Inducible and reversible inhibition of miRNA-mediated gene repression in vivo
- Cancer Biology and Genetics Program, Memorial Sloan Kettering Cancer Center, United States
- Department of Cancer Biology, Dana Farber Cancer Institute, United States
- Louis V. Gerstner Jr. Graduate School of Biomedical Sciences, Memorial Sloan Kettering Cancer Center, United States
- Laboratory of RNA Molecular Biology, The Rockefeller University, United States
- Department of Biological, Chemical and Pharmaceutical Sciences and Technologies, University of Palermo, Italy
- Weill Cornell/Rockefeller/Sloan-Kettering Tri-Institutional MD-PhD Program, United States
- Center of Integrative Biology, University of Trento, Italy
- Hem/Oncology, Medicine and Institution for Computational Biomedicine, Weill Cornell Medical College, United States
- Laboratory of Biochemistry and Molecular Biology, National Cancer Institute, United States
- Regensburg Center for Biochemistry, University of Regensburg, Germany
- Immunology Program, Memorial Sloan Kettering Cancer Center, United States
Figures
Figure 1 with 2 supplements
T6B fusion protein prevents miRNA-induced silencing complex (miRISC) assembly and impairs microRNA (miRNA) activity in vitro.
(A) Schematics of T6B action: T6B competes with TNRC6 for binding to AGO proteins preventing miRISC assembly. (B) Schematics of the size-exclusion chromatography (SEC) assay for the fractionation of …
-
Figure 1—source data 1
RNAseq, differential gene expression, mouse embryo fibroblasts.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-data1-v2.csv
-
Figure 1—source data 2
z-scores and miRNA family abundance, mouse embryo fibroblasts.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-data2-v2.csv
-
Figure 1—source data 3
Small RNAseq, microRNA counts, mouse embryo fibroblasts.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-data3-v2.csv
-
Figure 1—source data 4
Unedited blots shown in Figure 1C.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-data4-v2.pdf
-
Figure 1—source data 5
Unedited blots shown in Figure 1F.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-data5-v2.pdf
-
Figure 1—source data 6
Unedited blots shown in Figure 1F.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-data6-v2.pdf
-
Figure 1—source data 7
Uncropped blots shown in Figure 1F.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-data7-v2.pdf
Figure 1—figure supplement 1
Sequence and properties of the FH-T6B-YFP fusion protein.
(A) HCTT116 cells transduced with retroviral vectors expressing a doxycycline-inducible T6B or T6BMut transgene (FH-T6B-YFP) were cultured in the presence of doxycycline for 48 hr. Whole-cell …
-
Figure 1—figure supplement 1—source data 1
Unedited blots shown in Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-figsupp1-data1-v2.pdf
-
Figure 1—figure supplement 1—source data 2
Uncropped blots shown in Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-figsupp1-data2-v2.pdf
Figure 1—figure supplement 2
Size-exclusion chromatography was performed on whole-cell lysates from mouse embryo fibroblasts transduced with retroviral vectors expressing a doxycycline-inducible T6B or T6BMut transgene and cultured in the presence of doxycycline for 48 hr.
Eluted fractions were probed with the anti-AGO2 or anti-HA antibodies to determine the elution profile of AGO2 and T6B, respectively.
-
Figure 1—figure supplement 2—source data 1
Unedited blots shown in Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-figsupp2-data1-v2.pdf
-
Figure 1—figure supplement 2—source data 2
Uncropped blots shown in Figure 1—figure supplement 2.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig1-figsupp2-data2-v2.pdf
Figure 2 with 4 supplements
Expression of T6B reversibly blocks miRNA-induced silencing complex (miRISC) assembly and inhibits microRNA (miRNA) function in vivo.
(A) Schematic of the targeting strategy to generate the T6B mouse. The construct contains a flippase recognition target site (frt) that allows homing into the Col1a1 locus when electroporated …
-
Figure 2—source data 1
RNAseq, differential gene expression, colon and liver.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-data1-v2.csv
-
Figure 2—source data 2
Z-scores and miRNA families abundance, colon and liver.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-data2-v2.csv
-
Figure 2—source data 3
Unedited blots shown in Figure 2C.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-data3-v2.pdf
-
Figure 2—source data 4
Uncropped blots shown in Figure 2C.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-data4-v2.pdf
-
Figure 2—source data 5
Unedited blots shown in Figure 2D.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-data5-v2.pdf
-
Figure 2—source data 6
Uncropped blots shown in Figure 2D.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-data6-v2.pdf
-
Figure 2—source data 7
Unedited blots shown in Figure 2E.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-data7-v2.pdf
-
Figure 2—source data 8
Uncropped blots shown in Figure 2E.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-data8-v2.pdf
Figure 2—figure supplement 1
Expression of FH-T6B-YFP fusion protein in targeted ES clones.
(A) Two independent targeted ES clones were cultured in the presence or absence of doxycycline for 48 hr and examined by epifluorescence microscopy to detect FH-T6B-YFP expression. The same exposure …
-
Figure 2—figure supplement 1—source data 1
Unedited blots shown in Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-figsupp1-data1-v2.pdf
-
Figure 2—figure supplement 1—source data 2
Uncropped blots shown in Figure 2—figure supplement 1.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-figsupp1-data2-v2.pdf
Figure 2—figure supplement 2
Immunofluorescence imaging using a YFP-specific antibody, showing T6B expression in a panel of tissues of adult R26T6B mice (second column) and CAGT6B mice (third column) fed doxycycline-containing diet for 7 days.
Tissues from R26CTL (first column) mice fed doxycycline-containing diet for 7 days were included as negative controls.
Figure 2—figure supplement 3
Total extracts from the colon of R26T6B mice kept on doxycycline-containing diet for 1 week were immunoprecipitated using an anti-YFP antibody and probed with the indicated antibodies to measure the interaction between the T6B fusion protein and AGO2 in vivo.
An anti-HA antibody was used to detect T6B.
-
Figure 2—figure supplement 3—source data 1
Unedited blots shown in Figure 2—figure supplement 3.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-figsupp3-data1-v2.pdf
-
Figure 2—figure supplement 3—source data 2
Uncropped blots shown in Figure 2—figure supplement 3.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-figsupp3-data2-v2.pdf
Figure 2—figure supplement 4
Size-exclusion chromatography (SEC) fractionation followed by western blotting of total extracts from the liver and large intestine of control and R26T6B mice treated with doxycycline-containing chow for 7 days.
The shift of AGO2 from high-molecular-weight to low-molecular-weight complexes confirms disruption of the miRNA-induced silencing complex.
-
Figure 2—figure supplement 4—source data 1
Unedited blots shown in Figure 2—figure supplement 4.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-figsupp4-data1-v2.pdf
-
Figure 2—figure supplement 4—source data 2
Uncropped blots shown in Figure 2—figure supplement 4.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig2-figsupp4-data2-v2.pdf
Figure 3 with 7 supplements
Phenotypic analysis of R26T6B mice during homeostasis.
(A) Rosa26+/+; Col1a1T6B/T6B females were crossed with Rosa26rtTA/+; Col1a1T6B/T6B males and doxycycline was administered by chow starting at 0.5 d.p.c. No viable pups positive for both the rtTA …
-
Figure 3—source data 1
Complete blood counts (CBCs) of whole blood from R26T6B and R26CTL mice.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig3-data1-v2.pdf
Figure 3—figure supplement 1
Effects of FH-T6B-YFP fusion protein expression during development.
(A) Litter obtained by c-section from a pregnant Rosa26rtTA/rtTA; Col1a1T6B/+ female crossed to a Rosa26rtTA/rtTA; Col1a1T6B/+ male and maintained on doxycycline from d.p.c. 13.5 to d.p.c. 18.5. (B…
Figure 3—figure supplement 2
Immunofluorescence imaging of the small and large intestine of R26T6B and R26CTL mice kept on doxycycline diet for a month.
An antibody against YFP was used to detect the T6B fusion protein.
Figure 3—figure supplement 3
Sections from the colon and small intestine sections of R26T6B and control mice kept on doxycycline-containing diet for 2 months were probed by immunohistochemistry with an anti-Ki67 antibody.
Figure 3—figure supplement 4
Detection of goblet cells by staining of acidic and neutral mucins in intestine sections from R26T6B and control mice kept on doxycycline diet for 2 months.
Neutral mucins are stained with periodic acid-Shiff, whereas acidic mucins are stained with Alcian blue.
Figure 3—figure supplement 5
Body weight of R26T6B (n = 5) and control (n = 8) female mice was assessed after 2-month administration of doxycycline-containing chow.
ns, not significant (p=0. 6264, unpaired t-test).
Figure 3—figure supplement 6
Representative flow cytometry plots showing the gating strategy for the identification of hematopoietic stem and progenitor cells from whole bone marrow harvested from R26T6B and R26CTL mice maintained on doxycycline diet for 3 weeks.
LT-HSC: Lin- Kit+ Sca1+ CD150+ CD48-; ST-HSC: Lin- Kit+ Sca1+ CD150- CD48-; MPP2: Lin- Kit+ Sca1+ CD150+ CD48+; MPP3/4: Lin- Kit+ Sca1+ CD150 CD48+.
Figure 3—figure supplement 7
Representative flow cytometry plots showing the gating strategy for the identification of B cell lineage populations from whole bone marrow harvested from R26T6B and R26CTL mice maintained on doxycycline diet for 3 weeks.
Pro-B: B220+ CD19+ IgD-IgM-CD25-Kit+; Pre-B: B220+ CD19+ IgD-IgM-CD25+; Imm B: B220+ CD19+ IgD-IgM+; Mat B: B220+ CD19+ IgD + IgM+/lo.
Figure 4 with 2 supplements
T6B-induced block of miRNA-induced silencing complex (miRISC) assembly leads to impaired intestinal regeneration.
(A) R26T6B and R26CTL mice (n = 6 for each genotype) kept on doxycycline diet were treated with dextran sulfate sodium (DSS) for 5 days to induce inflammatory colitis and their weight was monitored …
Figure 4—figure supplement 1
Bar plots showing measurement of colon length, aggregated length of ulcers, percentage of colon with ulcers, area of ulcers, number of immune nodules, and the area of immune nodules performed on H&E longitudinal sections of colon from R26CTL and R26T6B mice 5 days post-dextran sulfate sodium (DSS) treatment.
Measurements of these parameters were obtained using OMERO (https://www.openmicroscopy.org/omero/) and used to estimate the extent of damage and colitis induced by DSS treatment. Plots show that no …
Figure 4—figure supplement 2
Representative immunohistochemistry image showing Ki67 signal in control mice (n = 3) 5 days after dextran sulfate sodium (DSS) treatment was discontinued.
The presence of highly proliferating cells indicates residual dysplasia.
Figure 5
T6B-induced block of miRNA-induced silencing complex (miRISC) assembly impairs the regeneration of the hematopoietic system.
(A) Long-term hematopoietic stem cell (HSC) in the bone marrow of R26T6B and R26CTL mice treated with 5-fluorouracil (5-FU) or subjected to repeated bleeding (n = 5 for each genotype). Mice were …
Figure 6 with 3 supplements
The microRNA (miRNA) pathway is essential in heart and skeletal muscle during homeostasis.
(A) Detection of T6B expression with an anti-YFP antibody in the heart and skeletal muscle of R26T6B, CAGT6B, and R26CTL mice maintained on doxycycline-containing diet for 7 days. (B) Total RNA …
-
Figure 6—source data 1
RNAseq, heart and muscle.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig6-data1-v2.csv
-
Figure 6—source data 2
Z-scores and miRNA family abundance, heart and muscle.
- https://cdn.elifesciences.org/articles/70948/elife-70948-fig6-data2-v2.csv
Figure 6—figure supplement 1
Body weight of CAGT6B and control mice maintained on doxycycline for up to 45 days was assessed the day on which euthanasia was performed.
n = 8 (four females and four males) for each genotype (age and sex matched). Mice were kept on doxycycline diet throughout the duration of the experiment, and control mice were euthanized at day 45. …
Figure 6—figure supplement 2
Representative H&E staining showing vasculitis of the pulmonary veins as revealed by inflammatory immune cell infiltration of the vessel wall (arrows).
Figure 6—figure supplement 3
T6B blocks miRNA activity in sea urchins and zebrafish.
(A) Left panel: representative examples of Mediterranean sea urchin (Paracentrotus lividus) zygotes injected with 1 pg of in vitro-transcribed mRNA coding for either T6B or T6BMut proteins and …
Scheme 1
Cloning strategy for the generation of the targeting vector expressing the FH-T6B-YFP transgene.
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background(Mus musculus) | T6B | This paper | Stock #036470 | The T6Bwt allele is integrated in the Col1a1 locus |
| Strain, strain background(M. musculus) | CD45.1+ C57BL/6 (BoyJ) | Jackson Laboratory | RRID:IMSR_JAX:002014 | Carries the differential Ptprca
pan leukocyte marker |
| Strain, strain background(M. musculus) | C57BL/6J | Jackson Laboratory | RRID:IMSR_JAX:000664 | |
| Strain, strain background(M. musculus) | Rosa26-CAGs-rtTA3 | Jackson Laboratory | RRID:IMSR_JAX:029627 | The CAG promoter drives the expression of rtTA3 |
| Cell line (M. musculus) | KH2 | PMID:16400644 | RRID:CVCL_C317 | Embryonic stem cells |
| Cell line (M. musculus) | DR4 | ATCC | RRID:CVCL_VK72 | Irradiated feeder cells |
| Transfected construct(M. musculus) | Silencer GAPDH siRNA | Thermo Fisher | #AM4624 | |
| Transfected construct(M. musculus) | Negative Control 1 siRNA | Thermo Fisher | #AM4611 | Nontargeting control |
| Antibody | Anti-E-cadherin(mouse monoclonal) | BD | #610181 | IF: (1:750) |
| Antibody | Anti-lysozyme(rabbit polyclonal) | Thermo Fisher | #RB-372-A1 | IF: (1:200) |
| Antibody | Anti-PH3(mouse monoclonal) | Cell Signaling | #970 | IF: (1:200) |
| Antibody | Anti-YFP(rabbit polyclonal) | Invitrogen | #A11122 | IF: (1:250) |
| Antibody | Anti-Ki67(rabbit monoclonal) | Cell Signaling | #12202 | IF: (1:400) |
| Antibody | Anti-Rabbit IgG, Alexa Fluor 488(goat polyclonal) | Thermo Fisher | #A11034 | IF: (1:250) |
| Antibody | Anti-mouse IgG2a, Alexa Fluor 594(goat polyclonal) | Thermo Fisher | #A-21135 | IF: (1:250) |
| Antibody | Anti-GFP(chicken polyclonal) | Abcam | #ab13970 | IF: (1:250) |
| Antibody | Rat IgG(rat polyclonal) | Sigma | #I-8015 | IF: (1:250) |
| Antibody | Anti-GW182(rabbit polyclonal) | Bethyl | #A302-329A | WB: (1:1000, in 5% milk) |
| Antibody | Anti-Ago2(rabbit monoclonal) | Cell Signaling | #2897 | WB: (1:1000) |
| Antibody | Anti-RPL26(rabbit polyclonal) | Bethyl | #A300-686A | WB: (1:1000) |
| Antibody | Anti-GAPDH(mouse monoclonal) | Sigma | #G8795 | WB: (1:2000) |
| Antibody | anti-β-actin(mouse monoclonal) | Sigma | #A2228 | WB: (1:2000) |
| Antibody | Anti-tubulin(mouse monoclonal) | Sigma-Aldrich | #T9026 | WB: (1:2000) |
| Antibody | Anti-HA(rabbit monoclonal) | Cell Signaling | #C29F4 | WB: (1:1000) |
| Antibody | Anti-rabbit IgG, HRP-conjugated(donkey polyclonal) | GE Healthcare | #NA934 | WB: (1:10,000) |
| Antibody | Anti-mouse IgG, HRP-conjugated(sheep polyclonal) | GE Healthcare | #NA931 | WB: (1:10,000) |
| Antibody | Anti-AGO2(mouse monoclonal) | WAKO | #011-22033 | IP: (1 µg/100 µl) |
| Antibody | Anti-AGO1-4(mouse monoclonal) | EMD Millipore | #MABE56 | IP: (1 µg/100 µl) |
| Antibody | Anti-FLAG(mouse monoclonal) | Cell Signaling | #8146S | IP: (1 µg/100 µl) |
| Antibody | Anti-HA(mouse monoclonal) | Cell Signaling | #2367S | IP: (1 µg/100 µl) |
| Antibody | Anti-IgG1 isotype(mouse monoclonal) | Cell Signaling | #5415 | IP: (1 µg/100 µl) |
| Recombinant DNA reagent | pCAGGS-flpE-puro (plasmid) | Addgene | RRID:Addgene_20733 | Flippase recombinase- expressing vector |
| Recombinant DNA reagent | pgk-ATG-frt plasmid | Addgene | RRID:Addgene_20734 | |
| Sequence-based reagent | Col1a1 common _F | This paper | PCR primers | AATCATCCCAGGTGCACAGCATTGCGG |
| Sequence-based reagent | Col1a1 wildtype _R | This paper | PCR primers | CTTTGAGGGCTCATGAACCTCCCAGG |
| Sequence-based reagent | Col1a1 mutant _R | This paper | PCR primers | ATCAAGGAAACCCTGGACTACTGCG |
| Sequence-based reagent | R26_F | This paper | PCR primers | AAAGTCGCTCTGAGTTGTTAT |
| Sequence-based reagent | R26a_R | This paper | PCR primers | GCGAAGAGTTTGTCCTCAACC |
| Sequence-based reagent | R26b_R | This paper | PCR primers | CCTCCAATTTTACACCTGTTC |
| Sequence-based reagent | T6B-YFP_F | This paper | PCR primers | GACTACAAGGACGACGATGACAAG |
| Sequence-based reagent | T6B-YFP_R | This paper | PCR primers | GTTACTTGTACAGCTCGTCCATG |
| Commercial assay or kit | RNAscope 2.5 HD Detection Reagent, BROWN | ACD | #320771 | |
| Commercial assay or kit | RNAScope Igfbp5 Probe | ACD | #425738 | |
| Commercial assay or kit | Superose 6 10/300 GL | Cytiva | #GE17-5172-01 | Now available as Increase 10/300 GL, Cytiva #GE29-0915-96 |
| Commercial assay or kit | Novex NuPAGE SDS/PAGE gel system | Thermo Fisher | #NP0321 | |
| Commercial assay or kit | EnVision + HRP | DAKO, Glostrup, Denmark | #K401111-2, RRID:AB_2827819 | |
| Commercial assay or kit | GFP-trap | Chromotek | #gtma-10RRID:AB_2827592 | |
| Commercial assay or kit | TruSeq Stranded mRNA LT Kit, | Illumina | #RS-122-2102 | |
| Software, algorithm | OMERO | PMID:22373911 | RRID:SCR_002629 | |
| Software, algorithm | STAR v2.5.3a | PMID:23104886 | ||
| Software, algorithm | DESeq2 | PMID:25516281 | RRID:SCR_015687 | |
| Software, algorithm | miRbase version 21 | https://www.mirbase.org/ | ||
| Software, algorithm | TargetScan | PMID:26267216 | RRID:SCR_010845 | |
| Chemical compound, drug | Doxycyline-containingRodent diet | Envigo | #TD01306 | 625 mg/kg doxycycline |
| Chemical compound, drug | Dextran sulfate sodium (DSS) | Cayman Chemical | #23250 | |
| Chemical compound, drug | Surgipath Decalcifier I | Leica Biosystems | #3800400 | Formic acid solution |
| Other | EDTA-free complete protease inhibitors | Sigma-Aldrich | #11836170001 | |
| Other | KnockOut DMEM | GIBCO | #10829018 | |
| Other | Phosphate inhibitors | Roche | #04906837001 | |
| Other | TRIzol Reagent | Thermo Fisher | #15596026 | |
| Other | DAPI stain | Sigma-Aldrich | #62248 | 5 μg/ml |
| Other | Mowiol 4-88 | Calbiochem | #475904100 GM | Mounting media |
| Other | GlutaMax | GIBCO | #35050061 | |
| Other | A/G PLUS-Agarose beads | Santa Cruz | #2003 | |
| Other | RIPA buffer | Sigma-Aldrich | #R0278 | |
| Other | Lipofectamine RNAiMAX | Thermo Fisher | #13778100 | Transfection reagent |
| Other | Alexa Fluor 488 tyramide signal amplification reagent | Life Technologies | B40953 |
