(A) HSF1 level and (B) heat shock response assessed by western blot in unmodified cells (WT) and in cells obtained using DNA-free CRISPR/Cas9 system: HSF1+ (six clones with the normal HSF1 level …
(A) Western blot analysis of HSF1 level in unmodified cells (WT), variants stably transduced with nonspecific shRNA (SCR) or with three different HSF1-specific shRNAs (shHSF1), and combination of …
(A) Western blot analysis of HSF1 level in T47D cell variants: unmodified (WT), a combination of five control (HSF1+) and five HSF1-negative (HSF1−) clones arisen from single cells following …
(A) Overlap of genes stimulated or repressed after the E2 treatment (RNA-seq analyses) in HSF1+ and HSF1− cells (model created as described in Figure 1). The bottom panel compares the degree of …
(A) Overlap of differentially expressed genes and (B, C) heatmaps with hierarchical clustering of normalized read counts from RNA-seq (row z-score) for genes stimulated or repressed after the E2 …
(A) Gene set enrichment analysis showing significant (false discovery rate [FDR] ≤ 0.001) terms from the Hallmark, Reactome, BioCarta, and KEGG gene sets collection detected in E2-stimulated HSF1+ …
(A) Number of peaks and peak size distribution (number of tags per peak), (B) heatmap visualization of ERα ChIP-seq data (versus input), and (C) binding enrichment (fold enrichment E2 versus Ctr) …
The CentriMo plots show the distribution of the given motifs in peaks from untreated (Ctr) and estrogen (E2)-treated (10 nM for 30 min) MCF7 cell variants. JASPAR motif names, IDs, and the p-value …
(A) Interactions between ERα and HSP90 assessed by Proximity Ligation Assay (PLA; red spots) in HSF1-positive (HSF1+) and HSF1-negative (HSF1−) MCF7 cells created using DNA-free CRISPR/Cas9 system. …
(A) Overlapped HSF1 and ERα ChIP-seq peaks in untreated wild-type MCF7 cells – peak size distribution (number of tags per peak). (B) The number of overlapped ERα and HSF1 peaks identified after E2 …
(A) HSF1 binding in ERα anchoring region. (B) HSF1 binding unrelated to ERα anchoring. Peaks identified by MACS in ChIP-seq analyses in wild-type MCF7 cells after E2 treatment (10 nM, 60 min) and …
(A) HSF1 and ERα localization assessed by immunofluorescence in wild-type MCF7 cells. DNA was stained with DAPI. Scale bar, 20 μm. (B) Interactions between ERα (mouse Ab) and HSF1 (rabbit Ab) …
(A) A workflow of the search for possible ERα and HSF1-binding patterns based on the presence (+) and absence (−) of estrogen-response element (ERE) and heat shock element (HSE) motifs within the …
(A) Correlation of HSF1 and ESR1 transcript level in all TCGA breast cancers. Each dot represents one cancer case; log(CPM), log2-counts per million. (B) Cases with markedly different mRNA levels of …
(A) All TCGA breast cancer cases. In the combined analysis, patients were split into high HSF1 and low HSF1 groups by the median value of HSF1 expression. (B) Cases with the most divergent ESR1 or HS…
(C) The proportion of metastatic (red) to nonmetastatic (green) cases (and their number) in ER-positive and ER-negative groups with different levels of HSF1 expression (deciles).
(A) Boxplots of fold changes (log fold change [logFC] absolute values) illustrating differences in gene expression between groups characterized in Figure 6; represented are the median, upper/lower …
(A) Without gene labels (the same scale is kept). (B) With gene labels. The points in the plots represent genes with statistically significant increased expression in the first group (red) or in the …
Blue, downregulated genes; red, upregulated genes. Terms related to estrogen response are marked with the green rectangle.
(A) Growth of HSF1+ and HSF1− MCF7 and T47D cells (assessed using crystal violet staining). Cells were treated with DMSO (Ctr), 4-OHT (100 nM), Palbo (1 µM in MCF7 cells, 10 µM in T47D cells), and …
Both ERα and HSF1 are kept in an inactive state by the complexes of HSP90, p23, and immunophilins (I). The binding of E2 to ERα is connected with the release of the chaperone complex and activation …
Cells were seeded on plates and the next day the medium was replaced into a phenol-free medium supplemented with 10% dextranactivated charcoal-stripped FBS. 48 hours later cells were collected (A) …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Cell line (Homo sapiens) | MCF7 | American Type Culture Collection | Cat#:HTB-22; RRID:VCL_0031 | |
Cell line (H. sapiens) | T47D | European Collection of Authenticated Cell Cultures | Cat#:85102201; RRID:CVCL_0553 | |
Transfected construct (human) | Edit-R Human HSF1 crRNAs | Dharmacon, Horizon Discovery Group Company | Cat#:CM-012109-02-0002 | Transfected construct (human)5′GGTGTCCGGGTCGCTCACGA |
Transfected construct (human) | Edit-R Human HSF1 crRNAs | Dharmacon, Horizon Discovery Group Company | Cat#:CM-012109-05-0002 | Transfected construct (human)AAAGTGGTCCACATCGAGCA |
Transfected construct (human) | Edit-R Human HSF1 crRNAs | Dharmacon, Horizon Discovery Group Company | Cat#:CM-012109-03-0002 | Transfected construct (human)GTGGTCCACATCGAGCAGGG |
Transfected construct (human) | Edit-R tracrRNA | Dharmacon, Horizon Discovery Group Company | Cat#:U-002005 | Transfected construct |
Antibody | Anti-HSF1 (rabbit polyclonal) | Enzo, Life Sciences, Famingdale, NY | Cat#:ADI-SPA-901; RRID:AB_1083465 | WB (1:4000),IF (1:300)PLA (1:300)ChIP (4 μg/sample) |
Antibody | Anti-HSF1 (E-4) (mouse monoclonal) | Santa Cruz Biotechnology, Inc, Inc, Dallas, TX | Cat#:sc-17757; RRID:AB_627753 | PLA (1:200) |
Antibody | Anti-ERα (estrogen receptor α) (D8H8) (rabbit monoclonal) | Cell Signaling Technology, Danvers, MA | Cat#:8644; RRID:AB_2617128 | WB (1:1000)PLA (1:200) |
Antibody | Anti-ERα (mouse monoclonal) ERalpha | Diagenode, Liège, Belgium | Cat#:C15100066; RRID:AB_2716575 | PLA (1:200)ChIP (4 μg/sample)IF (1:200) |
Antibody | Anti-phosphoERα (S118) (16J4) (mouse monoclonal) | Cell Signaling Technology, Danvers, MA | Cat#:2511; RRID:AB_331289 | WB (1:2000) |
Antibody | Anti-ACTB (AC-15)(HRP) (mouse monoclonal) | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:A3854; RRID:AB_262011 | WB (1:25,000) |
Antibody | Anti-HSP90 (rabbit polyclonal) | Enzo, Life Sciences, USA Famingdale, NY | Cat#:ADI-SPA-836; RRID:AB_10615944 | WB (1:2000)PLA (1:200)IF (1:200) |
Antibody | Anti-HSP70 (HSPA1) (mouse monoclonal) | Enzo, Life Sciences, Famingdale, NY | Cat#:ADI-SPA-810; RRID:AB_10616513 | WB (1:2000) |
Antibody | Anti-HSP105 (rabbit polyclonal) | BioVision, Milpitas, CA | Cat#:3390-100; RRID:AB_2264190 | WB (1:600) |
Antibody | Anti-HSPB8/HSP22 (rabbit polyclonal) | Cell Signaling Technology, Danvers, MA | Cat#:3059; RRID:AB_2248643 | WB (1:1000) |
Antibody | Anti-TDAG51 (PHLDA1) (RN-E62) (mouse monoclonal) | Santa Cruz Biotechnology, Inc, Inc, Dallas, TX | Cat#:sc-23866; RRID:AB_628117 | WB (1:1000) |
Antibody | Anti-EGR3 (A-7) (mouse monoclonal) | Santa Cruz Biotechnology, Inc, Inc, Dallas, TX | Cat#:sc-390967; RRID:AB_2894831 | WB (1:1000) |
Antibody | Anti-HSC70 (HSPA8) (B-6) (mouse monoclonal) | Santa Cruz Biotechnology, Inc, Inc, Dallas, TX | Cat#:sc-7298; RRID:AB_627761 | WB (1:5000) |
Antibody | Anti-mouse IgG (HRP) | Millipore, Billerica, MA | Cat#:AP124P; RRID:AB_90456 | WB (1:5000) |
Antibody | Anti-rabbit IgG (HRP) | Millipore, Billerica, MA | Cat#:AP132P; RRID:AB_90264 | WB (1:2000) |
Antibody | Anti-rabbit IgG (Alexa Fluor 488) | Abcam, Cambridge, Great Britain | Cat#:ab150077; RRID:AB_2630356 | IF (1:200) |
Antibody | Anti-mouse IgG (Alexa Fluor 594) | Abcam, Cambridge, Great Britain | Cat#:ab150116; RRID:AB_2650601 | IF (1:200) |
Recombinant DNA reagent | pLVX-shRNA1 vector | Clontech/Takara Bio USA, Inc. | Cat#:632177 | Lentivirus construct to express a small hairpin RNA (shRNA) |
Recombinant DNA reagent | pLVX-shHSF1 | This paper | pLVX-shRNA1 vector encoding shRNA specific for HSF1 | |
Recombinant DNA reagent | Edit-R hCMV-PuroR-Cas9 Expression Plasmid | Dharmacon, Horizon Discovery Group Company | Cat#:U-005100-120 | Cas9 expression vector |
Sequence-based reagent | qPCR primers | This paper | See Supplementary files 6–8 | |
Sequence-based reagent | shRNA | This paper | See Materials and methods | |
Peptide, recombinant protein | eSpCas9-GFP protein | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:ECAS9GFPPR | |
Commercial assay or kit | Duolink In Situ Red Kit Mouse/Rabbit | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:DUO92101 | |
Commercial assay or kit | ALDEFLUOR Kit | STEMCELL Technologies | Cat#:01700 | |
Commercial assay or kit | The iDeal ChIP-seq Kit for Transcription Factors | Diagenode | Cat#:C01010055 | |
Commercial assay or kit | Direct-Zol RNA MiniPrep Kit | Zymo Research | Cat#:R2052 | |
Commercial assay or kit | μMacs Streptavidin Kit | Miltenyi Biotec, Bergisch Gladbach, Germany | Cat#:130-074-101 | |
Commercial assay or kit | CellTiter 96 AQueous One Solution Assay | Promega; Madison, WI | Cat#:G3580 | |
Commercial assay or kit | SuperSignal West Pico PLUS Chemiluminescent Substrate | Thermo Fisher Scientific, Waltham, MA | Cat#:34577 | |
Commercial assay or kit | QIAseq Ultralow Input Library Kit | Qiagen, Venlo, Netherlands | Catt#:180492 | |
Commercial assay or kit | ECM Cell Adhesion Array kit | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:ECM540 | |
Commercial assay or kit | PCR Master Mix SYBR Green | A&A Biotechnology, Gdynia, Poland | Cat#:2008-100A | |
Chemical compound, drug | 17 beta-estradiol | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:E4389 | |
Chemical compound, drug | 4-Hydroxytamoxifen | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:T176 | |
Chemical compound, drug | Palbociclib, hydrochloride salt | LC Laboratories, Woburn, MA | Cat#:P-7788 | |
Chemical compound, drug | 4-Thiouridine | Cayman Chemical, Ann Arbor, MI | Cat#:16373-100 | |
Chemical compound, drug | Puromycin | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:P8833 | |
Chemical compound, drug | Phalloidin-TRITC | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:P1951 | IF (1:800) |
Software, algorithm | Adobe Photoshop CS6 | Adobe | Version 13.0.1; RRID:SCR_014199 | |
Software, algorithm | ImageJ | NIH | RRID:SCR_003070 | |
Software, algorithm | Samtools | doi:10.1093/bioinformatics/btp352 | RRID:SCR_002105 | |
Software, algorithm | R software | R Foundation for Statistical Computing | Package v.3.6.2; RRID:SCR_001905 | |
Software, algorithm | DESeq2 | doi:10.1158/0008-5472.CAN-13-1070 | RRID:SCR_015687 | |
Software, algorithm | NOISeq | doi:10.1093/nar/gkv711 | Package v.3.12; RRID:SCR_003002 | |
Software, algorithm | FastQC software | https://www.bioinformatics.babraham.ac.uk/projects/fastqc | RRID:SCR_014583 | |
Software, algorithm | Hisat2 | doi:10.1038/nmeth.3317 | Version 2.0.5; RRID:SCR_015530 | |
Software, algorithm | FeatureCounts | doi:10.1093/bioinformatics/btt656 | Version 1.6.5; RRID:SCR_012919 | |
Software, algorithm | ChIPpeakAnno | doi:10.1186/1471-2105-11-237 | Version 3.24.2; RRID:SCR_012828 | |
Software, algorithm | deepTools2 | doi:10.1093/nar/gkw257 | Version 3.5.0; SCR_016366 | |
Software, algorithm | Bowtie2 | doi:10.1038/nmeth.1923 | Version 2.2.9; SCR_016368 | |
Software, algorithm | MEME Suite | doi:10.1093/nar/gkv416 | Version. 5.4.1; RRID:SCR_001783 | |
Software, algorithm | MACS software | doi:10.1038/nprot.2012.101 | Version 1.4.2; RRID:SCR_013291 | |
Software, algorithm | Bedtools software | doi:10.1093/bioinformatics/btq033 | RRID:SCR_006646 | |
Software, algorithm | MedCalc Statistical Software | MedCalc Software Ltd, Ostend, Belgium | Version 19.2.1; RRID:SCR_015044 | |
Software, algorithm | ChIPseeker | Bioconductor package | Version 1.26.2; RRID:SCR_021322 | |
Software, algorithm | TCGAbiolinks package | doi:10.1093/nar/gkv1507 | Version 2.14; RRID:SCR_017683 | |
Software, algorithm | edgeR package | doi:10.1093/bioinformatics/btp616 | Version 3.28.1; RRID:SCR_012802 | |
Software, algorithm | Statistica | TIBCO Software Inc | RRID:SCR_014213 | |
Software, algorithm | MSigDB | doi:10.1073/pnas.0506580102 | RRID:SCR_016863 | |
Other | Deoxyribonuclease I | Worthington Biochemical Corporation | Cat#:LS006333 | |
Other | RNAClean XP beads | Beckman Coulter Life Science, Indianapolis, IN | Cat#:A63987 | |
Other | MTSEA-biotin-XX | Biotium, Fremont, CA | Cat#:90066 | |
Other | DAPI stain | Invitrogen | Cat#:D1306 | 1 µg/ml |
Other | DharmaFECT Duo | Dharmacon, Horizon Discovery Group Company | Cat#:T-2010 | Transfection reagent |
Other | Viromer CRISPR | Lipocalyx GmbH, Halle (Saale), Germany | Cat#:VCr-01LB-01 | Transfection reagent |
Other | cOmplete Protease Inhibitor Cocktail | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:4693116001 | |
Other | PhosSTOP (phosphatase inhibitor tablets) | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:4906837001 | |
Other | Collagen I | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:804592 | |
Other | Collagen IV | Sigma-Aldrich, Merck KGaA, Darmstadt, Germany | Cat#:C55333 | |
Other | Fibronectin | Corning, NY | Cat#:354008 |
Summary table of RNA-seq results (normalized signals and expression fold changes after E2 treatment) in MCF7 cell variants with different levels of HSF1.
Summary tables of ChIP-seq results: characteristics of ERα binding in wild-type, HSF1-proficient (MIX), and HSF1-deficient (KO#2) MCF7 cells, untreated (Ctr) and after E2 stimulation.
Summary tables of ChIP-seq results: characteristics of ERα and HSF1 common binding regions in wild-type MCF7 cells, untreated (Ctr versus input) and after E2 stimulation (versus Ctr).
Lists of all HSF1 and ERα ChIP-seq peaks (E2 versus input) and ERα anchoring regions with annotation and information about the presence of ERE and HSE motifs in wild-type MCF7 cells.
Differential expression tests between selected groups of breast cancer patients with different ESR1 and HSF1 statuses based on RNA-seq data deposited in TCGA database.
RT-qPCR primers for gene expression analyses.
ChIP-qPCR primers for ESR1-binding analyses.
PCR primers for chromosome conformation capture assay.
Figures 1A, B—8, Figure 1—figure supplement 1A, Figure 1—figure supplement 2A, Figure 3—figure supplement 2B and C source data (unedited gels and blots).
The original files of the full raw unedited blots and gels and figures with the uncropped blots and gels with the relevant bands labeled.