Control of Arabidopsis shoot stem cell homeostasis by two antagonistic CLE peptide signalling pathways
- Institute for Developmental Genetics and Cluster of Excellence on Plant Sciences, Heinrich Heine University, Germany
Figures
Figure 1 with 3 supplements
CLV3 and CLE40 exert opposite effects on meristem size.
(A) The amino acid (AA) sequences of the mature CLV3 and CLE40 peptides differ in four AAs (differences marked in red). (B) Col-0 inflorescence at 6 weeks after germination (WAG) with flowers. (B´) …
Figure 1—figure supplement 1
Mutants from the CLV pathway show differences in their leaf lengths.
(A) Wild-type (Col-0) and different single and double mutants (clv3-9, cle40-2, clv1-101, clv1-101;cle40-2, bam1-3, bam1-3;cle40-2, bam1-3;clv1-101) at 4 weeks after germination (WAG). (B) Leaf …
Figure 1—figure supplement 2
cle40 mutants have smaller meristems.
(A) Wild-type A. thaliana plants (Col-0) and cle40 mutants (cle40-2, cle40-cr1, cle40-cr2, cle40-cr3) at 6 weeks after germination (WAG). All plants show a similar height ranging from 17.5 cm to …
Figure 1—figure supplement 3
Siliques of various mutants differ in their carpel number.
(A) Carpels of Arabidopsis thaliana plants at 6 weeks after germination (WAG) in wild-type (Col-0) or different mutant backgrounds: clv3-9, cle40-2, clv1-20, clv1-20;cle40-2, bam1-3, bam1-3;cle40-2, …
Figure 2 with 2 supplements
CLE40 and CLV3 show complementary expression patterns in the inflorescence meristem (IFM).
(A) Maximum intensity projection (MIP) of an inflorescence at 5 weeks after germination (WAG) expressing the transcriptional reporter CLE40:Venus-H2B//Col-0 showing CLE40 expression in the IFM, …
Figure 2—figure supplement 1
CLE40 transcriptional and translational reporter lines display same expression patterns.
(A) The CLE40:Venus-H2B reporter line shows expression in the columella cells (CC) of the distal root meristem (DRM) and in the stele of main root at 5 days after germination (DAG). (B) The …
Figure 2—figure supplement 2
CLE40 and CLV3 expression in multiple inflorescence meristem (IFM).
(A–E) Maximum intensity projections (MIPs) of four independent T1 lines of IFMs at 5 weeks after germination (WAG) expressing the transcriptional reporter CLE40:Venus-H2B//Col-0 showing CLE40 …
Figure 3 with 2 supplements
WUS-dependent repression of CLE40 expression in the shoot meristem.
(A) Maximum intensity projection (MIP) of CLE40 expression (CLE40:Venus-H2B//Col-0) at 5 weeks after germination (WAG), (A’) Longitudinal optical section through the centre of the inflorescence …
Figure 3—figure supplement 1
CLE40 expression is lacking in the central zone (CZ) and organizing centre (OC).
(A) Maximum intensity projection (MIP) of CLV3 and WUS expression (CLV3:NLS-mCherry;WUS:NLS-GFP//clv3-9) in a clv3-9 mutant inflorescence meristem (IFM) (N = 5). CLV3 expression is detected at the …
Figure 3—figure supplement 2
CLE40 expression is extended in wus-7 mutants.
(A) Landsberg erecta (L.er.) wild-type plant at 5 weeks after germination (WAG) shows normal plant growth, while wus-7 mutants at 5 WAG are delayed in their development (dashed white line). (B) wus-7…
Figure 4 with 3 supplements
CLV1 is expressed in the organizing centre (OC) and cells of incipient organ primordia.
(A) Maximum intensity projection (MIP) of CLV1 under its endogenous promoter (CLV1:CLV1-GFP//Col-0) at 5 weeks after germination (WAG) shows CLV1 expression in the OC of the meristems, inflorescence …
Figure 4—figure supplement 1
The translational CLV1:CLV1-GFP reporter line rescues the carpel and shoot phenotype of clv1-101 mutants.
(A) Column bar plot shows the average carpel number of Col-0 (N = 260), clv1-101 (N = 320) and clv1-101 carrying the construct CLV1:CLV1-GFP (N = 360) at 5 weeks after germination (WAG). For each …
Figure 4—figure supplement 2
Two independent translational CLV1 reporter lines show exactly the same expression pattern.
(A) Maximum intensity projection (MIP) of the translational CLV1 (CLV1:CLV1-GFP//Col-0) reporter line used in this study at 5 weeks after germination (WAG) shows CLV1 expression in the organizing …
Figure 4—figure supplement 3
CLV1 expression in multiple inflorescence meristem (IFMs).
(A–H) Maximum intensity projection (MIP) of six different IFMs at 5 weeks after germination (WAG) expressing the translational reporter CLV1:CLV1-GFP//Col-0 showing CLV1 expression in the centre of …
Figure 5 with 6 supplements
BAM1 expression is elevated in the flanks of the inflorescence meristem (IFM) and not detectable in the organizing centre (OC).
(A) Maximum intensity projection (MIP) of BAM1 under its endogenous promoter (BAM1:BAM1-GFP//bam1-3) at 5 weeks after germination (WAG). BAM1 expression is detected nearly throughout the entire …
Figure 5—figure supplement 1
The translational BAM1:BAM1-GFP reporter line rescues the shoot phenotype of the double mutant bam1-3;clv1-20.
(A) Inflorescences (IFs) of bam1-3, clv1-20 at bam1-3;clv1-20 at 5 weeks after germination (WAG). The IF of clv1-20 mutants is enlarged compared to bam1-3 mutants. IFs of bam1-3;clv1-20 have a …
Figure 5—figure supplement 2
The translational BAM1 reporter line shows similar expression in three independent T1 lines.
(A–C) Maximum intensity projections (MIPs) of three independent T1 lines of inflorescence meristems (IFMs) at 5 weeks after germination (WAG) expressing the translational reporter BAM1:BAM1-GFP//bam1…
Figure 5—figure supplement 3
Expression of the translational BAM1 reporter (BAM1:BAM1-GFP) shifts from the PZ in bam1-3 mutants to the organizing centre (OC) and L1 in bam1-3;clv1-20 double mutants.
(A–E) Maximum intensity projection (MIP) of five different inflorescence meristems (IFMs) at 5 weeks after germination (WAG) expressing the translational reporter BAM1:BAM1-GFP//bam1-3 showing BAM1 …
Figure 5—figure supplement 4
Quantification of expression pattern of the translational BAM1 reporter line in bam1-3 (N = 9) and bam1-3;clv1-20 (N = 9) mutants.
(A) Optical XZ section through the centre of an inflorescence meristem (IFM) carrying the BAM1:BAM1-GFP//bam1-3 construct. BAM1 expression is elevated in the peripheral zone (PZ), downregulated in …
Figure 5—figure supplement 5
BAM1 and CLV1 are receptors for CLE40 and CLV3, respectively.
(A, A’) Longitudinal and cross-sections of CLE40 (CLE40:Venus-H2B//Col-0) through the inflorescence meristem (IFM) show CLE40 expression in the peripheral zone (PZ) while no CLE40 expression is …
Figure 5—figure supplement 6
Expression patterns of CLE40 and BAM1 overlap in the inflorescence meristem (IFM).
Longitudinal sections through an IFM and its developing primordia P1–P6 expressing either (A) CLE40 (CLE40:Venus-H2B) (N = 23) or (B) BAM1 (BAM1:BAM1-GFP) (N = 15). In the IFM, CLE40 and BAM1 …
Figure 6 with 1 supplement
Inflorescence meristem (IFM) size of single and double mutants.
XZ sections through the centre of IFMs of (A) Col-0, (B) cle40-2, (C) clv3-9, (D) bam1-3;clv1-101, (E) clv1-101, (F) clv1-101;cle40-2, (G) bam1-3 and (H) bam1-3;cle40-2 plants. (I) Box and whisker …
Figure 6—figure supplement 1
bam1-3 and bam1-3;clv1-101 mutants are resistant to CLE40 peptide treatment.
Root length of Col-0, bam1-3;clv1-101, bam1-3, and clv1-101 plants grown on ½ Murashige & Skoog (MS) media containing no CLE40 peptide, 10 nM, 20 nM, 40 nM or 200 nM CLE40 peptide were measured at …
Figure 7 with 3 supplements
CLE40 and BAM1 promote WUS expression.
(A–E’) Maximum intensity projection (MIP) and longitudinal optical section of inflorescences at 5 weeks after germination (WAG) expressing the transcriptional reporter WUS:NLS-GFP in a (A, A’) Col-0,…
Figure 7—figure supplement 1
Number of WUS-expressing cells in the inflorescence meristem (IFM) of various mutant backgrounds detected with Imaris software.
(A–E) Spot detection of WUS-expressing cells in the IFMs of (A) Col-0, (B) cle40-2, (C) bam1-3, (D) clv1-101 and (E) clv3-9 mutants via Imaris software. (F) Box and whisker plot shows the number of W…
Figure 7—figure supplement 2
Number of WUS-expressing cells in a longitudinal section through the meristem in multiple inflorescence meristems (IFMs).
(A–U) Longitudinal optical sections through the IFM of 3–5 (A–E) Col-0, (F–J) cle40-2, (K–O) bam1-3, (P–R) clv1-101 and (S–U) clv3-9 plants expressing the transcriptional reporter WUS:NLS-GFP. Scale …
Figure 7—figure supplement 3
Inflorescence meristem (IFM) height, width and shape at 5 weeks after germination (WAG).
(A) The width of Col-0 (N = 11), cle40-2 (N = 10), bam1-3 (N = 11), clv1-101 (N = 9) and clv3-9 (N = 5) mutants at 5 WAG does not significantly differ from each other. The average width lays between …
Figure 8 with 4 supplements
Schematic model of two intertwined signalling pathways in the shoot meristem.
(A, B) Schematic representation of two negative feedback loops in the inflorescence meristem (IFM) of Arabidopsis thaliana. CLV3 in the central zone (CZ) binds to the LRR receptor CLV1 to activate a …
Figure 8—figure supplement 1
Schematic model of the two intertwined signalling pathways in a clv1-101 mutant background.
(A) Longitudinal sections of inflorescence meristems (IFMs) show the expression patterns of CLV3 (N = 8), WUS (N = 8), BAM1 (N = 9) and CLV1 (N = 5) in a clv1 mutant. Compared to wild-type plants, …
Figure 8—figure supplement 2
Schematic model of the intertwined signalling pathways in a clv3-9 mutant background.
(A) Longitudinal optical sections of inflorescence meristem (IFMs) show the expression patterns of CLV3 (N = 5), WUS (N = 5), CLE40 (N = 6), BAM1 (N = 5) and CLV1 (N = 5) in a clv3-9 mutant. …
Figure 8—figure supplement 3
Schematic model of the intertwined signalling pathways in a cle40-2 mutant background.
(A) Longitudinal optical sections of inflorescence meristems (IFMs) show the expression patterns of CLV3 (N = 9), WUS (N = 9), BAM1 (N = 7) and CLV1 (N = 9) in a cle40-2 mutant. CLV3 expression is …
Figure 8—figure supplement 4
Schematic model of the intertwined signalling pathways in a bam1-3 mutant background.
(A) Longitudinal optical sections of inflorescence meristems (IFMs) show the expression patterns of CLV3 (N = 9), WUS (N = 9), BAM1 (N = 15) and CLV1 (N = 7) in a bam1-3 mutant. CLV3 expression is …
Author response image 1
Tables
Table 1
Mutants analysed in this study.
| Allele | Gene | Mutation | Reference | Background |
|---|---|---|---|---|
| bam1-3 | AT5G65700 | T-DNA | Alonso et al., 2003;SALK_015302 | Col-0 |
| cle40-2 | AT5G12990 | Transposon mutation | Stahl et al., 2009 | Col-0 |
| cle40-cr1 | AT5G12990 | CRISPR | Yamaguchi et al., 2017 | Col-0 |
| cle40-cr2 | ||||
| cle40-cr3 | ||||
| clv3-9 | AT2G27250 | EMS | Brand et al., 2000 | Col-0 |
| clv1-20 | AT1G75820 | T-DNA | SALK_008670 | Col-0 |
| clv1-101 | AT1G75820 | T-DNA | Kinoshita et al., 2010;CS858348 | Col-0 |
| wus-7 | AT2G17950 | EMS | Graf et al., 2010 | L.er. |
Table 2
Primers and methods used for genotyping.
| Allele | Method | Primer | PCR product |
|---|---|---|---|
| bam1-3 | PCR | bam1-3_F: ctaacgactctccgggagctbam1-3_R: taaggaccacagagatcaggattacLbaI_R: tggttcacgtagtgggccatcg | WT amp.: 1208 bpmutant amp.: 998 bp |
| cle40-2 | dCAPS | cle40-2_F: GGAGAAACACAAGATACGAAAGCCATGcle40-2_R: ATTGTGATTTGATACCAACTTAAAA | Restriction enzyme: AseIWT amp.: 460 + 200 bpmutant amp.: 410 + 200 + 60 bp |
| cle40-cr1 | dCAPS | cle40-cr_F: ATGGCGGCGATGAAATACAAcle40-cr_R: GTTACGCTTTGGCATCTTTCC | Restriction enzyme: BamHIWT amp.: 750 bpmutant amp.: 491 + 259 bp |
| cle40-cr2 | |||
| cle40-cr3 | |||
| clv1-20 | PCR | clv1-20_F: TTTGAATAGTGTGTGACCAAATTTGAclv1-20_R: TCCAATGGTAATTCACCGGTGLBa.1: TGGTTCACGTAGTGGGCCATCG | WT amp.: 860 bpmutant amp: 1200 bp |
| clv1-101 | PCR | clv1-101_F: TTCTCCAAATTCACCAACAGGclv1-101_R: CAACGGAGAAATCCCTAAAGGWiscLox_LT6_R: AATAGCCTTTACTTGAGTTGGCGTAAAAG | WT amp.: 1158 bpmutant amp.: 896 bp |
| wus-7 | dCAPS | wus-7_F: CCGACCAAGAAAGCGGCAACAwus-7_R: AGACGTTCTTGCCCTGAATCTTT | Restriction enzyme: XmnIWT amplification: 216 bpmutant amp.: 193 + 23 bp |
Table 3
Entry vectors used for cloning.
| Name | Description | Bacterial resistance | Backbone | Reference/origin |
|---|---|---|---|---|
| proBAM1(pGD288) | BAM1 promoter3522 bp upstream from transcription start | Ampicillin | pGGA000 | Grégoire Denay |
| proCLE40 | CLE40 promoter2291 bp upstream from translational start codon | Kanamycin | pENTR/D-TOPO | Rene Wink |
| proCLV3 | CLV3 promoter1480 bp upstream from transcription start | Ampicillin | pGGA000 | Jenia Schlegel |
| proCLV1 | CLV1 promoter5759 bp upstream from transcription start | Ampicillin | pGGA000 | Patrick Blümke |
| omega-element(pGGB002) | Omega-element | Ampicillin | pGGB000 | Lampropoulos et al., 2013 |
| SV40 NLS(pGGB005) | SV40 NLS (SIMIAN VIRUS 40 NUCLEARLOCALIZATION SIGNAL) | Ampicillin | pGGB000 | Lampropoulos et al., 2013 |
| BAM1_CDS(pGD351) | BAM1 coding region genomic region of BAM1 START to one codon before STOP, including introns, internal BsaI sites removed | Ampicillin | pGGC000 | Grégoire Denay |
| CLV1_CDS | CLV1 coding region2946 bp coding region amplified from genomic Col-0 DNA without STOP codon and internal BsaI site removed | Ampicillin | pGGC000 | Jenia Schlegel |
| 3x-mCherry(pGGC026) | 3x mCherry | Ampicillin | pGGC000 | Lampropoulos et al., 2013 |
| linker-GFP(pGD165) | linker(10aa)-eGFP | Ampicillin | pGGD000 | Grégoire Denay |
| d-dummy(pGGD002) | d-dummy | Ampicillin | pGGD000 | Lampropoulos et al., 2013 |
| tCLV3 | CLV3 terminator1257 bp downstream of transcription stop | Ampicillin | pGGE000 | Jenia Schlegel |
| tUBQ10(pGGE009) | UBQ10 terminator | Ampicillin | pGGE000 | Lampropoulos et al., 2013 |
| BastaR(pGGF008) | pNOS:BastaR (chi sequence removed):tNOS | Ampicillin | pGGF000 | Lampropoulos et al., 2013 |
| D-AlaR(pGGF003) | pMAS:D-AlaR:tMAS | Ampicillin | pGGF000 | Lampropoulos et al., 2013 |
Table 4
Destination vectors used to generate transgenic A. thaliana reporter lines.
| Name | Backbone | Promoter | N-tag | CDS | C-tag | Terminator | Resistance |
|---|---|---|---|---|---|---|---|
| BAM1:BAM1-GFP | pGGZ001 | proBAM1 | Ω-element(pGGB002) | BAM1-CDS | linker-GFP(pGD165) | tUBQ10 (pGGE009) | D-Alanin(pGGF003) |
| CLE40:Venus-H2B | pMDC99 | proCLE40 | - | Venus | H2B | T3A | Hygromycin |
| CLV1:CLV1-GFP | pGGZ001 | proCLV1 | Ω-element(pGGB002) | CLV1-CDS | linker-GFP(pGD165) | tUBQ10 (pGGE009) | BastaR(pGGF008) |
| CLV3:NLS-3xmCherry | pGGZ001 | proCLV3 | SV40 NLS | 3x-mCherry(pGGC026) | d-dummy(pGGD002) | tCLV3 | BastaR(pGGF008) |
Table 5
Primers used for cloning the entry vectors.
| Name | Primer |
|---|---|
| proBAM1(pGD288) | F: AAAGGTCTCAACCTATGATCCGATCCTCAAAAGTATGTAR: AAAGGTCTCATGTTTCTCTCTATCTCTCTTGTGTG |
| BAM1_CDS(pGD351) | F: TTTGGTCTCAGGCTCTATGAAACTTTTTCTTCTCCTTCR:TTTGGTCTCACTGATAGATTGAGTAGATCCGGCBsaI-site_#1_F: CTTGATCTCTCCGGACTCAACCTCTCCGGBsaI-site_#1_R: CCGGAGAGGTTGAGTCCGGAGAGATCAAGBsaI-site_#2_F: CTCATGTTGCTGACTTTGGACTCGCTAAATTCCTTCAAGBsaI-site_#2_R: CTTGAAGGAATTTAGCGAGTCCAAAGTCAGCAACATGAG |
| proCLE40 | F: CACCGTTAAGCCAAGTAAGTACCACACAGCR: CATTTCAAAAACCTCTTTGTG |
| proCLV1 | F: AAAGGTCTCAACCTGACTATTGTTTATACTTAGTTGR: TTTGGTCTCATGTTCATTTTTTTAGTGTCCTC |
| CLV1_CDS | F: AAAGGTCTCAGGCTTAATGGCGATGAGACR: TTTGGTCTCACTGAACGCGATCAAGTTCBasI-site_#1_F: CTAAAGGACACGGACTGCACGACTGBasI-site_#1_R: CAGTCGTGCAGTCCGTGTCCTTTAGBasI-site_#2_F: CTTAGAGTATCTTGGACTGAACGGAGCTGGBasI-site_#2_R: CCAGCTCCGTTCAGTCCAAGATACTCTAAG |
| proCLV3 | F: AAAGGTCTCAACCTCGGATTATCCATAATAAAAACR:AAAGGTCTCATGTTTTTTAGAGAGAAAGTGACTGAG |
| tCLV3 | F: TTTGGTCTCTCTGCCGCCCTAATCTCTTGTTR: TTTGGTCTCGTGATATGTGTGTTTTTTCTAAACAATC |
Table 6
Arabidopsis lines that were analysed in this study.
| Name/construct | Background | Plant resistance | Generation | Reference |
|---|---|---|---|---|
| BAM1:BAM1-GFP | bam1-3 | D-Ala | T4 | This study |
| BAM1:BAM1-GFP | bam1-3;clv1-20 | D-Ala | F3 | This study |
| BAM1:BAM1-GFP | bam1-3;clv3-9 | D-Ala | F3 | This study |
| BAM1:BAM1-GFP | bam1-3;cle40-2 | D-Ala | F3 | This study |
| CLE40:Venus-H2B | Col-0 | Hygromycin | T5 | This study |
| CLE40:Venus-H2B | clv3-9 | Hygromycin | F3 | This study |
| CLE40:Venus-H2B | wus-7 | Hygromycin | F2 | This study |
| CLE40:Venus-H2B | CLV3:WUS//Col-0 | Hygromycin/Basta | T1* | This study |
| CLE40:CLE40-GFP | Col-0 | N/A | T3 | Stahl et al., 2009 |
| CLV1:CLV1-GFP | Col-0 | Basta | T4 | This study |
| CLV1:CLV1-GFP | bam1-3 | Basta | F3 | This study |
| CLV1:CLV1-GFP | clv3-9 | Basta | F3 | This study |
| CLV1:CLV1-GFP | cle40-2 | Basta | F3 | This study |
| CLV1:CLV1-2xGFP | clv1-11 | Basta | N/A | Nimchuk et al., 2011 |
| CLV3:NLS-3xmCherry | CLE40:Venus-H2B//Col-0 | Basta/hygromycin | F3 | This study |
| CLV3:NLS-mCherryWUS:NLS-GFP | Col-0 | Kanamycin | N/A | Anne Pfeiffer |
| CLV3:NLS-mCherryWUS:NLS-GFP | cle40-2 | Kanamycin | F3 | This study |
| CLV3:NLS-mCherryWUS:NLS-GFP | bam1-3 | Kanamycin | F3 | This study |
| CLV3:NLS-mCherryWUS:NLS-GFP | clv1-101 | Kanamycin | F3 | This study |
| CLV3:NLS-mCherryWUS:NLS-GFP | clv3-9 | Kanamycin | F3 | This study |
-
*
Plants do not overcome seedling stage.
Table 7
Microscopy settings used for imaging.
| Fluorophore/staining | Excitation (nm) | Emission (nm) | MBS | Detector | Light source |
|---|---|---|---|---|---|
| DAPI | 405 | 410–490 | 405 | PMT | Diode |
| GFP | 488 | 500–545 | 488/561 | GaAsP | Argon laser |
| Venus | 514 | 518–540 | 458/514 | GaAsP | Argon laser |
| mCherry | 561 | 570–640 | 458/561 | PMT | DPSS laser |
| PI | 561 | 595–650 | 488/561 | PMT | DPSS laser |
-
PMT, photomultiplier tubes; DPSS, diode-pumped solid state.
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Arabidopsis thaliana) | Columbia (Col-0) | NASC ID: N22625 | ABRC: CS22625 | |
| Genetic reagent (A. thaliana) | bam1-3 | Alonso et al., 2003; NASC ID: N515302 | ABRC: SALK_015302 | T-DNA mutation in Col-0 background |
| Genetic reagent (A. thaliana) | cle40-2 | Stahl et al., 2009 | NA | Transposon mutation Col‑0 background |
| Genetic reagent (A. thaliana) | cle40-cr1/2/3 | Yamaguchi et al., 2017 | NA | CRISPR in Col-0 background |
| Genetic reagent (A. thaliana) | clv3-9 | Hobe et al., 2003 | NA | EMS in Col-0 background |
| Genetic reagent (A. thaliana) | clv1-20 | Alonso et al., 2003; NASC ID: N508670 | ABRC: SALK_008670 | T-DNA mutation in Col-0 background |
| Genetic reagent (A. thaliana) | clv1-101 | Alonso et al., 2003; NASC ID: N858348 | ABRC: CS858348 | T-DNA mutation in Col-0 background |
| Genetic reagent (A. thaliana) | wus-7 | Graf et al., 2010; | NA | EMS in L.er. background Gift from J. Lohmann lab |
| Genetic reagent (A. thaliana) | BAM1:BAM1-GFP | This study | NA | Transgenic line in bam1‑3 background |
| Genetic reagent (A. thaliana) | BAM1:BAM1-GFP | This study | NA | Transgenic line in bam1‑3;clv1‑20 background |
| Genetic reagent (A. thaliana) | BAM1:BAM1-GFP | This study | NA | Transgenic line in bam1‑3;clv3-9 background |
| Genetic reagent (A. thaliana) | BAM1:BAM1-GFP | This study | NA | Transgenic line in bam1‑3;cle40-2 background |
| Genetic reagent (A. thaliana) | CLE40:Venus-H2B | This study | NA | Transgenic line in Col-0 background |
| Genetic reagent (A. thaliana) | CLE40:Venus-H2B | This study | NA | Transgenic line in clv3-9 background |
| Genetic reagent (A. thaliana) | CLE40:Venus-H2B | This study | NA | Transgenic line in wus-7 background |
| Genetic reagent (A. thaliana) | CLE40:Venus-H2B | This study | NA | Transgenic line in CLV3:WUS/Col-0 background |
| Genetic reagent (A. thaliana) | CLE40:CLE40-GFP | Stahl et al., 2009 | NA | Transgenic line in Col-0 background |
| Genetic reagent (A. thaliana) | CLV1:CLV1-GFP | This study | NA | Transgenic line in Col-0 background |
| Genetic reagent (A. thaliana) | CLV1:CLV1-GFP | This study | NA | Transgenic line in clv1-101 background |
| Genetic reagent (A. thaliana) | CLV1:CLV1-GFP | This study | NA | Transgenic line in bam1-3 background |
| Genetic reagent (A. thaliana) | CLV1:CLV1-GFP | This study | NA | Transgenic line in clv3-9 background |
| Genetic reagent (A. thaliana) | CLV1:CLV1-GFP | This study | NA | Transgenic line in cle40-2 background |
| Genetic reagent (A. thaliana) | CLV1:CLV1-2xGFP | Nimchuk et al., 2011 | NA | Transgenic line in clv1-11 backgroundGift from Z. Nimchuk lab |
| Genetic reagent (A. thaliana) | CLV3:NLS-3xmCherry | This study | NA | Transgenic line in CLE40:Venus-H2B/Col-0 background |
| Genetic reagent (A. thaliana) | CLV3:NLS-mCherry WUS:NLS-GFP | Anne Pfeiffer | NA | Transgenic line in Col-0 backgroundGift from J. Lohmann lab |
| Genetic reagent (A. thaliana) | CLV3:NLS-mCherry WUS:NLS-GFP | This study | NA | Transgenic line in cle40-2 background |
| Genetic reagent (A. thaliana) | CLV3:NLS-mCherry WUS:NLS-GFP | This study | NA | Transgenic line in bam1-3 background |
| Genetic reagent (A. thaliana) | CLV3:NLS-mCherry WUS:NLS-GFP | This study | NA | Transgenic line in clv1-101 background |
| Genetic reagent (A. thaliana) | CLV3:NLS-mCherry WUS:NLS-GFP | This study | NA | Transgenic line in clv3-9 background |
| Strain, strain background (Agrobacterium tumefaciens) | A. tumefaciens GV3101 pMP90 pSoup | Lifeasible | Cat# ACC-101 | |
| Recombinant DNA reagent | pGGZ001 | Lampropoulos et al., 2013 | Addgene | RRID:Addgene_48868 |
| Recombinant DNA reagent | pGGB002 | Lampropoulos et al., 2013 | Addgene | RRID:Addgene_48820 |
| Recombinant DNA reagent | pGGE009 | Lampropoulos et al., 2013 | Addgene | RRID:Addgene_48841 |
| Recombinant DNA reagent | pGGF003 | Lampropoulos et al., 2013 | Addgene | RRID:Addgene_48844 |
| Recombinant DNA reagent | pGGC026 | Lampropoulos et al., 2013 | Addgene | RRID:Addgene_48831 |
| Recombinant DNA reagent | pGGD002 | Lampropoulos et al., 2013 | Addgene | RRID:Addgene_48834 |
| Recombinant DNA reagent | pGGF008 | Lampropoulos et al., 2013 | Addgene | RRID:Addgene_48848 |
| Recombinant DNA reagent | pMDC99 | Curtis and Grossniklaus, 2003 | NA | |
| Recombinant DNA reagent | pBAM1/pGGA000 | This study | NA | Entry vector used for cloningSee Tables 4 and 5 for details |
| Recombinant DNA reagent | BAM1-CDS/pGGC000 | This study | TAIR: AT5G65700 | Entry vector used for cloningSee Tables 4 and 5 for details |
| Recombinant DNA reagent | pCLV1-/pGGA000 | This study | NA | Entry vector used for cloningSee Tables 4 and 5 for details |
| Recombinant DNA reagent | CLV1-CDS/pGGC000 | This study | TAIR: AT1G75820 | Entry vector used for cloningSee Tables 4 and 5 for details |
| Recombinant DNA reagent | pCLE40/pGGA000 | This study | NA | Entry vector used for cloningSee Tables 4 and 5 for details |
| Recombinant DNA reagent | pCLV3/pGGA000 | This study | NA | Entry vector used for cloningSee Tables 4 and 5 for details |
| Recombinant DNA reagent | pCLV3/pGGE000 | This study | NA | Entry vector used for cloningSee Tables 4 and 5 for details |
| Sequence-based reagent | Cloning primers | This study | NA | Table 5 |
| Sequence-based reagent | Genotyping primers | This study | NA | Table 2 |
| Chemical compound, drug | BASTA non-selective herbicide | Bayer CropScience | 84442615 | |
| Peptide, recombinant protein | Synthetic CLE40 | Peptides&Elephants | NA | |
| Software, algorithm | ImageJ v 1.53c | Schneider et al., 2012 | https://imagej.net/software/fiji/ | RRID:SCR_003070 |
| Software, algorithm | MorphoGraphX | Barbier de Reuille et al., 2015 | https://www.mpipz.mpg.de/MorphoGraphX/ | |
| Software, algorithm | GraphPad Prism v8.0.0.224 | NA | GraphPad Prism (https://graphpad.com) | RRID:SCR_002798 |
| Software, algorithm | Imaris | NA | http://www.bitplane.com/imaris/imaris | RRID:SCR_007370 |
