1. Developmental Biology
  2. Immunology and Inflammation

Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection

  1. Xia Liu
  2. Jingjing Yu
  3. Longyong Xu
  4. Katharine Umphred-Wilson
  5. Fanglue Peng
  6. Yao Ding
  7. Brendan M Barton
  8. Xiangdong Lv
  9. Michael Y Zhao
  10. Shengyi Sun
  11. Yuning Hong
  12. Ling Qi
  13. Stanley Adoro  Is a corresponding author
  14. Xi Chen  Is a corresponding author
  1. Department of Molecular and Cellular Biology, Baylor College of Medicine, United States
  2. Lester and Sue Smith Breast Center and Dan L Duncan Comprehensive Cancer Center, Baylor College of Medicine, United States
  3. Department of Pathology, School of Medicine, Case Western Reserve University, United States
  4. Center for Molecular Medicine and Genetics, Wayne State University, United States
  5. Department of Chemistry and Physics, La Trobe University, Australia
  6. Department of Molecular and Integrative Physiology, University of Michigan Medical School, United States
https://doi.org/10.7554/eLife.69975
Share this article
Cite this article
  1. Xia Liu
  2. Jingjing Yu
  3. Longyong Xu
  4. Katharine Umphred-Wilson
  5. Fanglue Peng
  6. Yao Ding
  7. Brendan M Barton
  8. Xiangdong Lv
  9. Michael Y Zhao
  10. Shengyi Sun
  11. Yuning Hong
  12. Ling Qi
  13. Stanley Adoro
  14. Xi Chen
(2021)
Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection
eLife 10:e69975.
https://doi.org/10.7554/eLife.69975
  2. Download BibTeX
  3. Download .RIS
6 figures, 1 table and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
Protein quality control in β-selected thymocytes.

(A) Schematic of labeling and detection of nascent protein with OP-Puro. OP-Puro (O-propargyl puromycin) is a cell-permeable puromycin analog that is incorporated into the C-terminus of newly synthesized peptide chain. Fluorophore conjugated with Alexa Fluor 647 was then attached to OP-Puro through a copper-catalyzed click chemistry reaction between alkyne and azide group, which quantifies protein synthesis by fluorescence intensity. (B) Representative histogram (left) and quantification (right) of OP-Puro incorporation in different thymocyte subsets from 8-week-old wild-type mice. FMO represents AF647 control which is the background from the click chemistry in the absence of OP-Puro. MFI, mean fluorescence intensity. n = four mice. (C) Quantification of tetraphenylethene maleimide (TMI) fluorescence in different thymocyte subsets from 8-week-old wild-type mice. n = seven mice. (D) Quantitative RT-PCR analysis of ERAD (Sel1l) and UPR-related (Xbp1, Hspa5(Bip), Dnajb9, Ddit3 (Chop), Atf4) genes expression in different thymocyte subsets from 6-week-old wild-type mice. Data are presented relative to Actb; n = three mice. (B–D), ETP: early T lineage precursor (Lin- CD4- CD8- CD44+ CD25- CD117+); DN2: double negative two thymocytes (Lin- CD4- CD8- CD44+ CD25+); DN3: double negative three thymocytes (Lin- CD4- CD8- CD44- CD25+); DN4: double negative four thymocytes (Lin- CD4- CD8- CD44- CD25-); DP: double positive thymocytes (Lin- CD4+ CD8+); SP4: CD4 single positive thymocytes (Lin- CD4+ CD8-); SP8: CD8 single positive thymocytes (Lin- CD4- CD8+). Results are shown as mean ± s.d. The statistical significance was calculated by one-way ANOVA with Bonferroni test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n.s., not significant.

Figure 1—source data 1

Excel file containing numerical values shown in Figure 1.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Diagrams and representative flow cytometry gates used in this study.

(A) Diagram showing two ER quality control machineries: ERAD and UPR. The E3 ubiquitin ligase HRD1 and its adaptor protein SEL1L is the most conserved ERAD complex in mammals. While correctly folded proteins exit the ER, misfolded proteins in the ER are recruited to the SEL1L-HRD1 complex through ER chaperones (such as BiP, EDEM, and OS9), and then retrotranslocated into the cytosol, ubiquitinated and degraded by the proteasome. Failure to clear the misfolded or unfolded proteins in the ER activates the UPR signaling through three ER stress sensors IRE1α, ATF6, and PERK. Upon activation, IRE1α oligomerizes and undergoes trans-autophosphorylation to activate its RNase domain, resulting in the removal of 26 nucleotides from unspliced XBP1 (XBP1u) mRNA to produce mature, spliced XBP1 (XBP1s) mRNA. PERK is a serine-threonine kinase. ER stress induces PERK-dependent eIF2α phosphorylation and subsequent increased cap-independent translation of ATF4 and induction of CHOP. (B) Schematic diagram of T-cell development in the thymus. CLP: common lymphoid progenitors; ETP: early T lineage precursor (Lin- CD4- CD8- CD44+ CD25- CD117+); DN2: double negative two thymocytes (Lin- CD4- CD8- CD44+ CD25+); DN3: double negative three thymocytes (Lin- CD4- CD8- CD44- CD25+); DN4: double negative four thymocytes (Lin- CD4- CD8- CD44- CD25-); ISP: immature single-positive thymocytes (Lin-CD8+CD24+TCRβ-); DP: double positive thymocytes (Lin- CD4+ CD8+); SP4: CD4 single positive thymocytes (Lin- CD4+ CD8-); SP8: CD8 single positive thymocytes (Lin- CD4- CD8+). (C) Representative pseudocolor plots showing the gating strategy to identify different thymocyte subsets in the thymus.

Figure 2 with 2 supplements
Download asset Open asset
SEL1L is required for αβ T cell development.

(A) Images of thymus from 6 to 8 week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 3. (B and C) Thymus weight (B) and thymus cellularity (C) of age and gender-matched control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 4. (D) Representative images of H and E staining of thymus from 6~8-week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. Scale bars are indicated. C: Cortex. M: Medulla. (E and F) Quantification of cell numbers of the indicated thymocyte subsets in 6- to 8-week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 4. (G) Schematic depiction of the competitive bone marrow transplantation (BMT) experiment using whole bone marrow cells from control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice as donors. (H and I) Representative flow cytometry plots (H) and percentage (I) of control (Ctrl, Sel1lflox/flox) or Sel1l CKO donor-derived thymocyte subsets in the recipient mice 14 weeks after transplantation. n = 4–5. (J), Schematic overview of OP9-DL1 cell co-culture system. Sorted DN2 or DN3 cells from control (Ctrl) or Sel1l CKO mice were cultured on a monolayer of OP9 -DL1 cells supplemented with IL-7 and Flt3. (K, L, M) Representative pseudocolor plots (K) and percentage of DN3 (L) or DN4 (M) in DN thymocytes at indicated time points after in vitro co-culture of equal number of control (Ctrl, Sel1lflox/flox) or Sel1l CKO DN2 cells on OP9-DL1 cells supplemented with IL-7 and Flt3. n = 3. Results are shown as mean ± s.d. The statistical significance was calculated by two-tailed unpaired t-test (B, C, E, F, I) or two-way ANOVA with Bonferroni test (L, M). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n.s., not significant.

Figure 2—source data 1

Excel file containing numerical values shown in Figure 2.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Download asset Open asset
UPR is dispensable for αβ T cell development.

(A) Quantitative RT-PCR analysis of Sel1l expression in murine bone marrow progenitors and different thymocyte subsets from control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. Data are presented relative to Actb. n = 4. LMPP: lymphoid-primed multipotent progenitor. (B) Western blot analysis of SEL1L protein in sorted DN3 and DN4 thymocytes from Ctrl or Sel1l CKO mice. β-ACTIN was used as loading control. The original western blot images are provided in Figure 2—figure supplement 1—source data 1. (C–F) Representative images of thymus (C), thymus cellularity (D), cell numbers of indicated populations in the thymus (E) and peripheral splenocyte numbers of indicated populations (F) from age and gender-matched control (Ctrl, Perkflox/flox) or Perk CKO (Perkflox/flox; CD2-iCre) mice. n = 4. (G–J) Representative images of thymus (G), thymus cellularity (H), cell numbers of indicated populations in the thymus (I) and peripheral splenocyte numbers of indicated populations (J) from age and gender-matched control (Ctrl, Xbp1flox/flox) or Xbp1 CKO (Xbp1flox/flox; CD2-iCre) mice. n = 3–4. (K–N) Representative images of thymus (K), thymus cellularity (L), cell numbers of indicated populations in the thymus (M) and peripheral splenocyte numbers of indicated populations (N) from age and gender-matched control (Ctrl, Atf6flox/flox) and Atf6flox/flox; Vav1-iCre mice. n = 5. (O) Images of spleen from 6 to 8 week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. (P) Quantification of cell numbers of the indicated populations in the spleen of 6- to 8-week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. (Q) Images of the inguinal (left) lymph nodes from 6- to 8-week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. (R) Quantification of cell numbers in the lymph nodes of 6- to 8 week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 4. (S) Quantification of cell numbers of γδ T cells from 6- to 8-week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. Ctrl: n = 4. Sel1l CKO: n = 5. Data are representative of three independent experiments and are shown as mean ± s.d. Two-tailed Student’s t-tests (A, D–F, H–J, L–N, P, R, S) was used to calculate p values. n.s., not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 2—figure supplement 1—source data 1

Original western blot images shown in Figure 2—figure supplement 1.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig2-figsupp1-data1-v2.pdf
Figure 2—figure supplement 1—source data 2

Excel file containing numerical values shown in Figure 2—figure supplement 1.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig2-figsupp1-data2-v2.xlsx
Figure 2—figure supplement 2
Download asset Open asset
SEL1L is required for DN to DP thymocyte transition following β selection.

(A) Representative flow cytometry plots of different thymocyte subsets in control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. (B) Diagram showing different stages of CD2-iCre and Cd4-Cre initiated gene depletion during T cell development. (C) Quantitative RT-PCR analysis of Sel1l in different thymocyte subsets from control (Ctrl, Sel1lflox/flox) and Sel1lflox/flox; Cd4-Cre mice. Data are presented relative to Actb. n = 3. (D and E) Representative images of thymus (D) and quantification of thymus cellularity (E) in 6- to 8-week-old control (Ctrl, Sel1lflox/flox) and Sel1lflox/flox; Cd4-Cre mice. n = 3. (F and G) Quantification of cell numbers of different thymocyte subsets from control (Ctrl, Sel1lflox/flox) and Sel1lflox/flox; Cd4-Cre mice. n = 3. (H) Percentage of Ctrl or Sel1l CKO donor-derived progenitors in the bone marrow of recipient mice 14 weeks after transplantation. n = 4–5. (I) Quantification of Ctrl or Sel1l CKO donor-derived DN3/DN4 ratio. n = 4–5. (J) Percentage of Ctrl or Sel1l CKO donor-derived CD4+ T cells, CD8+ T cells, myeloid cells, and dendritic cells (DC) in the spleen of recipient mice 14 weeks after transplantation. n = 4–5. (K and L) Cell cycle analysis of DN3 thymocytes in 6-week-old control (Ctrl) and Sel1l CKO mice using Ki67 and DAPI. Representative flow cytometry plots (K) and quantification (L) are shown. n = 3. Data are shown as mean ± s.d. The statistical significance was calculated by two-tailed unpaired t-test (C, E-J) or Two-way ANOVA with Bonferroni test (L). n.s., not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 2—figure supplement 2—source data 1

Excel file containing numerical values shown in Figure 2—figure supplement 2.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig2-figsupp2-data1-v2.xlsx
Figure 3
Download asset Open asset
SEL1L is required for thymocyte survival at the β-selection checkpoint.

(A) Quantification of BrdU incorporation in different thymocyte subsets from 6-week-old control (Ctrl, Sel1lflox/flox) or Sel1l CKO mice. n = 3–4. (B and C) Cell cycle analysis of DN4 thymocytes in 6-week-old control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) using Ki67 and DAPI. Representative flow cytometry plots (B) and quantification (C) are shown. n = 3. (D) Quantification of apoptotic Ctrl or Sel1l CKO (Sel1lflox/flox; CD2-iCre) DN3 thymocytes co-cultured with OP9-DL1 cells in vitro for 2 days. n = 3. (E and F) Representative images (E) and quantification (F) of cleaved caspase-3 (CC3) positive cells in the thymus of 6- to 8-week-old control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. Sixteen fields were counted at ×20 magnification from 4 Ctrl or Sel1l CKO mice. Scale bars are indicated. (G and H) Representative images (G) and quantification (H) of TUNEL positive cells in the thymus of 6- to 8-week-old control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 4. Scale bar, 20 μM. Results are shown as mean ± s.d. The statistical significance was calculated by two-tailed unpaired t-test (D, F, H) or two-way ANOVA with Bonferroni test (A, C). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n.s., not significant.

Figure 3—source data 1

Excel file containing numerical values shown in Figure 3.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig3-data1-v2.xlsx
Figure 4 with 1 supplement
Download asset Open asset
Notch directly regulates transcription of ERAD genes.

(A) Quantification of surface NOTCH1 levels in different thymocyte subsets from wild-type mice. MFI, mean fluorescence intensity. n = four mice. (B) Quantitative RT–PCR analysis of ERAD genes (Sel1l, Hrd1, Os9, Edem1) expression in EL4 cells after stimulation with 5 μg/ml Delta ligand 4 (DLL4) for 24 hr. Data are presented relative to Actb. n = 3. (C) Western blot analysis of SEL1L level in EL4 cells after stimulation with Delta ligand 4 (DLL4) for 12 hr. β-ACTIN was used as loading control. The original western blot images are provided in Figure 4—source data 1. (D) Quantitative RT–PCR analysis of ERAD genes (Sel1l, Hrd1, Os9, Edem1) expression in primary DN3 thymocytes treated with 2 μM γ-secretase inhibitor DAPT for 5 hr. Data are presented relative to Actb. n = 3. (E) Conserved RBP-J binding motif (Red) within the promoters of Sel1l and Hrd1. Alignment of the Sel1l (Upper) or Hrd1 (lower) promoter from genomic sequence from human, mouse, and rat. The numbering corresponds to the mouse sequence and is relative to the transcription start site (TSS). Mutations of the RBP-J-binding motifs within Sel1l or Hrd1 promoter luciferase reporters (as in L, M) are shown. (F–I). Upper: Schematic diagram of the ChIP primer (P1–P3) locations across the Sel1l (F) Hrd1, (G) Edem1, (H) or Os9 (I) promoter regions. TSS: transcription start site. Lower: Chromatin extracts from EL4 cells treated with PBS or 5 μg/ml DLL4 for 24 hr were subjected to ChIP using anti-RBP-J antibody, anti-NICD antibody, or normal IgG. Genomic regions of Sel1l (F), Hrd1 (G), Edem1 (H), or Os9 (I) promoter (as in left panel) were tested for enrichment of RBP-J, NICD or IgG. Data are shown as percentage of input. (J) Sel1l or Hrd1 promoter luciferase reporter was co-transfected with empty vector or different doses of NICD into HEK293T cells, and luciferase activity was measured 36 hr after transfection. pGL3 basic was used as control. (K and L) Wild-type or mutant (RBP-J motif mutations, as shown in E) Sel1l (K) or Hrd1 (L) promoter luciferase reporter was transfected into EL4 cells which were treated with PBS or 5 μg/ml DLL4 for 24 hr before harvest. Luciferase activity was measured 36 hr after transfection. All luciferase data are presented relative to Renilla readings. Data are shown as mean ± s.d. Two-tailed Student’s t-tests (A, B, D, F-I, K, L) or one-way ANOVA with Bonferroni test (J) were used to calculate p values. n.s., not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 4—source data 1

Original western blot images shown in Figure 4.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig4-data1-v2.pdf
Figure 4—source data 2

Excel file containing numerical values shown in Figure 4.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig4-data2-v2.xlsx
Figure 4—figure supplement 1
Download asset Open asset
Notch signal regulates ERAD genes expression.

(A) Quantitative RT-PCR analysis of Notch target genes expression in EL4 cells after stimulation with 5 μg/ml Delta ligand 4 (DLL4) for 24 hr. Data are presented relative to Actb. n = 3. (B) Quantitative RT-PCR analysis of Notch target genes expression in primary DN3 thymocytes treated with 2 μM γ-secretase inhibitor DAPT for 5 hr. Data are presented relative to Actb. n = 3. (C) Expression of Notch1 on cell surface of different thymocyte subsets from control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. Ctrl: n = 2. Sel1l CKO: n = 4. (D) Quantitative RT-PCR analysis of Notch target genes expression in primary DN3 thymocytes from control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 4. Data are shown as mean ± s.d. Two-tailed Student’s t-tests (A–C) was used to calculate p values. n.s., not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 4—figure supplement 1—source data 1

Excel file containing numerical values shown in Figure 4—figure supplement 1.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig4-figsupp1-data1-v2.xlsx
Figure 5 with 2 supplements
Download asset Open asset
Sel1l-deficiency triggers unresolved ER stress during β-selection.

(A) Heatmap showing differentially expressed genes from the RNA-seq analysis of DN3 thymocytes sorted from control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. n = 4. (B) Gene Ontology (GO) analysis of the most significantly upregulated pathways in Sel1l CKO (Sel1lflox/flox; CD2-iCre) DN3 thymocytes compared with control (Ctrl, Sel1lflox/flox) DN3 thymocytes. (C–E) Plots from GSEA analysis showing enrichment of Unfolded Protein Response (C), IRE1α (D), and PERK (E) pathways in Sel1l CKO (Sel1lflox/flox; CD2-iCre) DN3 thymocytes compared to control (Ctrl, Sel1lflox/flox) DN3 thymocytes. (F and G) Representative histogram (F) and quantification(G) of ER-tracker staining in DN3 thymocytes sorted from control (Ctrl, Sel1lflox/flox) and Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. Ctrl: n = 4; Sel1l CKO: n = 3. MFI, mean fluorescence intensity. (H) Western blot analysis of UPR pathway markers in primary DN3 thymocytes sorted from 6-week-old Ctrl or Sel1l CKO mice. β-ACTIN was used as loading control. The original western blot images are provided in Figure 5—source data 1. (I) PCR analysis of XBP1-splicing in DN3 thymocytes sorted from Ctrl or Sel1l CKO mice. Xbp1u: Unspliced Xbp1; Xbp1s: Spliced Xbp1. ACTIN was used as loading control. The original gel images are provided in Figure 5—source data 2. (J and K) Representative histogram (J) and quantification (K) of unfolded/misfolded protein level measured by TMI in DN3 thymocytes sorted from Ctrl or Sel1l CKO mice. n = 3. (L) Schematic illustration of labeling and detection of misfolded and aggregated proteins with ProteoStat dye. (M and N) Representative images (M) and quantification (N) of protein aggregation measured by ProteoStat Protein Aggregation Detection Kit in primary DN3 thymocytes sorted from three pooled Ctrl or Sel1l CKO mice. Results are shown as mean ± s.d. Two-tailed Student’s t-tests (G, K, N) was used to calculate p values. **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 5—source data 1

Original western blot images shown in Figure 5.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-data1-v2.pdf
Figure 5—source data 2

Original gels images shown in Figure 5.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-data2-v2.pdf
Figure 5—source data 3

Excel file containing numerical values shown in Figure 5.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-data3-v2.xlsx
Figure 5—figure supplement 1
Download asset Open asset
SEL1L is not required for TCRβ gene rearrangement and pre-TCR signaling.

(A) PCR analysis of Vβ5-Jβ2, Vβ8-Jβ2, and Vβ11-Jβ2 gene rearrangements using genomic DNA of DN3 and DN4 thymocytes sorted from control (Ctrl, Sel1lflox/flox) or Sel1l CKO (Sel1lflox/flox; CD2-iCre) mice. The original gel images are provided in Figure 5—figure supplement 1—source data 1. (B and C) Representative flow cytometry plots (B) and quantification (C) of intracellular TCRβ positive cells in DN3a, DN3b and DN4 thymocytes from Ctrl or Sel1l CKO mice. n = 5. (D) Western blot analysis of the expression of proteins involved in pre-TCR signaling in primary DN3 and DN4 thymocytes sorted from Ctrl or Sel1l CKO mice. β-ACTIN was used as loading control. The original western blot images are provided in Figure 5—figure supplement 1—source data 2. (E–H) Representative pseudocolor plots (E) quantification of total thymocytes (F) and cell numbers of indicated populations (G and H) from OT-II.Ctrl (OT-II; Sel1lflox/flox) or OT-II. Sel1l CKO (OT-II; Sel1lflox/flox; CD2-iCre) mice. OT-II.Ctrl: n = 7. OT-II. Sel1l CKO: n = 6. Data are shown as mean ± s.d. Two-tailed Student’s t-tests (C, F–H) was used to calculate p values. n.s., not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 5—figure supplement 1—source data 1

Original gels images shown in Figure 5—figure supplement 1.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp1-data1-v2.pdf
Figure 5—figure supplement 1—source data 2

Original western blot images shown in Figure 5—figure supplement 1.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp1-data2-v2.pdf
Figure 5—figure supplement 1—source data 3

Excel file containing numerical values shown in Figure 5—figure supplement 1.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp1-data3-v2.xlsx
Figure 5—figure supplement 2
Download asset Open asset
Sel1l knockout induces ER stress.

(A) Western blot analysis of UPR pathway markers in primary DN4 thymocytes sorted from 6-week-old Ctrl or Sel1l CKO mice. β-ACTIN was used as loading control. The original western blot images are provided in Figure 5—figure supplement 2—source data 1. (B) PCR analysis of XBP1-splicing in DN4 thymocytes sorted from Ctrl or Sel1l CKO mice. Xbp1u: Unspliced Xbp1; Xbp1s: Spliced Xbp1. ACTIN was used as loading control. The original gel images are provided in Figure 5—figure supplement 2—source data 2. (C and D) Quantitative RT-PCR analysis of ER chaperone genes expression in DN3 (C) and DN4 (D) thymocytes sorted from 6-week-old Ctrl or Sel1l CKO mice. Data are presented relative to Actb. n = 3. Data are shown as mean ± s.d. Two-tailed Student’s t-tests was used to calculate p values. n.s., not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 5—figure supplement 2—source data 1

Original western blot images shown in Figure 5—figure supplement 2.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp2-data1-v2.pdf
Figure 5—figure supplement 2—source data 2

Original gels images shown in Figure 5—figure supplement 2.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp2-data2-v2.pdf
Figure 5—figure supplement 2—source data 3

Excel file containing numerical values shown in Figure 5—figure supplement 2.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig5-figsupp2-data3-v2.xlsx
Figure 6 with 1 supplement
Download asset Open asset
PERK signaling drives β-selected thymocyte apoptosis in Sel1l CKO mouse.

(A and B) Representative images of thymus (A) and quantification of total thymocytes, DP, SP4 and SP8 thymocytes (B) from age (6-week-old) and gender-matched control (Ctrl, Sel1lflox/flox), Sel1l KO (Sel1lflox/flox; CD2-iCre), Perk KO (Perkflox/flox; CD2-iCre)and Sel1l/Perk double knockout (DKO. Sel1lflox/flox, Perkflox/flox; CD2-iCre) mice. n = 3–5 each group. (C and D) Representative images of spleen (C) and quantification of total splenocytes, total CD3+ T cells, CD4+ T cells, and CD8+ T cells (D) from the same mice with indicated genotype as in A and B. n = 3–5 each group. (E and F) Representative images of the inguinal (left) lymph node (E) and quantification of total lymphocytes, total CD3+ T cells, CD4+ T cells, and CD8+ T cells (F) from the same mice with indicated genotype as in A and B. n = 3–5 each group. (G) Quantitative RT–PCR analysis of Chop expression in DN3 thymocytes sorted from mice with indicated genotype. n = 3–5 each group. (H and I) Representative images (H) and quantification (I) of cleaved caspase-3 (CC3)-positive cells in the thymus of 6- to 8-week-old gender-matched mice with indicated genotype. Twelve fields were counted at ×20 magnification from four mice with indicated genotype. Scale bars are indicated. Data are representative of three independent experiments and are shown as mean ± s.d. The statistical significance was calculated by two-tailed unpaired t-test (D, F) One-way ANOVA with turkey test (B, G) or one-way ANOVA with Bonferroni test (I). ns, not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 6—source data 1

Excel file containing numerical values shown in Figure 6.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Download asset Open asset
XBP1 functions as a compensatory adaptative mechanism in Sel1l CKO mouse.

(A) Quantification of total cellularity and DP cell numbers of 6–8 week-old gender-matched control (Ctrl, Sel1lflox/flox), Sel1l KO (Sel1lflox/flox; CD2-iCre), Xbp1 KO (Xbp1 flox/flox; CD2-iCre), and Sel1l/Xbp1 double knockout (DKO, Sel1lflox/flox; Xbp1flox/flox; CD2-iCre) mice. n = 3–6/each group. (B) Quantitative RT-PCR analysis Chop expression in DN3 thymocytes sorted from mice with indicated genotype. Data are presented relative to Actb. (C) Cell cycle analysis of DN4 thymocytes from age (6-week-old) and gender-matched control (Ctrl, Sel1lflox/flox), Sel1l KO (Sel1lflox/flox; CD2-iCre), Perk KO (Perkflox/flox; CD2-iCre) and Sel1l/Perk double knockout (DKO. Sel1lflox/flox; Perkflox/flox; CD2-iCre) mice. n = 3–5 each group. Data are shown as mean ± s.d. The statistical significance was calculated by two-tailed unpaired t-test (A, B) or One-way ANOVA with Turkey test (C). n.s., not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

Figure 6—figure supplement 1—source data 1

Excel file containing numerical values shown in Figure 6—figure supplement 1.

https://cdn.elifesciences.org/articles/69975/elife-69975-fig6-figsupp1-data1-v2.xlsx

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent (M. musculus)Sel1lfloxPMID:24453213Dr. Ling Qi (Department of Molecular and Integrative Physiology, University of Michigan Medical School)
Genetic reagent (M. musculus)Xbp1floxPMID:18556558Dr. Laurie H. Glimcher (Dana Farber Cancer Institute)
Genetic reagent (M. musculus)PerkfloxJackson LaboratoryStock No. 023066
RRID:IMSR_JAX:023066
Genetic reagent (M. musculus)hCD2-iCreJackson LaboratoryStock No. 008520
RRID:IMSR_JAX:008520
Genetic reagent (M. musculus)Cd4-CreJackson LaboratoryStock No. 022071 RRID:IMSR_JAX:022071
Genetic reagent (M. musculus)Atf6lfloxJackson LaboratoryStock No. 028253 RRID:IMSR_JAX:028253
Genetic reagent (M. musculus)Vav1-iCreJackson LaboratoryStock No. 008610 RRID:IMSR_JAX:008610
Genetic reagent (M. musculus)OTII transgenicJackson LaboratoryStock No. 004194 RRID:IMSR_JAX:004194
Cell line (M. musculus)EL4ATCCTIB-39
RRID:CVCL_0255
Cell line (M. musculus)OP9-DL1PMID:12479821Dr. Juan Carlos Zúñiga-Pflücker (University of Toronto)
Cell line (Homo sapiens)HEK293TATCCCRL-3216
RRID:CVCL_0063
AntibodyFITC anti-mouse CD45.1, Clone A20 (Mouse monoclonal)Biolegend110706
RRID:AB_313494		(1:100) FC
AntibodyAPC anti-mouse CD45.2, Clone 104 (Mouse monoclonal)Biolegend109814
RRID:AB_389211		(1:100) FC
AntibodyPacific Blue anti-mouse CD45.1, Clone A20 (Mouse monoclonal)Biolegend110721
RRID:AB_492867		(1:100) FC
AntibodyAlexa Fluor 700 anti-mouse CD45.2, Clone 104 (Mouse monoclonal)Biolegend109822
RRID:AB_493731		(1:100) FC
AntibodyFITC anti-mouse/human CD44, Clone IM7 (Rat monoclonal)Biolegend103006
RRID:AB_312957		(1:100) FC
AntibodyPE/Dazzle 594 anti-mouse/human CD44, Clone IM7 (Rat monoclonal)Biolegend103056
RRID:AB_2564044		(1:100) FC
AntibodyAPC anti-mouse CD25, Clone 3C7 (Rat monoclonal)Biolegend101910
RRID:AB_2280288		(1:100) FC
AntibodyFITC anti-mouse Ki-67, Clone 16A8 (Rat monoclonal)Biolegend652409
RRID:AB_2562140		(1:100) FC
AntibodyAPC/Fire 750 anti-mouse CD117 (c-Kit), Clone 2B8 (Rat monoclonal)Biolegend105838
RRID:AB_2616739		(1:50) FC
AntibodyBrilliant Violet 650 anti-mouse CD4, Clone RM4-5 (Rat monoclonal)Biolegend100546
RRID:AB_2562098		(1:100) FC
AntibodyAlexa Fluor 700 anti-mouse CD8a, Clone 53–6.7 (Rat monoclonal)Biolegend100730
RRID:AB_493703		(1:100) FC
AntibodyPE anti-mouse/rat/human CD27, Clone
LG.3A10 (Armenian Hamster monoclonal)		Biolegend124209
RRID:AB_1236464		(1:100) FC
AntibodyPE anti-mouse TCR β chain, Clone H57-597 (Armenian Hamster monoclonal)Biolegend109207
RRID:AB_313430		(1:100) FC
AntibodyAPC anti-mouse TCR β chain, Clone H57-598 (Armenian Hamster monoclonal)Biolegend109211
RRID:AB_313434		(1:100) FC
AntibodyPE/Cyanine7 anti-mouse CD24, Clone M1/69 (Rat monoclonal)Biolegend101822
RRID:AB_756048		(1:100) FC
AntibodyPE/Dazzle 594 anti-mouse CD3ε, Clone 145–2 C11 (Armenian Hamster monoclonal)Biolegend100348
RRID:AB_2564029		(1:100) FC
AntibodyPacific Blue anti-mouse/human CD45R/B220, Clone RA3-6B2 (Rat monoclonal)Biolegend103230
RRID:AB_492877		(1:100) FC
AntibodyFITC anti-mouse NK-1.1, Clone PK136 (Mouse monoclonal)Biolegend108706
RRID:AB_313393		(1:100) FC
AntibodyAPC Anti-mouse TCR γ/δ, Clone GL3 (Armenian Hamster monoclonal)Biolegend118115
RRID:AB_1731824		(1:100) FC
AntibodyPE Anti-mouse TCR γ/δ, Clone GL3 (Mouse monoclonal)Biolegend118108
RRID:AB_313832		(1:100) FC
AntibodyPE anti-mouse Notch 1, Clone HMN1-12 (Armenian Hamster monoclonal)Biolegend130607
RRID:AB_1227719		5 µL/test FC
AntibodyvioletFluor 450 Anti-Mouse CD45, Clone 30-F11 (Rat monoclonal)TONBO75–0451 U100
RRID:AB_2621947		(1:100) FC
AntibodyPE anti-mouse CD150 (SLAM), Clone TC15-12F12.2 (Rat monoclonal)BioLegend115904
RRID:AB_313683		(1:100) FC
AntibodyTruStain FcX (anti-mouse CD16/32), Clone 93 (Rat monoclonal)BioLegend101320
RRID:AB_1574975		(1:100) FC
AntibodyAPC anti-mouse Ly-6A/E (Sca-1), Clone D7 (Rat monoclonal)BioLegend108112
RRID:AB_313349		(1:100) FC
AntibodyPE/Cyanine7 StreptavidinBioLegend405206(1:100) FC
AntibodyFITC anti-mouse CD48, Clone HM48-1 (Armenian Hamster monoclonal)BioLegend103404
RRID:AB_313019		(1:100) FC
AntibodyBiotin anti-mouse CD3ε, Clone 145–2 C11 (Armenian Hamster monoclonal)Biolegend100304
RRID:AB_312669		(1:100) FC
AntibodyBiotin anti-mouse/human CD45R/B220, Clone RA3-6B2 (Rat monoclonal)Biolegend103204
RRID:AB_312989		(1:100) FC
AntibodyBiotin anti-mouse TER-119, Clone TER-119 (Rat monoclonal)Biolegend116204
RRID:AB_313705		(1:100) FC
AntibodyBiotin anti-mouse CD49b (pan-NK cells), Clone DX5 (Rat monoclonal)BioLegend108904
RRID:AB_313411		(1:100) FC
AntibodyBiotin anti-mouse/human CD11b, Clone M1/70 (Rat monoclonal)Biolegend101204
RRID:AB_312787		(1:100) FC
AntibodyBiotin anti-mouse CD11c, Clone N418 (Armenian Hamster monoclonal)Biolegend117303
RRID:AB_313772		(1:100) FC
AntibodyBiotin anti-mouse Ly-6G/Ly-6C (Gr-1), Clone RB6-8C5 (Rat monoclonal)BioLegend108404
RRID:AB_313369		(1:100) FC
AntibodyFITC Mouse IgG1, κ Isotype Ctrl, Clone MOPC-21 (Mouse monoclonal)Biolegend400108
RRID:AB_326429		(1:20) FC
AntibodyPE Mouse IgG2a, κ Isotype Ctrl, Clone MOPC-173 (Mouse monoclonal)Biolegend400213
RRID:AB_2800438		(1:20) FC
AntibodyPERK (D11A8) (Rabbit monoclonal)Cell Signaling5683S
RRID:AB_10841299		(1:200) WB
AntibodyPhospho-PERK (Thr980) (16F8) (Rabbit monoclonal)Cell Signaling3179S
RRID:AB_2095853		(1:100) WB
AntibodyIRE1α (14C10) (Rabbit monoclonal)Cell Signaling3294S
RRID:AB_823545		(1:200) WB
AntibodyeIF2α Antibody (FL-315) (Rabbit polyclonal)Santa Cruzsc-11386
RRID:AB_640075		(1:200) WB
AntibodyPhospho-eIF2α (Ser51) (Rabbit polyclonal)Cell Signaling9721S
RRID:AB_330951		(1:100) WB
AntibodyPhospho-Lck (Tyr505) (Rabbit polyclonal)Cell Signaling2751
RRID:AB_330446		(1:100) WB
AntibodyPhospho-Zap-70 (Tyr319)/Syk (Tyr352) (65E4) (Rabbit monoclonal)Cell Signaling2717
RRID:AB_2218658		(1:100) WB
AntibodyZap-70 (D1C10E) XP (Rabbit monoclonal)Cell Signaling3165
RRID:AB_2218656		(1:200) WB
AntibodyCREB-2 (Rabbit polyclonal)Santa Cruzsc-200
RRID:AB_2058752		(1:200) WB
AntibodyBiP (C50B12) (Rabbit monoclonal)Cell Signaling3177
RRID:AB_2119845		(1:200) WB
AntibodyAnti-SEL1L (ab78298) (Rabbit polyclonal)Abcamab78298
RRID:AB_2285813		(1:200) WB
Antibodyβ-Actin (13E5) (Rabbit monoclonal)Cell Signaling4970S
RRID:AB_2223172		(1:1000) WB
AntibodyAnti-Notch 1 (ab27526) (Rabbit polyclonal)Abcamab27526
RRID:AB_471013		(1:20) ChIP
AntibodyRBPSUH (D10A4) XP (Rabbit monoclonal)Cell Signaling5315
RRID:AB_2665555		(1:50) ChIP
AntibodyNormal Rabbit IgG (Rabbit polyclonal)Cell Signaling2729 s
RRID:AB_1031062		(1:250) ChIP
AntibodyCleaved Caspase-3 (Asp175) (Rabbit polyclonal)Cell Signaling9661
RRID:AB_2341188		(1:50) IHC
Sequence-based reagenthCD2-iCreJackson Laboratory Stock No. 0085205' primerAGATGCCAGGACATCAGGAACCTG
Sequence-based reagenthCD2-iCreJackson Laboratory Stock No. 0085203' primerATCAGCCACACCAGACACAGAGATC
Sequence-based reagentVav1-iCreJackson Laboratory Stock No. 0086105' primerAGATGCCAGGACATCAGGAACCTG
Sequence-based reagentVav1-iCreJackson Laboratory Stock No. 0086103' primerATCAGCCACACCAGACACAGAGATC
Sequence-based reagentSel1l f/fPMID:244532135' primerTTATGTCTGCTTAATTTCTGCTGG
Sequence-based reagentSel1l f/fPMID:185565583' primerTGAATGAGAAATCCAAGTAGTAGG
Sequence-based reagentXbp1 f/fPMID:185565585' primerACTTGCACCAACACTTGCCATTTC
Sequence-based reagentXbp1 f/fPMID:185565583' primerCAAGGTGGTTCACTGCCTGTAATG
Sequence-based reagentPerk f/fJackson Laboratory Stock No. 0230665' primerTTGCACTCTGGCTTTCACTC
Sequence-based reagentPerk f/fJackson Laboratory Stock No. 0230663' primerAGGAGGAAGGTGGAATTTGG
Sequence-based reagentAtf6 f/fJackson Laboratory Stock No. 028253Common ForwardTGCATCTGGGAAGAGAACCA
Sequence-based reagentAtf6 f/fJackson Laboratory Stock No. 028253Wild type ReverseTGCCATGAACTACCATGTCAC
Sequence-based reagentAtf6 f/fJackson Laboratory Stock No. 028253Mutant ReverseAGACTGCCTTGGGAAAAGCG
Sequence-based reagentCD4-iCreJackson Laboratory Stock No. 022071Common ForwardGTT CTT TGT ATA TAT TGA ATG TTA GCC
Sequence-based reagentCD4-iCreJackson Laboratory Stock No. 022071Wild type ReverseTAT GCT CTA AGG ACA AGA ATT GAC A
Sequence-based reagentCD4-iCreJackson Laboratory Stock No. 022071Mutant ReverseCTT TGC AGA GGG CTA ACA GC
Sequence-based reagentOTII transgenicJackson Laboratory Stock No. 004194Transgene ForwardGCT GCT GCA CAG ACC TAC T
Sequence-based reagentOTII transgenicJackson Laboratory Stock No. 004194Transgene ReverseCAG CTC ACC TAA CAC GAG GA
Sequence-based reagentMouse Sel1lthis paper5' primerTGAATCACACCAAAGCCCTG
Sequence-based reagentMouse Sel1lthis paper3' primerGCGTAGAGAAAGCCAAGACC
Sequence-based reagentMouse Xbp1this paper5' primerCTGAGCCCGGAGGAGAAAG
Sequence-based reagentMouse Xbp1this paper3' primerCTTCCAAATCCACCACTTGC
Sequence-based reagentMouse Xbp1sthis paper5' primerCTGAGTCCGCAGCAGGTG
Sequence-based reagentMouse Xbp1sthis paper3' primerTCCAACTTGTCCAGAATGCC
Sequence-based reagentMouse Ddit3(Chop)this paper5' primerGTCCCTAGCTTGGCTGACAGA
Sequence-based reagentMouse Ddit3(Chop)this paper3' primerTGGAGAGCGAGGGCTTTG
Sequence-based reagentMouse Erdj4this paper5' primerCACAAATTAGCCATGAAGTACC
Sequence-based reagentMouse Erdj4this paper3' primerTTTCATACGCTTCTGCAATCTC
Sequence-based reagentMouse Atf4this paper5' primerCCACCATGGCGTATTAGAGG
Sequence-based reagentMouse Atf4this paper3' primerGTCCGTTACAGCAACACTGC
Sequence-based reagentMouse Hrd1this paper5' primerCAAGGTCCTGCTGTACATGG
Sequence-based reagentMouse Hrd1this paper3' primerGTGTTCATGTTGCGGATGGC
Sequence-based reagentMouse Atf6this paper5' primerAGGGAGAGGTGTCTGTTTCG
Sequence-based reagentMouse Atf6this paper3' primerCTGCATCAAAGTGCACATCA
Sequence-based reagentMouse OS9this paper5' primerGGTGTCGGGAGCCTGAATTT
Sequence-based reagentMouse OS9this paper3' primerCCTCTCTTTCACGTTGGAAGTG
Sequence-based reagentMouse Edem1this paper5' primerGGGGCATGTTCGTCTTCGG
Sequence-based reagentMouse Edem1this paper3' primerCGGCAGTAGATGGGGTTGAG
Sequence-based reagentMouse Calreticulinthis paper5' primerCCTGCCATCTATTTCAAAGAGCA
Sequence-based reagentMouse Calreticulinthis paper3' primerGCATCTTGGCTTGTCTGCAA
Sequence-based reagentMouse Hyou1this paper5' primerTGCGCTTCCAGATCAGTCC
Sequence-based reagentMouse Hyou1this paper3' primerGGAGTAGTTCAGAACCATGCC
Sequence-based reagentMouse Canxthis paper5' primerATGGAAGGGAAGTGGTTACTGT
Sequence-based reagentMouse Canxthis paper3' primerGCTTTGTAGGTGACCTTTGGAG
Sequence-based reagentMouse GRP94this paper5' primerTCGTCAGAGCTGATGATGAAGT
Sequence-based reagentMouse GRP94this paper3' primerGCGTTTAACCCATCCAACTGAAT
Sequence-based reagentMouse Hes1this paper5' primerCCAGCCAGTGTCAACACGA
Sequence-based reagentMouse Hes1this paper3' primerAATGCCGGGAGCTATCTTTCT
Sequence-based reagentMouse Deltexthis paper5' primerATCAGTTCCGGCAAGACACAG
Sequence-based reagentMouse Deltexthis paper3' primerCGATGAGAGGTCGAGCCAC
Sequence-based reagentMouse preTCRathis paper5' primerTCACACTGCTGGTAGATGGA
Sequence-based reagentMouse preTCRathis paper3' primerTAGGCTCAGCCACAGTACCT
Sequence-based reagentMouse Notch1this paper5' primerACACTGACCAACAAATGGAGG
Sequence-based reagentMouse Notch1this paper3' primerGTGCTGAGGCAAGGATTGGA
Sequence-based reagentMouse Actinthis paper5' primerTACCACCATGTACCCAGGCA
Sequence-based reagentMouse Actinthis paper3' primerCTCAGGAGGAGCAATGATCTTGAT
Sequence-based reagentVβ5 Forwardthis paper5' primer5' CCCAGCAGATTCTCAGTCCAACAG 3'
Sequence-based reagentVβ8 Forwardthis paper3' primer5' GCATGGGCTGAGGCTGATCCATTA 3'
Sequence-based reagentVβ11 Forwardthis paper5' primer5' TGCTGGTGTCATCCAAACACCTAG 3'
Sequence-based reagentJβ2 Reversethis paper3' primer5' TGAGAGCTGTCTCCTACTATCGATT 3'
Sequence-based reagenteF-la Forwardthis paper5' primer5'CTGCTGAGATGGGAAAGGGCT-3'
Sequence-based reagenteF-la Reversethis paper3' primer5' TTCAGGATAATCACCTGAGCA 3'
Sequence-based reagentSel1l promoter reporter wildtypethis paper5' primerTAGCACGCGTGGGAAATGACAAGCGGCATTGTCTTGTAC
Sequence-based reagentSel1l promoter reporter wildtypethis paper3' primerATGCCTCGAGCCTGCTCTCGAAGGTCGAGAGCC
Sequence-based reagentSel1l promoter reporter mutated left_armthis paper5' primerCAGTTCAGGTATAGCTTATGGATCCGCGTTCATATCATGTCCAGTTCAAGGGATCCAAATAATTAAAAAGAAATACTTAGC
Sequence-based reagentSel1l promoter reporter mutated left_armthis paper3' primerGCTAAGTATTTCTTTTTAATTATTTGGATCCCTTGAACTGGACATGATATGAACGCGGATCCATAAGCTATACCTGAACTG
Sequence-based reagentSel1l promoter reporter mutated right-armthis paper5' primerTCTGGGCCAGGGAGGCCGTAAGGGGGGCGAAGAAGGAACC
Sequence-based reagentSel1l promoter reporter mutated right-armthis paper3' primerTCTGGGCCAGGGAGGCCGTAAGGGGGGCGAAGAAGGAACC
Sequence-based reagentHrd1 promoter reporter wildtypethis paper5' primerTAGCACGCGTGTGACCCCTGTGTAACGGTTTGATTCC
Sequence-based reagentHrd1 promoter reporter wildtypethis paper3' primerATGCAAGCTTGAAAACAGATATAGGTCTTCC
Sequence-based reagentHrd1 promoter reporter mutated left armthis paper5' primerCCCCGGCCTATGGACTGCGCTGCATACGCTGGCATCCAGCTGCCTTGGCA
Sequence-based reagentHrd1 promoter reporter mutated left armthis paper3' primerTGCCAAGGCAGCTGGATGCCAGCGTATGCAGCGCAGTCCATAGGCCGGGG
Sequence-based reagentHrd1 promoter reporter mutated middle armthis paper5' primerCCAGAAATTTTTCCTTTCTTGCATACTTGGTCCGCGTAACTTT
Sequence-based reagentHrd1 promoter reporter mutated middle armthis paper3' primerAAAGTTACGCGGACCAAGTATGCAAGAAAGGAAAAATTTCTGG
Sequence-based reagentHrd1 promoter reporter mutated right armthis paper5' primerTAGCACGCGTGTGACCCCTGTGTAACGGTTTGATTCC
Sequence-based reagentHrd1 promoter reporter mutated right armthis paper3' primerATGCAAGCTTGAAAACAGATATAGGTCCCTTACGGTTACCTCCCCCCAAC
Sequence-based reagentChIP-qPCR, Sel1l promoter P1this paper5' primerTTCAGTTCAGGTATAGCTTATTTCTCAGCG
Sequence-based reagentChIP-qPCR, Sel1l promoter P1this paper3' primerCGGTTAAGAACTTGCAAGGTTGCTAAG
Sequence-based reagentChIP-qPCR, Sel1l promoter P2this paper5' primerCCTTATGCCCTCAGCCACCTGCGGC
Sequence-based reagentChIP-qPCR, Sel1l promoter P2this paper3' primerGGGAACCCTCATCCAGGACTAC
Sequence-based reagentChIP-qPCR, Sel1l promoter P3this paper5' primerCGCTTAACAAGACAGCTGTTGGG
Sequence-based reagentChIP-qPCR, Sel1l promoter P3this paper3' primerTCTGGGGATTCAAATAACCATCTGGG
Sequence-based reagentChIP-qPCR, Hrd1 promoter P1this paper5' primerGCTAGTTATGAATTGTAAGTAAACGTCTG
Sequence-based reagentChIP-qPCR, Hrd1 promoter P1this paper3' primerCTGATTCTAGACGACTTTAAGGCAG
Sequence-based reagentChIP-qPCR, Hrd1 promoter P2this paper5' primerAACCAATCGGCGGTAGCCACGG
Sequence-based reagentChIP-qPCR, Hrd1 promoter P2this paper3' primerGGATAGCTACGACACGGTAAGAAG
Sequence-based reagentChIP-qPCR, Hrd1 promoter P3this paper5' primerTGCCCAGGTTTCACAGTGCAGC
Sequence-based reagentChIP-qPCR, Hrd1 promoter P3this paper3' primerACCGAGACGCAGGAGAACACC
Sequence-based reagentChIP-qPCR, Os9 promoter P1this paper5' primerGCTAGAGATGTCCCTTCCGC
Sequence-based reagentChIP-qPCR, Os9 promoter P1this paper3' primerCAGCCAATGAAAGCTTGGGG
Sequence-based reagentChIP-qPCR, Os9 promoter P2this paper5' primerGGAGGATAGCCGTGCTTTGA
Sequence-based reagentChIP-qPCR, Os9 promoter P2this paper3' primerATCATAGCTAAGGAGTGAGAATGAG
Sequence-based reagentChIP-qPCR, Edem1 promoter P1this paper5' primerCTACTCCATACCTGGACGGG
Sequence-based reagentChIP-qPCR, Edem1 promoter P1this paper3' primerGCCCTAGCCCGGGTAAATG
Sequence-based reagentChIP-qPCR, Edem1 promoter P2this paper5' primerCCCTGGTGAGTTGCTGATGT
Sequence-based reagentChIP-qPCR, Edem1 promoter P2this paper3' primerTGCTGTGAGTGTGTATGCGT
Sequence-based reagentMouse Xbp1 splicingPMID:294808185' primerACACGCTTGGGAATGGACAC
Sequence-based reagentMouse Xbp1 splicingPMID:294808183' primerCCATGGGAAGATGTTCTGGG
Sequence-based reagentMouse ActinPMID:294808185' primerTACCACCATGTACCCAGGCA
Sequence-based reagentMouse ActinPMID:294808183' primerCTCAGGAGGAGCAATGATCTTGAT
peptide, recombinant proteinRecombinant Murine Flt3-Ligand, 2 ug250–31Lpeprotech
peptide, recombinant proteinRecombinant Murine IL7, 2 ug217–17peprotech
peptide, recombinant proteinRecombinant Mouse DLL4776702Biolegend
commercial assay or kitHigh-Capacity cDNA Reverse Transcription Kit4368813Thermo Fisher
commercial assay or kitPower SYBR Green PCR Master MixA25778Thermo Fisher
commercial assay or kitIn Situ Cell Death Detection Kit, Fluorescein11684795910Roche
commercial assay or kitFITC BrdU Flow Kit559619BD Bioscience
commercial assay or kiteBioscience Foxp3 / Transcription Factor Staining Buffer Set00-5523-00Thermo Fisher
commercial assay or kitER-Tracker Green (BODIPY FL Glibenclamide), for live-cell imagingE34251Thermo Fisher
commercial assay or kitProteoStat (R) Aggresome detect KitENZ-51035-K100ENZO
commercial assay or kitClick-iT Plus OPP Alexa Fluor 647 Protein Synthesis Assay KitC10458Thermo Fisher
commercial assay or kitGenomic DNA Mini KitK182002Thermo Fisher
commercial assay or kitTruseq Stranded mRNA Kit# 20020594Illumina
Chemical compound, drugDAPTHY-13027MedChemExpress
Chemical compound, drugISRIB (trans-isomer)HY-12495MedChemExpress
Chemical compound, drugTunicamycin76102–666VWR
Chemical compound, drugTetraphenylethene maleimide (TMI)PMID:31914399Custom Synthesized
Software, algorithmSTARVersion 2.5.2b
Software, algorithmDESeq2R 3.6.1Version 1.26.0
Software, algorithmfgseaR 3.6.1Version 1.11.2
Software, algorithmpheatmapR 3.6.1Version 1.0.12
Software, algorithmEnrichrhttps://maayanlab.cloud/Enrichr/
Software, algorithmGraphpad Prism 8.4Graphpad (graphpad.com)RRID:SCR_002798
Software, algorithmFijihttp://imagej.net/FijiRRID:SCR_003070
Software, algorithmFlowJo 10Tree StarRRID:SCR_008520
Software, algorithmBiorenderhttps://biorender.com/Biorender was utilized to make the schematic diagrams used in this study.
OtherLD Columns130-042-901Miltenyi Biotec
OtherCD4 (L3T4) MicroBeads, mouse 1 x 2 mL130-117-043Miltenyi Biotec
OtherCD8a (Ly-2) MicroBeads, mouse130-117-044Miltenyi Biotec
OtherDAPI (4',6-Diamidino-2-Phenylindole, Dihydrochloride)D1306Thermo Fisher
OtherPrecision Count Beads424902Biolegend
OtherRBC Lysis Buffer (10X)420301Biolegend
OtherLiquid DAB+K3468Dako

Additional files

Transparent reporting form
https://cdn.elifesciences.org/articles/69975/elife-69975-transrepform-v2.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Xia Liu
  2. Jingjing Yu
  3. Longyong Xu
  4. Katharine Umphred-Wilson
  5. Fanglue Peng
  6. Yao Ding
  7. Brendan M Barton
  8. Xiangdong Lv
  9. Michael Y Zhao
  10. Shengyi Sun
  11. Yuning Hong
  12. Ling Qi
  13. Stanley Adoro
  14. Xi Chen
(2021)
Notch-induced endoplasmic reticulum-associated degradation governs mouse thymocyte β−selection
eLife 10:e69975.
https://doi.org/10.7554/eLife.69975