Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection
- Department of Molecular and Cellular Biology, Baylor College of Medicine, United States
- Lester and Sue Smith Breast Center and Dan L Duncan Comprehensive Cancer Center, Baylor College of Medicine, United States
- Department of Pathology, School of Medicine, Case Western Reserve University, United States
- Center for Molecular Medicine and Genetics, Wayne State University, United States
- Department of Chemistry and Physics, La Trobe University, Australia
- Department of Molecular and Integrative Physiology, University of Michigan Medical School, United States
Figures
Figure 1 with 1 supplement
Protein quality control in β-selected thymocytes.
(A) Schematic of labeling and detection of nascent protein with OP-Puro. OP-Puro (O-propargyl puromycin) is a cell-permeable puromycin analog that is incorporated into the C-terminus of newly …
-
Figure 1—source data 1
Excel file containing numerical values shown in Figure 1.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig1-data1-v3.xlsx
Figure 1—figure supplement 1
Diagrams and representative flow cytometry gates used in this study.
(A) Diagram showing two ER quality control machineries: ERAD and UPR. The E3 ubiquitin ligase HRD1 and its adaptor protein SEL1L is the most conserved ERAD complex in mammals. While correctly folded …
Figure 2 with 2 supplements
SEL1L is required for αβ T cell development.
(A) Images of thymus from 6 to 8 week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 3. (B and C) Thymus weight (B) and thymus cellularity (C) of age and …
-
Figure 2—source data 1
Excel file containing numerical values shown in Figure 2.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig2-data1-v3.xlsx
Figure 2—figure supplement 1
UPR is dispensable for αβ T cell development.
(A) Quantitative RT-PCR analysis of Sel1l expression in murine bone marrow progenitors and different thymocyte subsets from control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) …
-
Figure 2—figure supplement 1—source data 1
Original western blot images shown in Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig2-figsupp1-data1-v3.pdf
-
Figure 2—figure supplement 1—source data 2
Excel file containing numerical values shown in Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig2-figsupp1-data2-v3.xlsx
Figure 2—figure supplement 2
SEL1L is required for DN to DP thymocyte transition following β selection.
(A) Representative flow cytometry plots of different thymocyte subsets in control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. (B) Diagram showing different stages of CD2-iCr…
-
Figure 2—figure supplement 2—source data 1
Excel file containing numerical values shown in Figure 2—figure supplement 2.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig2-figsupp2-data1-v3.xlsx
Figure 3
SEL1L is required for thymocyte survival at the β-selection checkpoint.
(A) Quantification of BrdU incorporation in different thymocyte subsets from 6-week-old control (Ctrl, Sel1lflox/flox) or Sel1l CKO mice. n = 3–4. (B and C) Cell cycle analysis of DN4 thymocytes in …
-
Figure 3—source data 1
Excel file containing numerical values shown in Figure 3.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig3-data1-v3.xlsx
Figure 4 with 1 supplement
Notch directly regulates transcription of ERAD genes.
(A) Quantification of surface NOTCH1 levels in different thymocyte subsets from wild-type mice. MFI, mean fluorescence intensity. n = four mice. (B) Quantitative RT–PCR analysis of ERAD genes (Sel1l,…
-
Figure 4—source data 1
Original western blot images shown in Figure 4.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig4-data1-v3.pdf
-
Figure 4—source data 2
Excel file containing numerical values shown in Figure 4.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig4-data2-v3.xlsx
Figure 4—figure supplement 1
Notch signal regulates ERAD genes expression.
(A) Quantitative RT-PCR analysis of Notch target genes expression in EL4 cells after stimulation with 5 μg/ml Delta ligand 4 (DLL4) for 24 hr. Data are presented relative to Actb. n = 3. (B) …
-
Figure 4—figure supplement 1—source data 1
Excel file containing numerical values shown in Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig4-figsupp1-data1-v3.xlsx
Figure 5 with 2 supplements
Sel1l-deficiency triggers unresolved ER stress during β-selection.
(A) Heatmap showing differentially expressed genes from the RNA-seq analysis of DN3 thymocytes sorted from control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 4. (B) …
-
Figure 5—source data 1
Original western blot images shown in Figure 5.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-data1-v3.pdf
-
Figure 5—source data 2
Original gels images shown in Figure 5.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-data2-v3.pdf
-
Figure 5—source data 3
Excel file containing numerical values shown in Figure 5.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-data3-v3.xlsx
Figure 5—figure supplement 1
SEL1L is not required for TCRβ gene rearrangement and pre-TCR signaling.
(A) PCR analysis of Vβ5-Jβ2, Vβ8-Jβ2, and Vβ11-Jβ2 gene rearrangements using genomic DNA of DN3 and DN4 thymocytes sorted from control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) …
-
Figure 5—figure supplement 1—source data 1
Original gels images shown in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp1-data1-v3.pdf
-
Figure 5—figure supplement 1—source data 2
Original western blot images shown in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp1-data2-v3.pdf
-
Figure 5—figure supplement 1—source data 3
Excel file containing numerical values shown in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp1-data3-v3.xlsx
Figure 5—figure supplement 2
Sel1l knockout induces ER stress.
(A) Western blot analysis of UPR pathway markers in primary DN4 thymocytes sorted from 6-week-old Ctrl or Sel1l CKO mice. β-ACTIN was used as loading control. The original western blot images are …
-
Figure 5—figure supplement 2—source data 1
Original western blot images shown in Figure 5—figure supplement 2.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp2-data1-v3.pdf
-
Figure 5—figure supplement 2—source data 2
Original gels images shown in Figure 5—figure supplement 2.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp2-data2-v3.pdf
-
Figure 5—figure supplement 2—source data 3
Excel file containing numerical values shown in Figure 5—figure supplement 2.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp2-data3-v3.xlsx
Figure 6 with 1 supplement
PERK signaling drives β-selected thymocyte apoptosis in Sel1l CKO mouse.
(A and B) Representative images of thymus (A) and quantification of total thymocytes, DP, SP4 and SP8 thymocytes (B) from age (6-week-old) and gender-matched control (Ctrl, Sel1lflox/flox), Sel1l KO …
-
Figure 6—source data 1
Excel file containing numerical values shown in Figure 6.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig6-data1-v3.xlsx
Figure 6—figure supplement 1
XBP1 functions as a compensatory adaptative mechanism in Sel1l CKO mouse.
(A) Quantification of total cellularity and DP cell numbers of 6–8 week-old gender-matched control (Ctrl, Sel1lflox/flox), Sel1l KO (Sel1lflox/flox; CD2-iCre), Xbp1 KO (Xbp1 flox/flox; CD2-iCre), …
-
Figure 6—figure supplement 1—source data 1
Excel file containing numerical values shown in Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/69975/elife-69975-fig6-figsupp1-data1-v3.xlsx
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Sel1lflox | PMID:24453213 | Dr. Ling Qi (Department of Molecular and Integrative Physiology, University of Michigan Medical School) | |
| Genetic reagent (M. musculus) | Xbp1flox | PMID:18556558 | Dr. Laurie H. Glimcher (Dana Farber Cancer Institute) | |
| Genetic reagent (M. musculus) | Perkflox | Jackson Laboratory | Stock No. 023066 RRID:IMSR_JAX:023066 | |
| Genetic reagent (M. musculus) | hCD2-iCre | Jackson Laboratory | Stock No. 008520 RRID:IMSR_JAX:008520 | |
| Genetic reagent (M. musculus) | Cd4-Cre | Jackson Laboratory | Stock No. 022071 RRID:IMSR_JAX:022071 | |
| Genetic reagent (M. musculus) | Atf6lflox | Jackson Laboratory | Stock No. 028253 RRID:IMSR_JAX:028253 | |
| Genetic reagent (M. musculus) | Vav1-iCre | Jackson Laboratory | Stock No. 008610 RRID:IMSR_JAX:008610 | |
| Genetic reagent (M. musculus) | OTII transgenic | Jackson Laboratory | Stock No. 004194 RRID:IMSR_JAX:004194 | |
| Cell line (M. musculus) | EL4 | ATCC | TIB-39 RRID:CVCL_0255 | |
| Cell line (M. musculus) | OP9-DL1 | PMID:12479821 | Dr. Juan Carlos Zúñiga-Pflücker (University of Toronto) | |
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-3216 RRID:CVCL_0063 | |
| Antibody | FITC anti-mouse CD45.1, Clone A20 (Mouse monoclonal) | Biolegend | 110706 RRID:AB_313494 | (1:100) FC |
| Antibody | APC anti-mouse CD45.2, Clone 104 (Mouse monoclonal) | Biolegend | 109814 RRID:AB_389211 | (1:100) FC |
| Antibody | Pacific Blue anti-mouse CD45.1, Clone A20 (Mouse monoclonal) | Biolegend | 110721 RRID:AB_492867 | (1:100) FC |
| Antibody | Alexa Fluor 700 anti-mouse CD45.2, Clone 104 (Mouse monoclonal) | Biolegend | 109822 RRID:AB_493731 | (1:100) FC |
| Antibody | FITC anti-mouse/human CD44, Clone IM7 (Rat monoclonal) | Biolegend | 103006 RRID:AB_312957 | (1:100) FC |
| Antibody | PE/Dazzle 594 anti-mouse/human CD44, Clone IM7 (Rat monoclonal) | Biolegend | 103056 RRID:AB_2564044 | (1:100) FC |
| Antibody | APC anti-mouse CD25, Clone 3C7 (Rat monoclonal) | Biolegend | 101910 RRID:AB_2280288 | (1:100) FC |
| Antibody | FITC anti-mouse Ki-67, Clone 16A8 (Rat monoclonal) | Biolegend | 652409 RRID:AB_2562140 | (1:100) FC |
| Antibody | APC/Fire 750 anti-mouse CD117 (c-Kit), Clone 2B8 (Rat monoclonal) | Biolegend | 105838 RRID:AB_2616739 | (1:50) FC |
| Antibody | Brilliant Violet 650 anti-mouse CD4, Clone RM4-5 (Rat monoclonal) | Biolegend | 100546 RRID:AB_2562098 | (1:100) FC |
| Antibody | Alexa Fluor 700 anti-mouse CD8a, Clone 53–6.7 (Rat monoclonal) | Biolegend | 100730 RRID:AB_493703 | (1:100) FC |
| Antibody | PE anti-mouse/rat/human CD27, Clone LG.3A10 (Armenian Hamster monoclonal) | Biolegend | 124209 RRID:AB_1236464 | (1:100) FC |
| Antibody | PE anti-mouse TCR β chain, Clone H57-597 (Armenian Hamster monoclonal) | Biolegend | 109207 RRID:AB_313430 | (1:100) FC |
| Antibody | APC anti-mouse TCR β chain, Clone H57-598 (Armenian Hamster monoclonal) | Biolegend | 109211 RRID:AB_313434 | (1:100) FC |
| Antibody | PE/Cyanine7 anti-mouse CD24, Clone M1/69 (Rat monoclonal) | Biolegend | 101822 RRID:AB_756048 | (1:100) FC |
| Antibody | PE/Dazzle 594 anti-mouse CD3ε, Clone 145–2 C11 (Armenian Hamster monoclonal) | Biolegend | 100348 RRID:AB_2564029 | (1:100) FC |
| Antibody | Pacific Blue anti-mouse/human CD45R/B220, Clone RA3-6B2 (Rat monoclonal) | Biolegend | 103230 RRID:AB_492877 | (1:100) FC |
| Antibody | FITC anti-mouse NK-1.1, Clone PK136 (Mouse monoclonal) | Biolegend | 108706 RRID:AB_313393 | (1:100) FC |
| Antibody | APC Anti-mouse TCR γ/δ, Clone GL3 (Armenian Hamster monoclonal) | Biolegend | 118115 RRID:AB_1731824 | (1:100) FC |
| Antibody | PE Anti-mouse TCR γ/δ, Clone GL3 (Mouse monoclonal) | Biolegend | 118108 RRID:AB_313832 | (1:100) FC |
| Antibody | PE anti-mouse Notch 1, Clone HMN1-12 (Armenian Hamster monoclonal) | Biolegend | 130607 RRID:AB_1227719 | 5 µL/test FC |
| Antibody | violetFluor 450 Anti-Mouse CD45, Clone 30-F11 (Rat monoclonal) | TONBO | 75–0451 U100 RRID:AB_2621947 | (1:100) FC |
| Antibody | PE anti-mouse CD150 (SLAM), Clone TC15-12F12.2 (Rat monoclonal) | BioLegend | 115904 RRID:AB_313683 | (1:100) FC |
| Antibody | TruStain FcX (anti-mouse CD16/32), Clone 93 (Rat monoclonal) | BioLegend | 101320 RRID:AB_1574975 | (1:100) FC |
| Antibody | APC anti-mouse Ly-6A/E (Sca-1), Clone D7 (Rat monoclonal) | BioLegend | 108112 RRID:AB_313349 | (1:100) FC |
| Antibody | PE/Cyanine7 Streptavidin | BioLegend | 405206 | (1:100) FC |
| Antibody | FITC anti-mouse CD48, Clone HM48-1 (Armenian Hamster monoclonal) | BioLegend | 103404 RRID:AB_313019 | (1:100) FC |
| Antibody | Biotin anti-mouse CD3ε, Clone 145–2 C11 (Armenian Hamster monoclonal) | Biolegend | 100304 RRID:AB_312669 | (1:100) FC |
| Antibody | Biotin anti-mouse/human CD45R/B220, Clone RA3-6B2 (Rat monoclonal) | Biolegend | 103204 RRID:AB_312989 | (1:100) FC |
| Antibody | Biotin anti-mouse TER-119, Clone TER-119 (Rat monoclonal) | Biolegend | 116204 RRID:AB_313705 | (1:100) FC |
| Antibody | Biotin anti-mouse CD49b (pan-NK cells), Clone DX5 (Rat monoclonal) | BioLegend | 108904 RRID:AB_313411 | (1:100) FC |
| Antibody | Biotin anti-mouse/human CD11b, Clone M1/70 (Rat monoclonal) | Biolegend | 101204 RRID:AB_312787 | (1:100) FC |
| Antibody | Biotin anti-mouse CD11c, Clone N418 (Armenian Hamster monoclonal) | Biolegend | 117303 RRID:AB_313772 | (1:100) FC |
| Antibody | Biotin anti-mouse Ly-6G/Ly-6C (Gr-1), Clone RB6-8C5 (Rat monoclonal) | BioLegend | 108404 RRID:AB_313369 | (1:100) FC |
| Antibody | FITC Mouse IgG1, κ Isotype Ctrl, Clone MOPC-21 (Mouse monoclonal) | Biolegend | 400108 RRID:AB_326429 | (1:20) FC |
| Antibody | PE Mouse IgG2a, κ Isotype Ctrl, Clone MOPC-173 (Mouse monoclonal) | Biolegend | 400213 RRID:AB_2800438 | (1:20) FC |
| Antibody | PERK (D11A8) (Rabbit monoclonal) | Cell Signaling | 5683S RRID:AB_10841299 | (1:200) WB |
| Antibody | Phospho-PERK (Thr980) (16F8) (Rabbit monoclonal) | Cell Signaling | 3179S RRID:AB_2095853 | (1:100) WB |
| Antibody | IRE1α (14C10) (Rabbit monoclonal) | Cell Signaling | 3294S RRID:AB_823545 | (1:200) WB |
| Antibody | eIF2α Antibody (FL-315) (Rabbit polyclonal) | Santa Cruz | sc-11386 RRID:AB_640075 | (1:200) WB |
| Antibody | Phospho-eIF2α (Ser51) (Rabbit polyclonal) | Cell Signaling | 9721S RRID:AB_330951 | (1:100) WB |
| Antibody | Phospho-Lck (Tyr505) (Rabbit polyclonal) | Cell Signaling | 2751 RRID:AB_330446 | (1:100) WB |
| Antibody | Phospho-Zap-70 (Tyr319)/Syk (Tyr352) (65E4) (Rabbit monoclonal) | Cell Signaling | 2717 RRID:AB_2218658 | (1:100) WB |
| Antibody | Zap-70 (D1C10E) XP (Rabbit monoclonal) | Cell Signaling | 3165 RRID:AB_2218656 | (1:200) WB |
| Antibody | CREB-2 (Rabbit polyclonal) | Santa Cruz | sc-200 RRID:AB_2058752 | (1:200) WB |
| Antibody | BiP (C50B12) (Rabbit monoclonal) | Cell Signaling | 3177 RRID:AB_2119845 | (1:200) WB |
| Antibody | Anti-SEL1L (ab78298) (Rabbit polyclonal) | Abcam | ab78298 RRID:AB_2285813 | (1:200) WB |
| Antibody | β-Actin (13E5) (Rabbit monoclonal) | Cell Signaling | 4970S RRID:AB_2223172 | (1:1000) WB |
| Antibody | Anti-Notch 1 (ab27526) (Rabbit polyclonal) | Abcam | ab27526 RRID:AB_471013 | (1:20) ChIP |
| Antibody | RBPSUH (D10A4) XP (Rabbit monoclonal) | Cell Signaling | 5315 RRID:AB_2665555 | (1:50) ChIP |
| Antibody | Normal Rabbit IgG (Rabbit polyclonal) | Cell Signaling | 2729 s RRID:AB_1031062 | (1:250) ChIP |
| Antibody | Cleaved Caspase-3 (Asp175) (Rabbit polyclonal) | Cell Signaling | 9661 RRID:AB_2341188 | (1:50) IHC |
| Sequence-based reagent | hCD2-iCre | Jackson Laboratory Stock No. 008520 | 5' primer | AGATGCCAGGACATCAGGAACCTG |
| Sequence-based reagent | hCD2-iCre | Jackson Laboratory Stock No. 008520 | 3' primer | ATCAGCCACACCAGACACAGAGATC |
| Sequence-based reagent | Vav1-iCre | Jackson Laboratory Stock No. 008610 | 5' primer | AGATGCCAGGACATCAGGAACCTG |
| Sequence-based reagent | Vav1-iCre | Jackson Laboratory Stock No. 008610 | 3' primer | ATCAGCCACACCAGACACAGAGATC |
| Sequence-based reagent | Sel1l f/f | PMID:24453213 | 5' primer | TTATGTCTGCTTAATTTCTGCTGG |
| Sequence-based reagent | Sel1l f/f | PMID:18556558 | 3' primer | TGAATGAGAAATCCAAGTAGTAGG |
| Sequence-based reagent | Xbp1 f/f | PMID:18556558 | 5' primer | ACTTGCACCAACACTTGCCATTTC |
| Sequence-based reagent | Xbp1 f/f | PMID:18556558 | 3' primer | CAAGGTGGTTCACTGCCTGTAATG |
| Sequence-based reagent | Perk f/f | Jackson Laboratory Stock No. 023066 | 5' primer | TTGCACTCTGGCTTTCACTC |
| Sequence-based reagent | Perk f/f | Jackson Laboratory Stock No. 023066 | 3' primer | AGGAGGAAGGTGGAATTTGG |
| Sequence-based reagent | Atf6 f/f | Jackson Laboratory Stock No. 028253 | Common Forward | TGCATCTGGGAAGAGAACCA |
| Sequence-based reagent | Atf6 f/f | Jackson Laboratory Stock No. 028253 | Wild type Reverse | TGCCATGAACTACCATGTCAC |
| Sequence-based reagent | Atf6 f/f | Jackson Laboratory Stock No. 028253 | Mutant Reverse | AGACTGCCTTGGGAAAAGCG |
| Sequence-based reagent | CD4-iCre | Jackson Laboratory Stock No. 022071 | Common Forward | GTT CTT TGT ATA TAT TGA ATG TTA GCC |
| Sequence-based reagent | CD4-iCre | Jackson Laboratory Stock No. 022071 | Wild type Reverse | TAT GCT CTA AGG ACA AGA ATT GAC A |
| Sequence-based reagent | CD4-iCre | Jackson Laboratory Stock No. 022071 | Mutant Reverse | CTT TGC AGA GGG CTA ACA GC |
| Sequence-based reagent | OTII transgenic | Jackson Laboratory Stock No. 004194 | Transgene Forward | GCT GCT GCA CAG ACC TAC T |
| Sequence-based reagent | OTII transgenic | Jackson Laboratory Stock No. 004194 | Transgene Reverse | CAG CTC ACC TAA CAC GAG GA |
| Sequence-based reagent | Mouse Sel1l | this paper | 5' primer | TGAATCACACCAAAGCCCTG |
| Sequence-based reagent | Mouse Sel1l | this paper | 3' primer | GCGTAGAGAAAGCCAAGACC |
| Sequence-based reagent | Mouse Xbp1 | this paper | 5' primer | CTGAGCCCGGAGGAGAAAG |
| Sequence-based reagent | Mouse Xbp1 | this paper | 3' primer | CTTCCAAATCCACCACTTGC |
| Sequence-based reagent | Mouse Xbp1s | this paper | 5' primer | CTGAGTCCGCAGCAGGTG |
| Sequence-based reagent | Mouse Xbp1s | this paper | 3' primer | TCCAACTTGTCCAGAATGCC |
| Sequence-based reagent | Mouse Ddit3(Chop) | this paper | 5' primer | GTCCCTAGCTTGGCTGACAGA |
| Sequence-based reagent | Mouse Ddit3(Chop) | this paper | 3' primer | TGGAGAGCGAGGGCTTTG |
| Sequence-based reagent | Mouse Erdj4 | this paper | 5' primer | CACAAATTAGCCATGAAGTACC |
| Sequence-based reagent | Mouse Erdj4 | this paper | 3' primer | TTTCATACGCTTCTGCAATCTC |
| Sequence-based reagent | Mouse Atf4 | this paper | 5' primer | CCACCATGGCGTATTAGAGG |
| Sequence-based reagent | Mouse Atf4 | this paper | 3' primer | GTCCGTTACAGCAACACTGC |
| Sequence-based reagent | Mouse Hrd1 | this paper | 5' primer | CAAGGTCCTGCTGTACATGG |
| Sequence-based reagent | Mouse Hrd1 | this paper | 3' primer | GTGTTCATGTTGCGGATGGC |
| Sequence-based reagent | Mouse Atf6 | this paper | 5' primer | AGGGAGAGGTGTCTGTTTCG |
| Sequence-based reagent | Mouse Atf6 | this paper | 3' primer | CTGCATCAAAGTGCACATCA |
| Sequence-based reagent | Mouse OS9 | this paper | 5' primer | GGTGTCGGGAGCCTGAATTT |
| Sequence-based reagent | Mouse OS9 | this paper | 3' primer | CCTCTCTTTCACGTTGGAAGTG |
| Sequence-based reagent | Mouse Edem1 | this paper | 5' primer | GGGGCATGTTCGTCTTCGG |
| Sequence-based reagent | Mouse Edem1 | this paper | 3' primer | CGGCAGTAGATGGGGTTGAG |
| Sequence-based reagent | Mouse Calreticulin | this paper | 5' primer | CCTGCCATCTATTTCAAAGAGCA |
| Sequence-based reagent | Mouse Calreticulin | this paper | 3' primer | GCATCTTGGCTTGTCTGCAA |
| Sequence-based reagent | Mouse Hyou1 | this paper | 5' primer | TGCGCTTCCAGATCAGTCC |
| Sequence-based reagent | Mouse Hyou1 | this paper | 3' primer | GGAGTAGTTCAGAACCATGCC |
| Sequence-based reagent | Mouse Canx | this paper | 5' primer | ATGGAAGGGAAGTGGTTACTGT |
| Sequence-based reagent | Mouse Canx | this paper | 3' primer | GCTTTGTAGGTGACCTTTGGAG |
| Sequence-based reagent | Mouse GRP94 | this paper | 5' primer | TCGTCAGAGCTGATGATGAAGT |
| Sequence-based reagent | Mouse GRP94 | this paper | 3' primer | GCGTTTAACCCATCCAACTGAAT |
| Sequence-based reagent | Mouse Hes1 | this paper | 5' primer | CCAGCCAGTGTCAACACGA |
| Sequence-based reagent | Mouse Hes1 | this paper | 3' primer | AATGCCGGGAGCTATCTTTCT |
| Sequence-based reagent | Mouse Deltex | this paper | 5' primer | ATCAGTTCCGGCAAGACACAG |
| Sequence-based reagent | Mouse Deltex | this paper | 3' primer | CGATGAGAGGTCGAGCCAC |
| Sequence-based reagent | Mouse preTCRa | this paper | 5' primer | TCACACTGCTGGTAGATGGA |
| Sequence-based reagent | Mouse preTCRa | this paper | 3' primer | TAGGCTCAGCCACAGTACCT |
| Sequence-based reagent | Mouse Notch1 | this paper | 5' primer | ACACTGACCAACAAATGGAGG |
| Sequence-based reagent | Mouse Notch1 | this paper | 3' primer | GTGCTGAGGCAAGGATTGGA |
| Sequence-based reagent | Mouse Actin | this paper | 5' primer | TACCACCATGTACCCAGGCA |
| Sequence-based reagent | Mouse Actin | this paper | 3' primer | CTCAGGAGGAGCAATGATCTTGAT |
| Sequence-based reagent | Vβ5 Forward | this paper | 5' primer | 5' CCCAGCAGATTCTCAGTCCAACAG 3' |
| Sequence-based reagent | Vβ8 Forward | this paper | 3' primer | 5' GCATGGGCTGAGGCTGATCCATTA 3' |
| Sequence-based reagent | Vβ11 Forward | this paper | 5' primer | 5' TGCTGGTGTCATCCAAACACCTAG 3' |
| Sequence-based reagent | Jβ2 Reverse | this paper | 3' primer | 5' TGAGAGCTGTCTCCTACTATCGATT 3' |
| Sequence-based reagent | eF-la Forward | this paper | 5' primer | 5'CTGCTGAGATGGGAAAGGGCT-3' |
| Sequence-based reagent | eF-la Reverse | this paper | 3' primer | 5' TTCAGGATAATCACCTGAGCA 3' |
| Sequence-based reagent | Sel1l promoter reporter wildtype | this paper | 5' primer | TAGCACGCGTGGGAAATGACAAGCGGCATTGTCTTGTAC |
| Sequence-based reagent | Sel1l promoter reporter wildtype | this paper | 3' primer | ATGCCTCGAGCCTGCTCTCGAAGGTCGAGAGCC |
| Sequence-based reagent | Sel1l promoter reporter mutated left_arm | this paper | 5' primer | CAGTTCAGGTATAGCTTATGGATCCGCGTTCATATCATGTCCAGTTCAAGGGATCCAAATAATTAAAAAGAAATACTTAGC |
| Sequence-based reagent | Sel1l promoter reporter mutated left_arm | this paper | 3' primer | GCTAAGTATTTCTTTTTAATTATTTGGATCCCTTGAACTGGACATGATATGAACGCGGATCCATAAGCTATACCTGAACTG |
| Sequence-based reagent | Sel1l promoter reporter mutated right-arm | this paper | 5' primer | TCTGGGCCAGGGAGGCCGTAAGGGGGGCGAAGAAGGAACC |
| Sequence-based reagent | Sel1l promoter reporter mutated right-arm | this paper | 3' primer | TCTGGGCCAGGGAGGCCGTAAGGGGGGCGAAGAAGGAACC |
| Sequence-based reagent | Hrd1 promoter reporter wildtype | this paper | 5' primer | TAGCACGCGTGTGACCCCTGTGTAACGGTTTGATTCC |
| Sequence-based reagent | Hrd1 promoter reporter wildtype | this paper | 3' primer | ATGCAAGCTTGAAAACAGATATAGGTCTTCC |
| Sequence-based reagent | Hrd1 promoter reporter mutated left arm | this paper | 5' primer | CCCCGGCCTATGGACTGCGCTGCATACGCTGGCATCCAGCTGCCTTGGCA |
| Sequence-based reagent | Hrd1 promoter reporter mutated left arm | this paper | 3' primer | TGCCAAGGCAGCTGGATGCCAGCGTATGCAGCGCAGTCCATAGGCCGGGG |
| Sequence-based reagent | Hrd1 promoter reporter mutated middle arm | this paper | 5' primer | CCAGAAATTTTTCCTTTCTTGCATACTTGGTCCGCGTAACTTT |
| Sequence-based reagent | Hrd1 promoter reporter mutated middle arm | this paper | 3' primer | AAAGTTACGCGGACCAAGTATGCAAGAAAGGAAAAATTTCTGG |
| Sequence-based reagent | Hrd1 promoter reporter mutated right arm | this paper | 5' primer | TAGCACGCGTGTGACCCCTGTGTAACGGTTTGATTCC |
| Sequence-based reagent | Hrd1 promoter reporter mutated right arm | this paper | 3' primer | ATGCAAGCTTGAAAACAGATATAGGTCCCTTACGGTTACCTCCCCCCAAC |
| Sequence-based reagent | ChIP-qPCR, Sel1l promoter P1 | this paper | 5' primer | TTCAGTTCAGGTATAGCTTATTTCTCAGCG |
| Sequence-based reagent | ChIP-qPCR, Sel1l promoter P1 | this paper | 3' primer | CGGTTAAGAACTTGCAAGGTTGCTAAG |
| Sequence-based reagent | ChIP-qPCR, Sel1l promoter P2 | this paper | 5' primer | CCTTATGCCCTCAGCCACCTGCGGC |
| Sequence-based reagent | ChIP-qPCR, Sel1l promoter P2 | this paper | 3' primer | GGGAACCCTCATCCAGGACTAC |
| Sequence-based reagent | ChIP-qPCR, Sel1l promoter P3 | this paper | 5' primer | CGCTTAACAAGACAGCTGTTGGG |
| Sequence-based reagent | ChIP-qPCR, Sel1l promoter P3 | this paper | 3' primer | TCTGGGGATTCAAATAACCATCTGGG |
| Sequence-based reagent | ChIP-qPCR, Hrd1 promoter P1 | this paper | 5' primer | GCTAGTTATGAATTGTAAGTAAACGTCTG |
| Sequence-based reagent | ChIP-qPCR, Hrd1 promoter P1 | this paper | 3' primer | CTGATTCTAGACGACTTTAAGGCAG |
| Sequence-based reagent | ChIP-qPCR, Hrd1 promoter P2 | this paper | 5' primer | AACCAATCGGCGGTAGCCACGG |
| Sequence-based reagent | ChIP-qPCR, Hrd1 promoter P2 | this paper | 3' primer | GGATAGCTACGACACGGTAAGAAG |
| Sequence-based reagent | ChIP-qPCR, Hrd1 promoter P3 | this paper | 5' primer | TGCCCAGGTTTCACAGTGCAGC |
| Sequence-based reagent | ChIP-qPCR, Hrd1 promoter P3 | this paper | 3' primer | ACCGAGACGCAGGAGAACACC |
| Sequence-based reagent | ChIP-qPCR, Os9 promoter P1 | this paper | 5' primer | GCTAGAGATGTCCCTTCCGC |
| Sequence-based reagent | ChIP-qPCR, Os9 promoter P1 | this paper | 3' primer | CAGCCAATGAAAGCTTGGGG |
| Sequence-based reagent | ChIP-qPCR, Os9 promoter P2 | this paper | 5' primer | GGAGGATAGCCGTGCTTTGA |
| Sequence-based reagent | ChIP-qPCR, Os9 promoter P2 | this paper | 3' primer | ATCATAGCTAAGGAGTGAGAATGAG |
| Sequence-based reagent | ChIP-qPCR, Edem1 promoter P1 | this paper | 5' primer | CTACTCCATACCTGGACGGG |
| Sequence-based reagent | ChIP-qPCR, Edem1 promoter P1 | this paper | 3' primer | GCCCTAGCCCGGGTAAATG |
| Sequence-based reagent | ChIP-qPCR, Edem1 promoter P2 | this paper | 5' primer | CCCTGGTGAGTTGCTGATGT |
| Sequence-based reagent | ChIP-qPCR, Edem1 promoter P2 | this paper | 3' primer | TGCTGTGAGTGTGTATGCGT |
| Sequence-based reagent | Mouse Xbp1 splicing | PMID:29480818 | 5' primer | ACACGCTTGGGAATGGACAC |
| Sequence-based reagent | Mouse Xbp1 splicing | PMID:29480818 | 3' primer | CCATGGGAAGATGTTCTGGG |
| Sequence-based reagent | Mouse Actin | PMID:29480818 | 5' primer | TACCACCATGTACCCAGGCA |
| Sequence-based reagent | Mouse Actin | PMID:29480818 | 3' primer | CTCAGGAGGAGCAATGATCTTGAT |
| peptide, recombinant protein | Recombinant Murine Flt3-Ligand, 2 ug | 250–31L | peprotech | |
| peptide, recombinant protein | Recombinant Murine IL7, 2 ug | 217–17 | peprotech | |
| peptide, recombinant protein | Recombinant Mouse DLL4 | 776702 | Biolegend | |
| commercial assay or kit | High-Capacity cDNA Reverse Transcription Kit | 4368813 | Thermo Fisher | |
| commercial assay or kit | Power SYBR Green PCR Master Mix | A25778 | Thermo Fisher | |
| commercial assay or kit | In Situ Cell Death Detection Kit, Fluorescein | 11684795910 | Roche | |
| commercial assay or kit | FITC BrdU Flow Kit | 559619 | BD Bioscience | |
| commercial assay or kit | eBioscience Foxp3 / Transcription Factor Staining Buffer Set | 00-5523-00 | Thermo Fisher | |
| commercial assay or kit | ER-Tracker Green (BODIPY FL Glibenclamide), for live-cell imaging | E34251 | Thermo Fisher | |
| commercial assay or kit | ProteoStat (R) Aggresome detect Kit | ENZ-51035-K100 | ENZO | |
| commercial assay or kit | Click-iT Plus OPP Alexa Fluor 647 Protein Synthesis Assay Kit | C10458 | Thermo Fisher | |
| commercial assay or kit | Genomic DNA Mini Kit | K182002 | Thermo Fisher | |
| commercial assay or kit | Truseq Stranded mRNA Kit | # 20020594 | Illumina | |
| Chemical compound, drug | DAPT | HY-13027 | MedChemExpress | |
| Chemical compound, drug | ISRIB (trans-isomer) | HY-12495 | MedChemExpress | |
| Chemical compound, drug | Tunicamycin | 76102–666 | VWR | |
| Chemical compound, drug | Tetraphenylethene maleimide (TMI) | PMID:31914399 | Custom Synthesized | |
| Software, algorithm | STAR | Version 2.5.2b | ||
| Software, algorithm | DESeq2 | R 3.6.1 | Version 1.26.0 | |
| Software, algorithm | fgsea | R 3.6.1 | Version 1.11.2 | |
| Software, algorithm | pheatmap | R 3.6.1 | Version 1.0.12 | |
| Software, algorithm | Enrichr | https://maayanlab.cloud/Enrichr/ | ||
| Software, algorithm | Graphpad Prism 8.4 | Graphpad (graphpad.com) | RRID:SCR_002798 | |
| Software, algorithm | Fiji | http://imagej.net/Fiji | RRID:SCR_003070 | |
| Software, algorithm | FlowJo 10 | Tree Star | RRID:SCR_008520 | |
| Software, algorithm | Biorender | https://biorender.com/ | Biorender was utilized to make the schematic diagrams used in this study. | |
| Other | LD Columns | 130-042-901 | Miltenyi Biotec | |
| Other | CD4 (L3T4) MicroBeads, mouse 1 x 2 mL | 130-117-043 | Miltenyi Biotec | |
| Other | CD8a (Ly-2) MicroBeads, mouse | 130-117-044 | Miltenyi Biotec | |
| Other | DAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride) | D1306 | Thermo Fisher | |
| Other | Precision Count Beads | 424902 | Biolegend | |
| Other | RBC Lysis Buffer (10X) | 420301 | Biolegend | |
| Other | Liquid DAB+ | K3468 | Dako |
