1. Biochemistry and Chemical Biology
  2. Cancer Biology

Elevated FBXO45 promotes liver tumorigenesis through enhancing IGF2BP1 ubiquitination and subsequent PLK1 upregulation

  1. Xiao-Tong Lin
  2. Hong-Qiang Yu
  3. Lei Fang
  4. Ye Tan
  5. Ze-Yu Liu
  6. Di Wu
  7. Jie Zhang
  8. Hao-Jun Xiong
  9. Chuan-Ming Xie  Is a corresponding author
  1. Key Laboratory of Hepatobiliary and Pancreatic Surgery, Institute of Hepatobiliary Surgery, Southwest Hospital, Third Military Medical University (Army Medical University), China
https://doi.org/10.7554/eLife.70715
Share this article
Cite this article
  1. Xiao-Tong Lin
  2. Hong-Qiang Yu
  3. Lei Fang
  4. Ye Tan
  5. Ze-Yu Liu
  6. Di Wu
  7. Jie Zhang
  8. Hao-Jun Xiong
  9. Chuan-Ming Xie
(2021)
Elevated FBXO45 promotes liver tumorigenesis through enhancing IGF2BP1 ubiquitination and subsequent PLK1 upregulation
eLife 10:e70715.
https://doi.org/10.7554/eLife.70715
  2. Download BibTeX
  3. Download .RIS
11 figures, 4 tables and 6 additional files

Figures

Figure 1 with 1 supplement
Download asset Open asset
FBXO45 is associated with poor survival in HCC patients.

(A, B) Tissue sections of HCC and matched adjacent tissues from patients were subjected to HE staining, Sirius red staining, or IHC staining for ɑ-SMA and FBXO45. Representative images are shown (A).…

Figure 1—source data 1

Clinical and pathological data from HCC patient.

HCC, hepatocellular carcinoma.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig1-data1-v2.xlsx
Figure 1—source data 2

FBXO45 is associated with poor survival in HCC patients.

HCC, hepatocellular carcinoma.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig1-data2-v2.xls
Figure 1—figure supplement 1
Download asset Open asset
FBXO45 mRNA level is associated with poor survival in HCC patients.

(A) The FBXO45 mRNA level was elevated in liver tumors. Data are from the studies by Chen et al., 2002; Wurmbach et al., 2007. (B–D) Data for a total of 253 patients with HCC were downloaded from …

Figure 2 with 1 supplement
Download asset Open asset
FBXO45 promotes hepatocarcinogenesis in mice.

(A–C) FBXO45-OE (n=11) and wild-type (n=20) male mice were injected with DEN at the age of 2 weeks, followed by 14 injections of CCl4; the mice were sacrificed at 24 weeks of age. Representative …

Figure 2—source data 1

FBXO45 promotes hepatocarcinogenesis in mice.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig2-data1-v2.xls
Figure 2—figure supplement 1
Download asset Open asset
FBXO45 silencing inhibits the proliferation of HCC cells.

(A–C) The detection of the FBXO45 expression in FBXO45-OE and wild-type mice by PCR genotyping in liver (A) and Western blot analysis in different tissues (B, C). (D) Comparison of the proliferation …

Figure 2—figure supplement 1—source data 1

FBXO45 silencing inhibits the proliferation of HCC cells.

HCC, hepatocellular carcinoma.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig2-figsupp1-data1-v2.xls
Figure 3 with 2 supplements
Download asset Open asset
FBXO45 promotes polyubiquitination at the Lys190 and Lys450 sites and subsequent activation of IGF2BP1.

(A) The Venn diagram shows the number of proteins with upregulated ubiquitin sites identified in response to FBXO45 overexpression (blue), FBXO45 interaction candidates identified by Co-IP and mass …

Figure 3—source data 1

Ubiquitinated proteins and interacted proteins with FBXO45.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig3-data1-v2.xls
Figure 3—source data 2

FBXO45 promotes polyubiquitination at the Lys190 and Lys450 sites and subsequent activation of IGF2BP1.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig3-data2-v2.xls
Figure 3—figure supplement 1
Download asset Open asset
Two sites K190 and K450 in IGF2BP1 are conserved.

(A) HepG2 and HCCLM3 cells were transfected with Flag-FBXO45 or Flag-FBXO45ΔF (FBXO45 without F-box domain) for 48 hr, followed by immunoprecipitation with anti-Flag antibody and Western blot …

Figure 3—figure supplement 2
Download asset Open asset
FBXO45 promotes IGF2BP1 polyubiquitination via PAM.

(A) FBXO45 mediated IGF2BP1 ubiquitination requires PAM. HCCLM3 cells were transfected with the indicated plasmids or siRNA targeting PAM for 72 hr, followed by pull-down using Ni-NTA beads or …

Figure 4 with 1 supplement
Download asset Open asset
FBXO45 promotes cell proliferation via IGF2BP1-PLK1 axis.

(A, B) HCCLM3 and HepG2 cells were transfected with siControl or siRNA targeting IGF2BP1 (siIGF2BP1) for 48 h. A portion of cells were reseeded into 96-well plates and cell proliferation analyzed by …

Figure 4—source data 1

FBXO45 promotes cell proliferation via IGF2BP1-PLK1 axis.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig4-data1-v2.xls
Figure 4—figure supplement 1
Download asset Open asset
IGF2BP1binds and stabilizes PLK1 mRNA.

(A) The RIP-PCR products gotten by anti-normal IgG or anti-IGF2BP1 lgG pull-down were detected by RT-PCR. IGF2BP1 interacted with PLK1 mRNA. (B) HCCLM3 and HepG2 cells were transfected with shVector …

Figure 4—figure supplement 1—source data 1

IGF2BP1binds and stabilizes PLK1 mRNA.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig4-figsupp1-data1-v2.xls
Figure 5
Download asset Open asset
Interfering IGF2BP1 protects against FBXO45-mediated hepatocarcinogenesis.

(A–E) FBXO45-OE male mice were injected with AAV9-shIGF2BP1-ZsGreen(TBG) (5×1010 gene copies per mouse, i.p.) (n=6) or AAV9-ZsGreen(TBG) (n=7) at the age of 10 days, followed by injection of DEN (25 …

Figure 5—source data 1

Interfering IGF2BP1 protects against FBXO45-mediated hepatocarcinogenesis.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig5-data1-v2.xls
Figure 6
Download asset Open asset
Inhibiting PLK1 blocks FBXO45-mediated the growth of HCC xenograft tumors in mice.

(A–D) A total of 4×106 HCCLM3-FBXO45 cells were injected subcutaneously into right flank sides of nude mice. When the tumors reached a size of 80–120 mm3, the mice were received i.p. injection of …

Figure 6—source data 1

Inhibiting PLK1 blocks FBXO45-mediated the growth of HCC xenograft tumors in mice.

HCC, hepatocellular carcinoma.

https://cdn.elifesciences.org/articles/70715/elife-70715-fig6-data1-v2.xls
Figure 7 with 1 supplement
Download asset Open asset
Correlation between the FBXO45, IGF2BP1, and PLK1 levels in HCC tissues.

(A) The expression of IGF2BP1 in HCC tissue samples was determined by staining with an anti-IGF2BP1 antibody. Scale bar, 50 μm. (B) The association between IGF2BP1 or PLK1 protein expression and …

Figure 7—figure supplement 1
Download asset Open asset
Relationships between the high or low expression of both FBXO45/IGF2BP1/PLK1 and clinicopathologic characteristics in HCC patients.

(A) The association between the high or low expression of FBXO45/IGF2BP1/PLK1 protein and survival time in HCC patients was evaluated. (B–D) The relationships between the FBXO45/IGF2BP1/PLK1 protein …

Author response image 1
Download asset Open asset
Author response image 2
Download asset Open asset
Expression level of FBXO45 at mRNA in various cancers and liver cancer cell lines (DepMap data).
Author response image 3
Download asset Open asset
The gene effect of FBXO45 on cell proliferation in various cancers and liver cancer cell lines (DepMap data).
Author response image 4
Download asset Open asset

Tables

Table 1
Relationships between the FBXO45 protein and clinicopathologic characteristics in 105 HCC patients.
VariablesCasesFBXO45FBXO45P value
High levelLow level
Age(years)0.582
≤55764036
>55291712
Gender0.864
Female1697
Male894841
TNM stage0.004**
I351223
II–IV704525
Histologic grade0.001**
G1G2874146
G318162
Tumor size0.239
≤5 cm231013
>5 cm824735
Recurrence0.631
Present241212
Absent814536
Metastasis0.098
Present533320
Absent522428

  1. Calculated using the x2 test.

  2. **p≤0.01 were considered statistically significant.

Table 2
Primers used for qRT-PCR.
Gene symbolPrimer forwardPrimer reverse
HumanIGF2BP1CTCCTTTATGCAGGCTCCCGGGGTCTCCAGCTTCACTTCC
 PLK1CGAGTTCTTTACTTCTGGCTTATTGAGGACTGTGAGGGGC
 MKI67CTTCGCTCTTACTCCCCTGCGACTGAGACCACAGGACTGC
 FOXK1CCAAGGATGAGTCAAAGCCGGTTCAAAGAGAGGTTGTGCC
 PDLIM7CTCACAGGCACCGAGTTCATCACTGTGCTCGTTTTGTCCG
 PEG10GCCTAGAAATGGGCCGTTGTCGTTCTTGTCGTTGGTGAAC
MouseActa2CCGCCATGTATGTGGCTATTCAGTTGTACGTCCAGAGGCATA
 Timp1CTCGGACCTGGATGCTAAAAACTCTTCACTGCGGTTCTGG
 Col1a1TAAGGGTCCCCAATGGTGAGAGGGTCCCTCGACTCCTACAT
 Col1a2CCAGCGAAGAACTCATACAGCGGACACCCCTTCTACGTTGT
 PdgfbGGTGAGCAAGGTTGTAATGGGGAGGCAATGGACAGACAA
 PdgfrbTCCCACATTCCTTGCCCTTCGCACAGGGTCCACGTAGATG
 Mki67AAAGGCGAAGTGGAGCTTCTTTTCGCAACTTTCGTTTGTG
 PcnaAAAGATGCCGTCGGGTGAATCCATTGCCAAGCTCTCCACT
 Ccnb1AGCGAAGAGCTACAGGCAAGCTCAGGCTCAGCAAGTTCCA
 Ccnb2CCGACGGTGTCCAGTGATTTAGGTTTCTTCGCCACCTGAG
 TnfaCAAGATGCTGGGACAGTGACAGGGAAGAATCTGGAAAGGT
 Ccl2AAAAACCTGGATCGGAACCAACGGGTCAACTTCACATTCAAAG
 Il6GAGCCCACCAAGAACGATAGTCATTTCCACGATTTCCCAG
 Il1bGCTTCAGGCAGGCAGTATCAGACAGCACGAGGCTTTTTTG
 Fbxo45GCTGGGAAGTGACGACCAGAGAGCCAGAAGTCAGATGCTCAAGG
Table 3
RNA interference.
Gene symbolForwardReverse
HumanFBXO45 1#CCAGGAAUGUCUACAUUAAdTdTUUAAUGUAGACAUUCCUGGdTdT
 FBXO45 2#CCAGCAGUUUCUGCUGUAUdTdTAUACAGCAGAAACUGCUGGdTdT
 FBXO45 3#CAGAUAGGAGAAAGAAUUCGAUCGAAUUCUUUCUCCUAUCUG
 IGF2BP1 2#CCACCAGUUGGAGAACCAUdTdTAUGGUUCUCCAACUGGUGGdTdT
 IGF2BP1 4#CCGGGAGCAGACCAGGCAAdTdTUUGCCUGGUCUGCUCCCGGdTdT
 MYCBP2 #1CCCGAGAUCUUGGGAAUAATTUUAUUCCCAAGAUCUCGGGTT
 No-targeting controlUUCUCCGAACGUGUCACGUTTACGUGACACGUUCGGAGAATT
MouseshIGF2BP15′-GATCCGCCGGGAGCAGACCAGGCAATTCAAGAGATTGCCTGGTCTGCTCCCGGTTTTTTACGCGTG-3′
Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
genetic reagent (M. musculus)FBXO45-OECyagen Biosciences Inc.Fbxo45 knockin at the locus of ROSA26 in C57BL/6 mice
genetic reagent (M. musculus)BALB/c athymic nude miceArmy Medical UniversityAged 6 weeks
cell line (Homo-sapiens)Dermal fibroblast (normal, Adult)ATCCPCS-201–012
cell line (Homo-sapiens)HepG2 (HCC,15-year-old Male)ATCCATCC:HB-8065;RRID:CVCL_0027
cell line (Homo-sapiens)Huh7 (HCC, Adult male)Fudan Cell BankCSTR:19375.09.3101HUMTCHu182;RRID:CVCL_0336
cell line (Homo-sapiens)HCCLM3BeiNa Culture CollectionBNCC-342335;RRID:CVCL_6832
biological sample (Macaca fascicularis)Primary simian hepatocytesSingHealth, SingaporeFreshly isolated from Macaca fascicularis
antibodyanti-IGF2BP1 (Rabbit Monoclonal)Cell SignalingCat. #: 8,482 S;RRID:AB_11179079WB (1:1000)IP (1:150)
antibodyanti-IGF2BP1 (Rabbit Polyclonal)ProteintechCat. #: 22803–1-AP;RRID:AB_2879173IHC (1:200)
antibodyanti-PLK1 (Rabbit Monoclonal)Cell SignalingCat. #: 4,513 S;RRID:AB_2167409WB (1:1000)
antibodyanti-PLK1 (Mouse Monoclonal)BosterCat. #: M00182IHC (1:300)
antibodyanti-Cullin-1 (Rabbit Polyclonal)Cell SignalingCat. #: 4,995 S;RRID:AB_2261133WB (1:1000)
antibodyanti-FBXO45 (Rabbit Polyclonal)AbcamCat. #:ab136614;WB (1:1000)
antibodyanti-FBXO45 (Rabbit Polyclonal)BiossCat. #:bs-13150R;IHC (1:300)
antibodyanti-α-SMA (Rabbit Polyclonal)AbcamCat. #:ab5694;RRID:AB_2223021IHC (1:1600)
antibodyanti-SKP1 (Rabbit Polyclonal)ProteintechCat. #: 10990–2-AP;RRID:AB_2187492WB (1:1000)
antibodyanti-GAPDH (Rabbit Polyclonal)ProteintechCat. #: 10494–1-AP;RRID:AB_2263076WB (1:5000)
antibodyanti-HA (Rat Monoclonal)RocheCat. #: 11867423001;RRID:AB_390918WB (1:1000)
antibodyanti-N-cadherin (Mouse Monoclonal)Cell SignalingCat. #: 14,215 S;RRID:AB_2798427WB (1:1000)
antibodyanti-Flag (Mouse Monoclonal)Sigma-BaldricCat. #: F1804;RRID:AB_262044WB (1:1000)IF (1:200)
antibodyanti-CCNB2 (Rabbit Polyclonal)ProteintechCat. #: 21644–1-AP;RRID:AB_10755304IHC (1:300)
antibodyGoat anti-mouse IgG HRPCell SignalingCat. #: 7,076 S;RRID:AB_330924WB (1:5000)
antibodyGoat anti-rabbit IgG HRPCell SignalingCat. #: 7,074 S;RRID:AB_2099233WB (1:5000)
antibodyGoat anti-rat IgG HRPCell SignalingCat. #: 7,077 S;RRID:AB_10694715WB (1:5000)
antibodyanti-Ki67 (Mouse Monoclonal)MilliporeCat#: FCMAB103AP;RRID:AB_10561769WB (1:1000)IHC (1:800)
antibodyMouse IgG1 Isotype ControlCell SignalingCat. #:5,415 S;RRID:AB_10829607
antibodyRabbit IgG Isotype ControlCell SignalingCat. #:3,900 S;RRID:AB_1550038
recombinant DNA reagentpcDNA3.1-FBXO45-3xFLAGThis paperGenBank_ID:NM_001105573
recombinant DNA reagentpcDNA3.1-FBXO45ΔF-3xFLAGThis paperGenBank_ID:NM_001105573(del39-82aa)
recombinant DNA reagentpcDNA3.1-IGF2BP1-HAThis paperGenBank_ID:NM_006546
recombinant DNA reagentAAV9-shIGF2BP1-ZsGreen-TBGHanheng Biosciences
recombinant DNA reagentpLV[EXP]-EGFP-Puro-FBXO45-3xFLAGThis paper
recombinant DNA reagentLV-U6-shIGF2BP1-mCherry-PuroThis paper
commercial assay or kitMagna RIP RNA-Binding Protein Immunoprecipitation KitMilliporeCat #:17–700
commercial assay or kitPrimeScript RT reagent Kit with gDNA EraserTakaraCat #: RR047
commercial assay or kitTB Green Premix Ex Taq IITakaraCat #: RR820
commercial assay or kitQuikChange Lightning Site-Directed Mutagenesis KitAgilentCat #：210,519
chemical compound, drugDNase IRocheCat. #:10104159001
chemical compound, drugCollagenaseInvitrogenCat. #:17104019
chemical compound, drugDENSigma-AldrichCat. #: N075625 mg/kg
chemical compound, drugActinomycin DSigma-AldrichCat. #: SBR0001310 µg/mL
chemical compound, drugMG-132, proteasome inhibitorSelleckCat. #: S261910 μM
chemical compound, drugVolasertibSelleckCat. #: S2235
chemical compound, drugRigosertibSelleckCat. #: S1362
chemical compound, drugProtein A/G PLUS-AgaroseSanta CruzCat. #: sc-2003;RRID:AB_10201400
Software, algorithmGraphpad PrismGraphpadRRID:SCR_002798
Software, algorithmIBM SPSS StatisticsIBMRRID:SCR_019096

Additional files

Supplementary file 1

Univariate and multivariate analyses indicating associations between overall survival and various risk factors in 105 HCC patients.

https://cdn.elifesciences.org/articles/70715/elife-70715-supp1-v2.docx
Supplementary file 2

Relationships between FBXO45 mRNA expression and clinicopathologic characteristics in 253 HCC patients.

https://cdn.elifesciences.org/articles/70715/elife-70715-supp2-v2.docx
Supplementary file 3

Univariate and multivariate analyses indicating the associations between overall survival and various risk factors in 253 HCC patients.

https://cdn.elifesciences.org/articles/70715/elife-70715-supp3-v2.docx
Supplementary file 4

FBXO45-interacting proteins identified by Co IP-MS.

https://cdn.elifesciences.org/articles/70715/elife-70715-supp4-v2.docx
Supplementary file 5

Relationships between the IGF2BP1 protein and clinicopathological characteristics in 105 HCC patients.

https://cdn.elifesciences.org/articles/70715/elife-70715-supp5-v2.docx
Transparent reporting form
https://cdn.elifesciences.org/articles/70715/elife-70715-transrepform1-v2.docx

Download links