Research Article

Supracellular organization confers directionality and mechanical potency to migrating pairs of cardiopharyngeal progenitor cells

Center for Developmental Genetics, Department of Biology, New York University, United States
Courant Institute of Mathematical Sciences and Department of Biology, New York University, United States
Mathematics and Computational Medicine, University of North Carolina at Chapel Hill, United States
Sars International Centre for Marine Molecular Biology, Norway
Department of Heart Disease, Haukeland University Hospital, Norway

Nov 29, 2021

https://doi.org/10.7554/eLife.70977

Open access
Copyright information

Version of Record: January 11, 2022
Version of Record: December 23, 2021
Accepted Manuscript: November 29, 2021

Download
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
- Article PDF
- Figures PDF
Open citations (links to open the citations from this article in various online reference manager services)
- Mendeley
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Yelena Y Bernadskaya

Haicen Yue

Calina Copos

Lionel Christiaen

Alex Mogilner

(2021)
Supracellular organization confers directionality and mechanical potency to migrating pairs of cardiopharyngeal progenitor cells

eLife 10:e70977.

https://doi.org/10.7554/eLife.70977
- Download BibTeX
- Download .RIS
Cite
Share
CommentOpen annotations (there are currently 0 annotations on this page).

Figures
Videos
Tables
Additional files

5 figures, 10 videos, 3 tables and 1 additional file

Figures

Figure 1 with 3 supplements

Download asset Open asset

Model of force distribution in migrating trunk ventral cell (TVC) pairs.

(A) Diagram of *Ciona robusta* embryo at the late tailbud stage (embryonic stage 23). Migrating TVCs are shown in green, their non-migratory sister cells, anterior tail muscles (ATMs), in blue. The …

Figure 1—figure supplement 1

Download asset Open asset

In silico analysis of evolution of single-cell shape and two-cell cohesion under differing force distribution.

(A) Typical cell shapes for protrusive and retractive forces distributed within different ranges. (B) Unstable deformation of cell front resulting from focusing the protrusive force in the narrow …

Figure 1—figure supplement 2

Download asset Open asset

Sphericity of leader and trailer cells.

Sphericity is measured using automated Bitplane Imaris function and calculated as the ratio of surface area of sphere with volume equal to that of a cell being analyzed to the actual surface area of …

Figure 1—figure supplement 3

Download asset Open asset

Myosin distribution at the cell-cell junction.

(A) Micrograph at left shows a dorsal view of a leader/trailer cell pair with leader oriented to the right. Dashed lines show positions of line scans of fluorescence intensity (a.u.) taken in the …

Figure 2 with 1 supplement

Download asset Open asset

Polarized matrix adhesion promotes adoption of leader/trailer cell state.

(A) Establishment of leader/trailer polarity as measured by the asymmetry that develops between leader and trailer sphericity as cells polarize in the direction of migration. Diagram depicts dorsal …

Figure 2—figure supplement 1

Download asset Open asset

Acute reduction of extracellular matrix (ECM) adhesion in single cell (red) causes detachment of that cell from the underlying epidermis and recapitulates the phenotype observed in vivo (bottom right) with the detached cell positioned on top of the cell that maintains ECM adhesion.

Micrograph at the bottom right shows trunk ventral cell (TVC) pair expressing *Foxf>Intβ1^dn* with membranes marked by *Mesp>hCD4::GFP*.

Figure 3

Download asset Open asset

Hierarchical organization of multicellular migratory clusters.

(A) Evolution of trunk ventral cell (TVC) polarization. Panels show in vivo-rendered images of cells at the indicated embryonic stages. Leader in blue, trailer in red, non-migratory anterior tail …

Figure 4

Download asset Open asset

Migratory persistence of cell pairs and single cells.

(A) Left: simulation of migration persistence over time for single cell and the centroid of the cell pair. The shaded area shows the standard error. In the model, green arrows show the direction of …

Figure 5

Download asset Open asset

Supracellular cell pairs are more efficient at dispersing pressure from surrounding tissues.

(A) Micrographs of stage 23 embryos showing the endodermal pocket formed during trunk ventral cell (TVC) migration. Embryos are oriented with anterior to the right. Endodermal cells are marked with N…

Videos

Video 1

Download asset

posterframe for video — In silico model of a single migrating trunk ventral cell (TVC).

Video 2

Download asset

Video 3

Download asset

Video 4

Download asset

Video 5

Download asset

Video 6

Download asset

Video 7

Download asset

Video 8

Download asset

Video 9

Download asset

Video 10

Download asset

Tables

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Software, algorithm		https://github.com/HaicenYue/3D-simulation-of-TVCs.git
Genetic reagent (Ciona robusta)	Wild-caught	M-Rep, San Diego,CA	https://www.m-rep.com
Sequence-based reagent	RhoDFca-F	This paper	PCR primers	TGAAACTTGTATTGCGGCCGC
Sequence-based reagent	RhoDFca-R	This paper	PCR primers	agacgtacgt GAATTCTCACAATAGC AAACAACAGCAGCAG
Sequence-based reagent	iMyo::GFP – F	This paper	PCR primers	ACTTGTATTG CGGCCGCAACCAT GGCCGAGGTGCAGC
Sequence-based reagent	iMyo::GFP – R	This paper	PCR Primers	gctgagcgcGAA TTCTTACTTGT ACAGCTCGTCCATGC
Recombinant DNA reagent	pCESA: Mesp > hCD4::GFP (plasmid)	PMID:30610187		B7.5 lineage specific GFP membrane marker
Recombinant DNA reagent	pCESA: Mesp > H2B::GFP (plasmid)	PMID:30610187		B7.5 lineage specific GFP histone/nuclear marker
Recombinant DNA reagent	pCESA: Mesp > iMyo::GFP (plasmid)	This paper		B7.5 lineage specific GFP myosin intrabody
Recombinant DNA reagent	pCESA: Foxf > mCherry (plasmid)	PMID:30610187		mCherry TVC-specific marker
Recombinant DNA reagent	pCESA: EfnB > hCD4::mCherry (plasmid)	PMID:30610187		Epidermal mCherry membrane marker
Recombinant DNA reagent	pCESA: Mesp > 3xmKate2 (plasmid)	PMID:30610187		B7.5 lineage specific mKate2 marker
Recombinant DNA reagent	pCESA: Nkx2−1> hCD4::GFP (plasmid)	PMID:30610187		Endoderm specific GFP cell membrane marker
Recombinant DNA reagent	pCESA: Foxf>Sar1^dn (plasmid)	PMID:25564651		TVC-specific dominant negative Sar1
Recombinant DNA reagent	pCESA: Foxf > Rhodf^ca (plasmid)	PMID:18535245		TVC-specific constitutively active RhoD/F
Recombinant DNA reagent	pCESA: Mesp > LacZ (plasmid)	PMID:30610187		B7.5 lineage specific LacZ loading control
Recombinant DNA reagent	pCESA: Foxf > Intβ1^dn (plasmid)	PMID:30610187		TVC-specific dominant negative Intβ1
Recombinant DNA reagent	pCESA: Foxf > Ras^ca (plasmid)	PMID:18535245		TVC-Specific constituitivley active Ras
Recombinant DNA reagent	pCESA: Foxf > Ddr^dn (plasmid)	PMID:30610187		TVC-specific dominant negative Ddr
Software, algorithm	FIJI	Schindelin et al., 2012 PMID:22743772	RRID:SCR_002285
Software, algorithm	Bitplane Imaris	Bitplane Imaris	RRID:SCR_007370
Software, algorithm	Prism 9	https://www.graphpad.com/	RRID:SCR_002798

Appendix 1—table 1

Parameterization of cell-shaping forces, cell adhesion, polarization, and endoderm stiffness for single migrating cells and cell pairs.

Parametername	Standard single		Supracellulardouble		Doublesame		Climbing
Used in figure	Figure 1B and C		Figures 1B, C, 2B (after polarization), Figure 3D (LT mode), Figure 3G		Figures 1E and 2B (before polarization), Figure 3D (I mode, FS mode)		Figure 2—figure supplement 1
$λ$	0.1		0.1		0.1		0.2
$V$	905		905		905		905
$κ$	0.02		0.02		0.02		0.06
$J_{L T}$			16		16		16
$J_{L S}$	14		14		14		14
$J_{T S}$			15		14		40
$P r o_{L}$	160		180		160 (200 for FS mode in Figure 3D)		180
$R e t_{L}$	40		20		40 (50 for FS mode in Figure 3D)		20
$P r o_{T}$			$150 {(α - φ)}^{*}$		160		$150 {(α - φ)}^{*}$
$R e t_{T}$			70		40 (30 for FS mode in Figure 3D)		300
$α_{p L}$	66°		90°		66°		90°
$α_{r L}$	90°		90°		90°		90°
$α_{p T}$			90°		66°		90°
$α_{r T}$			90°		90°		90°
With noise
Used in figure	Figure 4A and B		Figure 4A and B
$ω_{1}$	0.005		0.005
$ω_{2}$			0.1
$σ$	0.1		0.1
With endoderm cells
Used in figure	Figure 5D		Figure 5D		Figure 5D
	Soft	Stiff	Soft	Stiff	Soft	Stiff
$λ_{E}$	0.05	0.5	0.05	0.5	0.05	0.5
$V_{E}$	1,000	1,000	1,000	1,000	1,000	1,000
$κ_{E}$	0.01	0.01	0.01	0.01	0.01	0.01
$J_{E E}$	0	0	0	0	0	0
$J_{L T}$			10	10	16	16
All the other $J$ s not listed above are 20.The $J$ s not listed for the ‘with noise’ and ‘with endoderm’ part are the same as the part without noise or endoderm. $L, T, E, S$ in the subscripts of parameter names mean ‘leader,’ ‘trailer,’ ‘endoderm,’ and ‘substrate,’ respectively.* $(α - φ)$ is as listed in equations in the Materials and methods section.

Appendix 1—table 2

Parameterization of migration mode of three migrating cells.

Parametername	Three cells: independent mode and leader-mid-trailer mode	Three cells: faster-slower mode
Used in figure	Figure 3E	Figure 3E
$λ$	0.1	0.1
$V$	905	905
$κ$	0.02	0.02
$J_{L M}, J_{L T}, J_{M T}$	16	16
$J_{L S}, J_{M S}, J_{T S}$	15	15
$P r o_{L}$	160	170
$R e t_{L}$	40	45
$P r o_{M}$	160	150
$R e t_{M}$	40	40
$P r o_{T}$	160	120
$R e t_{T}$	40	30
$α_{p L}$	66°	66°
$α_{r L}$	90°	90°
$α_{p M}$	66°	66°
$α_{r M}$	90°	90°
$α_{p T}$	66°	66°
$α_{r T}$	90°	90°
All the other $J$ s not listed above are 20. $L, T, M, S$ in the subscripts of parameter names mean ‘leader,’ ‘trailer,’ ‘middle,’ and ‘substrate,’ respectively.

Additional files

Transparent reporting form: https://cdn.elifesciences.org/articles/70977/elife-70977-transrepform1-v3.pdf
Download elife-70977-transrepform1-v3.pdf

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Figures

Model of force distribution in migrating trunk ventral cell (TVC) pairs.

In silico analysis of evolution of single-cell shape and two-cell cohesion under differing force distribution.

Sphericity of leader and trailer cells.

Myosin distribution at the cell-cell junction.

Polarized matrix adhesion promotes adoption of leader/trailer cell state.

Acute reduction of extracellular matrix (ECM) adhesion in single cell (red) causes detachment of that cell from the underlying epidermis and recapitulates the phenotype observed in vivo (bottom right) with the detached cell positioned on top of the cell that maintains ECM adhesion.

Hierarchical organization of multicellular migratory clusters.

Migratory persistence of cell pairs and single cells.

Supracellular cell pairs are more efficient at dispersing pressure from surrounding tissues.

Videos

In silico model of a single migrating trunk ventral cell (TVC).

In silico model of trunk ventral cell (TVC) pair (leader in blue, trailer in red) migrating along a surface.

In silico modeling of cell position rearrangement of two migrating cells using the faster-slower mode of migration.

In silico modeling of cell position rearrangement of two migrating cells using the leader-trailer mode of migration.

In silico modeling of cell position rearrangement of three migrating cells using the faster-slower mode of migration.

In silico modeling of cell position rearrangement of three migrating cells using the leader-trailer mode of migration.

In vivo conversion of anterior tail muscle (ATM) fate to trunk ventral cell (TVC) by misexpression of Mesp>Ras^ca, resulting in migration of four cells.

In vivo conversion of anterior tail muscle (ATM) fate to trunk ventral cell (TVC) by misexpression of Mesp>Ras^ca, resulting in migration of four cells.

In vivo migration of a control trunk ventral cell (TVC) pair.

In vivo migration of a single trunk ventral cell (TVC), produced by misexpression of Foxf >Sar1dn.

Tables

Parameterization of cell-shaping forces, cell adhesion, polarization, and endoderm stiffness for single migrating cells and cell pairs.

Parameterization of migration mode of three migrating cells.

Additional files

Transparent reporting form

Download links

Be the first to read new articles from eLife

Share this article

Cite this article

Model of force distribution in migrating trunk ventral cell (TVC) pairs.

In silico analysis of evolution of single-cell shape and two-cell cohesion under differing force distribution.

Sphericity of leader and trailer cells.

Myosin distribution at the cell-cell junction.

Polarized matrix adhesion promotes adoption of leader/trailer cell state.

Acute reduction of extracellular matrix (ECM) adhesion in single cell (red) causes detachment of that cell from the underlying epidermis and recapitulates the phenotype observed in vivo (bottom right) with the detached cell positioned on top of the cell that maintains ECM adhesion.

Hierarchical organization of multicellular migratory clusters.

Migratory persistence of cell pairs and single cells.

Supracellular cell pairs are more efficient at dispersing pressure from surrounding tissues.

In silico model of a single migrating trunk ventral cell (TVC).

In silico model of trunk ventral cell (TVC) pair (leader in blue, trailer in red) migrating along a surface.

In silico modeling of cell position rearrangement of two migrating cells using the faster-slower mode of migration.

In silico modeling of cell position rearrangement of two migrating cells using the leader-trailer mode of migration.

In silico modeling of cell position rearrangement of three migrating cells using the faster-slower mode of migration.

In silico modeling of cell position rearrangement of three migrating cells using the leader-trailer mode of migration.

In vivo conversion of anterior tail muscle (ATM) fate to trunk ventral cell (TVC) by misexpression of Mesp>Rasca, resulting in migration of four cells.

In vivo conversion of anterior tail muscle (ATM) fate to trunk ventral cell (TVC) by misexpression of Mesp>Rasca, resulting in migration of four cells.

In vivo migration of a control trunk ventral cell (TVC) pair.

In vivo migration of a single trunk ventral cell (TVC), produced by misexpression of Foxf >Sar1dn.

Parameterization of cell-shaping forces, cell adhesion, polarization, and endoderm stiffness for single migrating cells and cell pairs.

Parameterization of migration mode of three migrating cells.

Transparent reporting form

In vivo conversion of anterior tail muscle (ATM) fate to trunk ventral cell (TVC) by misexpression of Mesp>Ras^ca, resulting in migration of four cells.

In vivo conversion of anterior tail muscle (ATM) fate to trunk ventral cell (TVC) by misexpression of Mesp>Ras^ca, resulting in migration of four cells.