2.
Figure 6—figure supplement 1
Gene ontology analysis of RNA sequencing data.
Gene ontology analysis of biological processes altered in RA-treated primary cardiomyocytes using RNA sequencing data from top 500 deregulated genes. Analysis performed with Gorilla software (http://cbl-gorilla.cs.technion.ac.il/).
Figure 6—figure supplement 2
Tgm2 and Ace1 are indirect RA targets in cultured cardiomyocytes.
(A) Schematic showing strategy to remove endothelial cells from primary cardiomyocyte cultures using CD31-magnetic beads. MACS = magnetic activated cell sorting. (B) qPCR analysis of cell isolation from (A) reveals purified cardiomyocytes (CM) express very low levels of endothelial (Endo) markers (Pecam, Flk1) and high levels of Troponin T (TropT) (n = 3). Data are expressed as fold change vs controls and columns are means ± SEM. For statistics, two tailed t-test assuming unequal variance. (C) qPCR analysis reveals upregulation of Tgm2 and Ace1 in RARECreERT2 MI hearts when compared to sham controls. Data are expressed as fold change vs controls and columns are means ± SEM. For statistics, two tailed t-test assuming unequal variance was used. (D) qPCR analysis of E18.5 cardiomyocytes treated with RA for 3 hr with or without the protein synthesis inhibitor cycloheximide (CHX) reveals no significant changes in Ace1 and Tgm2 expression. Rarb expression is significantly upregulated after 3 hr RA treatment both with and without CHX. For statistics, two-way analysis of variance (ANOVA) performed. Data information: *p < 0.05, **p < 0.01, ***p < 0.001, ns = not significant. p = 0.0031 (B, Pecam), p = 0.0017 (B, Flk1), p = 0.0069 (B, TropT), p = 0.048 (C, Tgm2), p = 0.037 (C, Ace), p = 0.048 (D, Rarb, red), p = 0.00010 (D, Rarb, gray), p = 0.14 (D, Tgm2, red), p = 0.21 (D, Tgm2, gray), p = 0.91 (D, Ace, red), p = 0.78 (D, Ace, gray).
Videos
Video 1
The RARECreERT2 line displays a high labeling efficiency in early mouse embryos.
Wholemount IF for GFP (green) and Gata binding protein 4 (Gata4)(purple) on E10.5 RARECreERT2; mTmG embryos injected with tamoxifen at E7.5.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Aldh1a1 | Mouse genome informatics | MGI: 1353450 | |
| Gene (Mus musculus) | Aldh1a2 | Mouse genome informatics | MGI: 107928 | |
| Gene (Mus musculus) | Aldh1a3 | Mouse genome informatics | MGI: 1861722 | |
| Gene (Mus musculus) | Rarb | Mouse genome informatics | MGI: 97857 | |
| Gene (Mus musculus) | Ace1 | Mouse genome informatics | MGI: 87874 | |
| Gene (Mus musculus) | Tgm2 | Mouse genome informatics | MGI: 98731 | |
| Strain, strain background (Mus musculus, male and female) | RARECreERT2 | This paper | Tg(RARE-Hspa1b-cre/ERT2)RRID:MGI:6726566 | Mixed genetic background |
| Strain, strain background (Mus musculus, male and female) | R26L | Soriano, 1999 | Gt(ROSA)26Sortm1SorRRID:MGI:1861932 | Mixed genetic background |
| Strain, strain background (Mus musculus, male and female) | mTmG | Muzumdar et al., 2007 | Gt(ROSA)26Sortm4(ACTB-tdTomato,-EGFP)LuoRRID:MGI:3716464 | Mixed genetic background |
| Strain, strain background (Mus musculus, male and female) | CAGGCreER | Hayashi and McMahon, 2002 | Tg(CAG-cre/Esr1*)5AmcRRID:MGI:2182767 | Mixed genetic background |
| Strain, strain background (Mus musculus, male and female) | Aldh1a1fl | Matt et al., 2005 | Mixed genetic background | |
| Strain, strain background (Mus musculus, male and female) | Aldh1a2fl | Vermot et al., 2006 | Mixed genetic background | |
| Strain, strain background (Mus musculus, male and female) | Aldh1a3fl | Dupé et al., 2003 | Mixed genetic background | |
| Strain, strain background (Mus musculus, male and female) | WT1CreERT2 | Zhou et al., 2008 | Wt1tm2(cre/ERT2)WtpRRID:MGI:3801682 | Mixed genetic background |
| Biological sample (Mus musculus) | Primary cardiomyocytes | This paper | N/A | Freshly isolated from E18.5 embryonic hearts |
| Antibody | Anti-GFP (chicken polyclonal) | Abcam | Cat#: AB13970RRID:AB_300798 | IF (1:400) |
| Antibody | Anti-ALDH1A2 (rabbit polyclonal) | SigmaAldrich | Cat#: ABN420 | IF (1:300) |
| Antibody | Anti-Myosin D (mouse monoclonal) | Santa Cruz | Cat#: sc32758RRID:AB_627978 | IF (1:200) |
| Antibody | Anti-MF20 (mouse monoclonal) | DSHB | Cat#: AB_2147781RRID:AB_2147781 | IF (1:20) |
| Antibody | Anti-αSMA (mouse monoclonal) | Santa Cruz | Cat#: sc53015RRID:AB_628683 | IF (1:1000) |
| Antibody | Anti-WT1 (mouse monoclonal) | Agilent | Cat#: M3561RRID:AB_2304486 | IF (1:100) |
| Antibody | Anti-Vimentin (chicken polyclonal) | Abcam | Cat#: AB24525RRID:AB_778824 | IF (1:1000) |
| Antibody | Anti-active caspase 3 (rabbit polyclonal) | R & D | Cat#: AF835RRID:AB_2243952 | IF (1:1000) |
| Antibody | Anti-active caspase 3 (rabbit polyclonal) | R & D | Cat#: AF835RRID:AB_2243952 | IF (1:200) |
| Antibody | Anti-phospho-ERK (rabbit monoclonal) | Cell signalling technology | Cat#: 4370 SRRID:AB_2315112 | F (1:400) |
| Antibody | Anti-Troponin T (mouse monoclonal) | Invitrogen | Cat#: MA5-12960RRID:AB_11000742 | IF (1:300) |
| Antibody | Anti-GATA4 (goat polyclonal) | Santa Cruz | Cat#: sc1237RRID:AB_2108747 | IF (1:500) |
| Antibody | Anti-PECAM-1 (goat polyclonal) | Santa Cruz | Cat#: sc1506RRID:AB_2161037 | IF (1:200) |
| Antibody | Anti-SM22a (rabbit polyclonal) | Abcam | Cat#: AB14106RRID:AB_443021 | IF (1:400) |
| Antibody | Anti-ALDH1A3 (rabbit polyclonal) | SigmaAldrich | Cat#: HPA046271RRID:AB_10965992 | IF (1:200) |
| Antibody | Anti-ALDH1A1 (rabbit monoclonal) | Abcam | Cat#: ab52492,RRID:AB_867566 | IF (1:200) |
| Antibody | Anti-Mouse IgG Cy3(donkey polyclonal) | Jackson immunoreseach | Cat#: 715-165-150;RRID:AB_2340813 | IF (1:400) |
| Antibody | Anti-Mouse IgG, Alexa Fluor 647 (donkey polyclonal) | Jackson immunoreseach | Cat#: 715-605-151;RRID:AB_2340863 | IF (1:400) |
| Antibody | Anti-Mouse IgG, Alexa Fluor 488(donkey polyclonal) | Jackson immunoreseach | Cat#: 715-545-150;RRID:AB_2340846 | IF (1:400) |
| Antibody | Anti-Rabbit IgG Cy3(donkey polyclonal) | Jackson immunoreseach | Cat#: 711-165-152;RRID:AB_2307443 | IF (1:400) |
| Antibody | Anti-Rabbit IgG, Alexa Fluor 647(donkey polyclonal) | Jackson immunoreseach | Cat#: 711-605-152;RRID:AB_2492288 | IF (1:400) |
| Antibody | Anti-Goat IgG, Alexa Fluor 647(donkey polyclonal) | Jackson immunoreseach | Cat#: 705-605-147;RRID:AB_2340437 | IF (1:400) |
| Antibody | Anti-Chicken IgG, Alexa Fluor 488(donkey polyclonal) | Jackson immunoreseach | Cat#: 703-545-155;RRID:AB_2340375 | IF (1:400) |
| Sequence-based reagent | Rarb_F | This paper | qPCR primer | GTCAGCGCTGGAATTCGT |
| Sequence-based reagent | Rarb_R | This paper | qPCR primer | CACCGGCATACTGCTCAA |
| Sequence-based reagent | Rbp1_F | This paper | qPCR primer | TCTCCCTTCTGCACACACTG |
| Sequence-based reagent | Rbp1_R | This paper | qPCR primer | GCCATTGGCCTTCACACT |
| Sequence-based reagent | Cyp26a1_F | This paper | qPCR primer | GGAGCTCTGTTGACGATTGTT |
| Sequence-based reagent | Cyp26a1_R | This paper | qPCR primer | CCGGCTTCAGGCTACAGA |
| Sequence-based reagent | Raldh1_F | This paper | qPCR primer | CATCTTGAATCCACCGAAGG |
| Sequence-based reagent | Raldh1_R | This paper | qPCR primer | GCCATCACTGTGTCATCTGC |
| Sequence-based reagent | Raldh2_F | This paper | qPCR primer | GGCAGGATATTGACGACTCC |
| Sequence-based reagent | Raldh2_R | This paper | qPCR primer | TGAGCAGACACCGCTCAGT |
| Sequence-based reagent | Raldh3_F | This paper | qPCR primer | AGTCGGTGCTATTCGCTCTC |
| Sequence-based reagent | Raldh3_R | This paper | qPCR primer | TGAGGATTGCCAAAGAGGA |
| Sequence-based reagent | Cyp26b1_F | This paper | qPCR primer | CACTTTGCCCAGGAGGAAT |
| Sequence-based reagent | Cyp26b1_R | This paper | qPCR primer | CAGAAGGAAGTCTGGGCTTG |
| Sequence-based reagent | Ace1_F | This paper | qPCR primer | TGCAGCTCCTGGTACAGTTTT |
| Sequence-based reagent | Ace1_R | This paper | qPCR primer | AAGATTGCCAAGCTCAATGG |
| Sequence-based reagent | Adam10_F | This paper | qPCR primer | CTCAGGACCACTACTAGCAGCA |
| Sequence-based reagent | Adam10_R | This paper | qPCR primer | CCGTTTTTGAAAGGATGAGG |
| Sequence-based reagent | Tgm2_F | This paper | qPCR primer | GGTTTTGCTTGGGTTCTCC |
| Sequence-based reagent | Tgm2_R | This paper | qPCR primer | ACCTGCTGGCTGAGAGAGAT |
| Commercial assay or kit | In situ cell death detection kit, TMR red | Roche | Cat#: 12156792910 | |
| Commercial assay or kit | Neonatal cardiomyocyte isolation kit, mouse | Miltenyi | Cat#: 130-100-825 | |
| Commercial assay or kit | Nucleospin RNA, Mini kit for RNA purification | Machery Nagel | Cat#: 740955.250 | |
| Chemical compound, drug | Tamoxifen | Sigma Aldrich | Cat#: T5648 | |
| Chemical compound, drug | 4-Hydroxytamoxifen | Sigma Aldrich | Cat#: H6728 | |
| Chemical compound, drug | Corn oil | Sigma Aldrich | Cat#: C8267 | |
| Chemical compound, drug | BMS493 | TOCRIS | Cat#: 3509 | |
| Chemical compound, drug | Retinoic acid | Sigma Aldrich | Cat#: R2625 | |
| Chemical compound, drug | Antigen Unmasking Solution, Citrate-Based | Vector laboratories | Cat#: H-3300–250 | |
| Chemical compound, drug | Direct red 80 | Sigma Aldrich | Cat#: 365,548 | |
| Chemical compound, drug | Picric acid solution | VWR International | Cat#: 87897.18 | |
| Chemical compound, drug | Trypsin from porcine pancreas | Sigma Aldrich | Cat#: T4799 | |
| Chemical compound, drug | TRIzol | Invitrogen | Cat#: 15596026 | |
| Chemical compound, drug | LightCycler 480 SYBR Green I Master | Roche | Cat#: 04707516001 | |
| Chemical compound, drug | Buprenorphrine | Axience | Cat#: 03760087151244 | |
| Chemical compound, drug | Isofluorane | Med'Vet | Cat#:0890402663435 | |
| Chemical compound, drug | Gelatin | VWR | Cat#: 24350.262 | |
| Chemical compound, drug | Thimerosal | SigmaAldrich | Cat#: T8784 | |
| Chemical compound, drug | Low melting agarose | Invitrogen | Cat#: 16520050 | |
| Software, algorithm | Fiji (ImageJ) | https://fiji.sc/ | RRID:SCR_002285 | |
| Software, algorithm | GraphPad | Prism | RRID:SCR_002798 | |
| Software, algorithm | Adobe Photoshop | Photoshop | RRID:SCR_014199 | |
| Software, algorithm | LightCycler 480 software | Roche | RRID:SCR_012155 |
Additional files
-
Supplementary file 1
Complete list of genes from RNA sequencing analysis on primary cardiomyocytes treated with RA.
RNA sequencing data has been uploaded to the public functional genomics data repository gene expression omnibus (GSE161429).
- https://cdn.elifesciences.org/articles/68280/elife-68280-supp1-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/68280/elife-68280-transrepform1-v2.docx
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Retinoic acid signaling is directly activated in cardiomyocytes and protects mouse hearts from apoptosis after myocardial infarction
eLife 10:e68280.
https://doi.org/10.7554/eLife.68280
