1. Cell Biology

The relative binding position of Nck and Grb2 adaptors impacts actin-based motility of Vaccinia virus

  1. Angika Basant  Is a corresponding author
  2. Michael Way  Is a corresponding author
  1. Cellular Signalling and Cytoskeletal Function Laboratory, The Francis Crick Institute, United Kingdom
https://doi.org/10.7554/eLife.74655
Share this article
Cite this article
  1. Angika Basant
  2. Michael Way
(2022)
The relative binding position of Nck and Grb2 adaptors impacts actin-based motility of Vaccinia virus
eLife 11:e74655.
https://doi.org/10.7554/eLife.74655
  2. Download BibTeX
  3. Download .RIS

Abstract

Phosphotyrosine (pTyr) motifs in unstructured polypeptides orchestrate important cellular processes by engaging SH2-containing adaptors to assemble complex signalling networks. The concept of phase separation has recently changed our appreciation of multivalent networks, however, the role of pTyr motif positioning in their function remains to be explored. We have now investigated this parameter in the operation of the signalling cascade driving actin-based motility and spread of Vaccinia virus. This network involves two pTyr motifs in the viral protein A36 that recruit the adaptors Nck and Grb2 upstream of N-WASP and Arp2/3 complex-mediated actin polymerisation. Manipulating the position of pTyr motifs in A36 and the unrelated p14 from Orthoreovirus, we find that only specific spatial arrangements of Nck and Grb2 binding sites result in robust N-WASP recruitment, Arp2/3 complex driven actin polymerisation and viral spread. This suggests that the relative position of pTyr adaptor binding sites is optimised for signal output. This finding may explain why the relative positions of pTyr motifs are frequently conserved in proteins from widely different species. It also has important implications for regulation of physiological networks, including those undergoing phase transitions.

Editor's evaluation

The authors have previously established that the binding of the NCK and GRB2 SH2/SH3 adaptor proteins to their cognate pTyr sites in the C-terminal cytoplasmic domain of the viral A36 protein embedded in the Vaccinia virion membrane is important for the formation of actin tails on the virion that drive intracellular virus motility and cell to cell spread. Here, they made the surprising observation that it is essential to have the NCK-binding site upstream of the GRB2-binding site for the formation of functional actin tails. This suggests that precise spatial organization of signaling protein complexes that drive actin cytoskeleton assembly is key to optimal signal output, and, by extension, this principle may be important in other signaling pathways with multiple inputs.

https://doi.org/10.7554/eLife.74655.sa0

Introduction

Multicellular animals extensively use phosphotyrosine (pTyr) signals for growth, communication, movement, and differentiation (Jin and Pawson, 2012; Lim and Pawson, 2010). Pathways including EGF and insulin receptor signalling, as well as T cell activation rely on pTyr motifs interacting with SH2 domains (Blumenthal and Burkhardt, 2020; Lemmon and Schlessinger, 2010). SH2 domains are present in kinases, phosphatases as well as adaptor proteins that lack enzymatic activity but couple upstream signalling events to downstream function (Liu and Nash, 2012). Examples of such adaptors include Shc1, Crk, Nck, and Grb2 that also contain other interaction modules such as SH3 domains that bind polyproline (PxxP) motifs (Bywaters and Rivera, 2021; Mayer, 2015). pTyr signalling is often dysregulated in cancers and other diseases. For example, EGF receptors can be mutationally activated or present in high copy numbers vis-à-vis their cognate adaptors, and oncogenic mutations frequently map to SH2 domains (Li et al., 2012a; Li et al., 2021; Shi et al., 2016; Sigismund et al., 2018). It therefore remains important to understand the molecular principles of how pTyr-dependent signalling networks function.

pTyr motifs commonly occur in poorly ordered, unstructured regions of proteins (Stavropoulos et al., 2012; Van Roey et al., 2014). Moreover, a single polypeptide may be phosphorylated more than once to generate multiple SH2 domain binding sites creating a large network of interactions with many signalling modules. Indeed, like many receptor tyrosine kinases, the C terminus of EGFR is disordered (Figure 1—figure supplement 1A; Keppel et al., 2017; Pinet et al., 2021). This region contains several pTyr motifs including those that bind Grb2 and Shc1 (Batzer et al., 1994; Lin et al., 2019; Mandiyan et al., 1996; Smith et al., 2006; Ward et al., 1996). The relative positions of these motifs are conserved across vertebrates (Figure 1—figure supplement 1B). Though they are short and space-efficient, linear motifs bearing such pTyr must interact with effectors comprising globular domains of varying sizes. Additionally, disordered sequences can become structured when bound to their respective domains (Davey, 2019; Nioche et al., 2002; van der Lee et al., 2014). Given that such factors are likely to impose constraints or ‘polarity’ on the architecture of signalling networks, can the positioning of motifs have an impact on function? If yes, this would suggest that pTyr motifs cannot be repositioned as they are optimised to achieve the desired signalling output.

In recent years, the framework of phase separation or biomolecular condensates has shed new light on signalling network organisation (Banani et al., 2017; Huang et al., 2019; Li et al., 2012b; Zhao and Zhang, 2020). Integral membrane proteins with disordered cytoplasmic regions and involved in multivalent pTyr-SH2 interactions such as Linker for Activation of T cells (LAT) and the kidney podocyte regulator nephrin form phase separated condensates at critical concentrations (Case et al., 2019; Ditlev et al., 2019; Kim et al., 2019; Pak et al., 2016; Su et al., 2016). This striking property is thought to contribute to their signalling function. As these proteins have been largely investigated by overexpressing components in cells or by reconstitution in vitro, we are yet to fully understand how the underlying principles of condensate organisation regulate physiological signalling (Alberti et al., 2019; Mayer and Yu, 2018; McSwiggen et al., 2019). Furthermore, the relationship between pTyr motifs in these systems has only been explored via mutational disruption of the sites (Huang et al., 2017) and the role of their positioning has not been investigated. Do membrane signalling proteins make stochastic connections with their downstream components or do underlying wiring principles involving site-specific or favoured interactions exist? We chose to investigate the importance of pTyr motif positioning in a physiologically relevant model, that of Vaccinia virus egress from its infected host cell (Leite and Way, 2015).

Following replication and assembly, Vaccinia virus recruits kinesin-1 via WD/WE motifs in the cytoplasmic tail of A36 an integral viral membrane protein to transport virions to the cell periphery on microtubules (Dodding et al., 2011; Figure 1). After viral fusion with the plasma membrane, extracellular virions that remain attached to the cell locally activate Src and Abl family kinases (Frischknecht et al., 1999; Newsome et al., 2004; Newsome et al., 2006; Reeves et al., 2005). This results in phosphorylation of tyrosine 112 and 132 in a disordered region of A36 once it incorporates into the plasma membrane when the virus fuses at the cell periphery (Frischknecht et al., 1999; Newsome et al., 2004; Newsome et al., 2006; Reeves et al., 2005; Ward and Moss, 2004; Figure 1, Figure 1—figure supplement 1 – supplement 1C). pTyr 112 and 132 motifs bind the SH2 domains of adaptors Nck and Grb2, respectively (Scaplehorn et al., 2002). Nck recruits N-WASP via WIP to activate the Arp2/3 complex at the virus (Donnelly et al., 2013). The resulting actin polymerisation drives virus motility and enhances its cell-to-cell spread (Ward and Moss, 2004). Nck is essential for actin tail formation, while Grb2 recruitment helps stabilise the signalling complex (Frischknecht et al., 1999; Scaplehorn et al., 2002; Weisswange et al., 2009). Additionally, NPF motifs in A36 interact with the RhoGEF intersectin to recruit Cdc42 and clathrin to the virus, further enhancing actin polymerisation (Humphries et al., 2012; Humphries et al., 2014; Snetkov et al., 2016; Figure 1). The turnover rates of Nck, Grb2, and N-WASP beneath extracellular virions are highly reproducible with little variability, suggesting the signalling network has a defined organisation (Weisswange et al., 2009). This underlying organisation may arise from the fact that both WIP and N-WASP only have two Nck-binding sites, each with distinct preferences for the three adaptor SH3 domains (Donnelly et al., 2013). This Nck-dependent signalling network is not unique to Vaccinia and is also used to polymerise actin by nephrin in kidney podocytes and the pathogenic E. coli EPEC protein Tir (Hayward et al., 2006; Jones et al., 2006; Welch and Way, 2013).

Figure 1 with 1 supplement see all
Download asset Open asset
A36 interactions and the Vaccinia signalling network.

A schematic showing the Vaccinia virus protein A36 and its known interactors. Kinesin-1 that drives microtubule-based transport of virions to the plasma membrane binds the WD/WE motifs. Nck and Grb2 bind Y112 and Y132 respectively when they are phosphorylated by Src and Abl family kinases. Nck and Grb2 interact with WIP and N-WASP via their SH3 domains, which results in the activation of the Arp2/3 complex and stimulation of actin polymerisation. The region deleted in A36 after residue 139 (red triangle) to abolish the involvement of the RhoGEF intersectin and its binding partners clathrin and Cdc42 is shown in grey. For simplicity, the A36 molecule has been illustrated as extending into the cytosol perpendicular to the membrane, but its exact orientation is unknown.

Cellular pTyr networks are typically transient and can be difficult to detect, making them challenging to manipulate and study quantitatively (Sharma et al., 2014). In contrast, the Vaccinia virus signalling network and actin tail formation are robust and sustained. Vaccinia therefore provides an in vivo genetically tractable system where outputs of actin polymerisation, virus speed and spread can be quantitatively measured. Using recombinant Vaccinia viruses, including ones expressing Orthoreovirus protein p14 (Figure 1—figure supplement 1C), we uncovered a striking impairment in actin-based motility and spread of the virus when the relative positions of Nck and Grb2 pTyr binding motifs were manipulated. Our results indicate that the relative positioning of pTyr motifs and downstream adaptor binding is an important factor in the output of signalling networks that has previously been overlooked.

Results

A minimal system to investigate how pTyr signalling regulates actin polymerisation

The recruitment of Nck by A36 at pTyr112 is necessary and sufficient to drive actin-based motility of Vaccinia virus, whereas Grb2 recruitment at pY132 improves actin tail formation (Frischknecht et al., 1999; Scaplehorn et al., 2002; Weisswange et al., 2009). In addition to these two adaptors, the recruitment of intersectin, Cdc42 and clathrin by full-length A36 also indirectly regulates the extent of virus-driven actin polymerisation (Humphries et al., 2012; Humphries et al., 2014; Snetkov et al., 2016). To reduce the complexity arising from these interactions and other unknown A36 binding partners, we generated a recombinant virus that recruits a minimal signalling network to activate Arp2/3 complex driven actin polymerisation (Figure 1). To achieve this goal, the WR–ΔA36R virus lacking the A36 gene was rescued with an A36 variant that terminates after the Grb2 binding site at residue 139 (referred to as the A36 N-G virus hereafter). This shorter A36 variant retains the WD/WE kinesin-1 binding motifs that are required for microtubule-based transport of the virus to the plasma membrane. As in the full-length protein, actin tail formation induced by this shorter A36 variant depends on the Nck-binding site (Figure 2—figure supplement 1A, A36 N-G vs X-G). Similar to the intact protein, truncated A36 induces shorter actin tails in the absence of Grb2 recruitment (Figure 2—figure supplement 1A, A36 N-G vs N-X). Having confirmed the role of Nck and Grb2 is the same as in the wild-type virus, we used the A36 N-G virus to explore the role of pTyr motif positioning in signalling output.

The relative positioning of Nck and Grb2-binding impacts actin polymerisation

Residues N-terminal to the Tyr (positions –4 to –1) are important for tyrosine kinase site recognition while SH2 domain binding specificity is typically based on +1 to +6 residues C-terminal to the pTyr (Blasutig et al., 2008; Frese et al., 2006; Kefalas et al., 2018; Songyang and Cantley, 1995; Wagner et al., 2013). Given these previous observations, we compared actin polymerisation, virus motility and spread of the A36 N-G virus with a recombinant virus where 12 residues surrounding the pTyr112 Nck-binding site were exchanged with the pTyr132 Grb2 interaction motif (Figure 2A and A36 G-N virus hereafter). This modified virus maintains requirements for Src and Abl mediated phosphorylation as well as Nck and Grb2 SH2 binding. Strikingly, exchanging the positions of these two pTyr motifs impacts the length of actin tails though the number of extracellular virus particles inducing actin polymerisation remains unaltered (Figure 2B). It is possible that this effect is a consequence of the relative positioning of the two adaptor binding sites in A36. Alternatively, it may be that the Nck-binding site is sub-optimal when it is repositioned into the Grb2-binding locus. To determine which is true, we assessed the impact of changing the position of the Nck-binding site in the absence of Grb2 recruitment. We found that viruses A36 N-X and X-N that lack a Grb2 binding site (N-X: Nck binds in native position and X-N: Nck binds in Grb2 position), did not differ considerably in their extent or ability to induce actin tails, although there is a mild impact on actin tail length (p=0.18) (Figure 2—figure supplement 1B). Curiously, having two Nck or Grb2 binding sites does not improve the ability of a single adaptor to promote actin polymerisation (Figure 2—figure supplement 2A). The length of actin tails was also not influenced by extending the linker between the adaptor binding sites (Figure 2—figure supplement 2B). Collectively, our observations suggest that the relative positioning and number of Nck and Grb2 phosphotyrosine motifs in A36 is optimised for the signalling output (efficient actin polymerisation).

Figure 2 with 2 supplements see all
Download asset Open asset
Phosphotyrosine motif position impacts actin-based motility and viral spread.

(A) C-terminal amino acid sequence of A36 in recombinant viruses showing the position of phosphotyrosine motifs in their wild-type (A36 N-G) and swapped (A36 G-N) configurations. (B) Representative immunofluorescence images of actin tails in HeLa cells infected with the indicated virus at 8 hr post-infection. Actin is stained with phalloidin, and extra-cellular virus particles attached to plasma membrane are labelled using an antibody against the viral protein B5. Scale bar = 3 μm. The graphs show quantification of number of extracellular virus particles inducing actin tails and their length. A total of 270 actin tails were measured in three independent experiments. (C) Temporal colour-coded representation of time-lapse movies tracking the motility of the indicated RFP-A3-labelled virus over 50 s at 8 hr post infection (Video 1). Images were recorded every second and the position of virus particles at frame 1 (yellow triangles) and frame 50 (red triangles) are indicated. Scale bar = 3 μm. The graph shows quantification of virus speed over 50 s. A total of 82 virus particles were tracked in three independent experiments. (D) Representative images and quantification of plaque diameter produced by the indicated virus in confluent BS-C-1 cells 72 hr post-infection. Sixty-four plaques were measured in three independent experiments. Scale bar = 3 mm. All error bars represent S.D and the distribution of the data from each experiment is shown using a ‘SuperPlot’. Welch’s t test was used to determine statistical significance; ns, p>0.05; * p≤0.05; ** p≤0.01.

Figure 2—source data 1

Datasheets for graphs and summary statistics.

https://cdn.elifesciences.org/articles/74655/elife-74655-fig2-data1-v2.zip

Actin polymerisation at the virus drives both the motility and spread of virions. To test whether motif positioning influences the former, we imaged cells infected with the A36 N-G or A36 G-N viruses expressing A3, a viral core protein tagged with RFP. In the swapped configuration, corresponding to reduced actin polymerisation, virus motility is slower (Figure 2C, Video 1). In addition, the A36 G-N virus has reduced cell-to-cell spread as it forms smaller plaques on confluent cell monolayers compared to A36 N-G (Figure 2D; Figure 2—figure supplement 1C). Our observations with Vaccinia clearly demonstrate that the output of a signalling network is strongly influenced by the relative positioning of Nck and Grb2 binding sites in the membrane protein responsible for initiating the signalling cascade.

Video 1
Download asset
Phosphotyrosine motif position impacts actin-based motility of Vaccinia virus.

HeLa cells stably expressing LifeAct-iRFP670 (green) were infected with either the A36 N-G or A36 G-N virus labelled with RFP-A3 (magenta) for 8 hr. Images were taken every second. Video plays at 5 frames per second. The RFP-A3 signal was used to generate the temporal colour-coded representation in Figure 2C. The time in seconds is indicated, and the scale bar = 3 µm.

Inducing actin polymerisation using a synthetic signalling network

We were curious whether our observations were unique to Vaccinia A36 and/or if the positioning of adaptor binding sites would also be important in a different context. We took advantage of the Vaccinia signalling platform to generate a synthetic pTyr network that replaces A36 with a different protein capable of activating actin polymerisation via the same adaptors. Unfortunately, we could not identify a host receptor that signals to actin via Nck and Grb2. Recent observations, however, demonstrate that p14, an integral membrane protein from Orthoreovirus activates N-WASP via Grb2 to regulate cell fusion (Chan et al., 2020). Grb2 is recruited by a pTyr116 motif located in the short cytoplasmic tail of p14 that is also predicted to be disordered (Figure 1—figure supplement 1C). Interestingly, examination of the p14 sequence reveals there are two tyrosine residues predicted to interact with Nck located 16 and 20 amino acids upstream of the pTyr116 (Eukaryotic Linear Motif (ELM) and Scansite 4.0) (Kumar et al., 2020; Obenauer et al., 2003; Figure 3A). To determine whether these sites participate in actin polymerisation, we generated a hybrid construct comprising the first 105 amino acids of A36 including the kinesin-1-binding motifs required to traffic virions to the plasma membrane and residues 79–125 of p14 (Figure 3A). Transient expression of p14 N-G in cells infected with Vaccinia virus lacking A36 results in extracellular virions inducing robust actin tails that were dependent on the presence of N-WASP (Figure 3B and C). Given this, we mutated Tyr96, 100 and 116 of p14 in turn and examined the impact on actin tail formation. This analysis reveals there is no role for Tyr100 as its mutation to phenylalanine had no impact on actin tail formation (Figure 3D). In contrast, Tyr96 is essential for the virus induced actin polymerisation. As with Vaccinia A36, the ability of transiently expressed p14 N-G to promote actin polymerisation primarily depends on the predicted Nck-binding pTyr96 and is enhanced by pTyr116 (Figure 3D and E). Disrupting these sites via Y96F and Y116F mutations in p14 N-G results in loss of Nck and Grb2 recruitment to the virus respectively (Figure 3—figure supplement 1A). When phosphorylated, Tyr116 is a bona fide Grb2-binding site (Chan et al., 2020). To verify pTyr96 interacts with Nck, we incubated HeLa cell lysates with beads conjugated with peptides containing the prospective binding motif. The pTyr96 peptide retains Nck from the cell lysate but not the unphosphorylated control (Figure 3F). The peptide also does not bind Grb2. Consistent with our observation that Tyr100 plays no part in actin polymerisation, the pTyr100 peptide does not bind either adaptor (Figure 3—figure supplement 1B). Our observations clearly demonstrate that as with Vaccinia A36, p14 of Orthoreovirus induces actin polymerisation using a Nck and Grb2 signalling network. These results also establish that the Vaccinia platform can be used to establish synthetic signalling networks and test predictions concerning their operation.

Figure 3 with 1 supplement see all
Download asset Open asset
Generating and validating an A36-p14 hybrid that can polymerise actin.

(A) Schematic showing a hybrid construct (referred to as p14 N-G) comprising the first 105 residues of A36 and the C-terminal residues 79–125 of Orthoreovirus p14 protein. Positions of the predicted Nck-binding sites at Tyr96 and Tyr100, and the previously established Grb2-binding site at Tyr116 are shown together with their respective sequences. (B) Representative immunofluorescence images of actin tails in HeLa cells infected with Vaccinia virus lacking the A36 gene and transiently expressing the indicated constructs under the A36 promoter at 8 hr post-infection. Actin is stained with phalloidin, and extra-cellular virus particles attached to plasma membrane are labelled using an anti-B5 antibody. Scale bar = 3 μm. (C) Representative immunofluorescence images of N-WASP null or parental mouse embryonic fibroblast cells infected with Vaccinia virus lacking the A36 gene and transiently expressing the p14 N-G construct under the A36 promoter at 16 hr post-infection. Actin is stained with phalloidin, and extra-cellular virus particles are labelled using an anti-B5 antibody. Scale bar = 3 μm. The graph shows quantification of actin tail number per extracellular virus particle. Error bars represent S.D. from three independent experiments. Welch’s t test was used to determine statistical significance; * p≤0.05. (D) and (E) Quantification of the number of extracellular virus inducing actin tails together with their length in HeLa cells infected with Vaccinia virus lacking the A36 gene and transiently expressing p14 N-G constructs under the A36 promoter with indicated Tyr to Phe mutations, at 8 hr post-infection. 125 actin tails were measured in three independent experiments, except in mutants Y96F and Y116F where fewer actin tails were made. All error bars represent S.D and the distribution of the data from each experiment is shown using a ‘SuperPlot’. Dunnett’s multiple comparison’s test (for panel D) and Welch’s t test (for panel E) were used to determine statistical significance; ns, p>0.05; ** p≤0.01; *** p≤0.001. (F) Immunoblot analysis of peptide pulldowns showing that endogenous Nck from HeLa cell lysates binds to phosphopeptides corresponding to Tyr96 from the Orthoreovirus p14 and Tyr112 of the Vaccinia A36 but not to their unphosphorylated counterparts.

Figure 3—source data 1

Datasheets for graphs, summary statistics and raw immunoblots.

https://cdn.elifesciences.org/articles/74655/elife-74655-fig3-data1-v2.zip

Given this, we generated a recombinant virus where endogenous A36 was replaced with the hybrid A36-p14 protein (henceforth referred to as the p14 N-G virus). As previously observed with Vaccinia A36, actin tails generated by the p14 N-G virus recruit endogenous Nck, WIP, and N-WASP to the virion (Figure 4A). In the absence of an antibody that can detect Grb2, we confirmed the p14 N-G virus also recruits Grb2 by infecting HeLa cells stably expressing GFP-Grb2 (Figure 4A; Figure 4—figure supplement 1). We next sought to determine whether the relative positioning of the Nck and Grb2 binding sites was important for the signalling output of p14. To address this question, we generated a recombinant virus (p14 G-N virus) where the Nck- and Grb2-binding motifs of p14 are in a swapped orientation (Figure 4B). Remarkably, as we observed for A36, swapping these motifs did not impact on the number of viruses inducing actin polymerisation but resulted in shorter actin tails and a slower virus speed (Figure 4C and D, Video 2). Plaque assays on confluent cell monolayers reveals that the p14 G-N virus is also attenuated in its spread when compared to p14 N-G (Figure 4E). Once again, the signalling output of the system clearly depends on the relative positioning of Nck and Grb2 pTyr binding sites.

Figure 4 with 1 supplement see all
Download asset Open asset
Phosphotyrosine motif position in a A36-p14 hybrid protein impacts actin polymerisation.

(A) Representative images showing the recruitment of Nck, WIP, Grb2, and N-WASP to actin tails in HeLa cells infected with a recombinant virus expressing the p14 N-G construct at the A36 locus at 8 hr post-infection. Endogenous Nck, N-WASP and WIP were detected with antibodies and actin is labelled with phalloidin. To ascertain Grb2 localisation, infected HeLa cells stably expressing GFP-Grb2 and transiently expressing LifeAct iRFP were imaged live. Scale bar = 2 μm. (B) C-terminal amino acid sequence of the A36 -p14 hybrid in recombinant viruses showing the positions of phosphotyrosine motifs in their wild-type (p14 N-G) and swapped (p14 G-N) configurations. (C) Representative immunofluorescence images of actin tails in HeLa cells infected with the indicated virus at 8 hr post-infection. Actin is stained with phalloidin, and extra-cellular virus particles are using an anti-B5 antibody. Scale bar = 3 μm. The graphs show quantification of number of extracellular virus particles inducing actin tails and their length. 336 actin tails were measured in four independent experiments. (D) Temporal colour-coded representation of time-lapse movies tracking the motility of the indicated RFP-A3-labelled virus over 50 s at 8 hr post infection (Video 2). Images were recorded every second and the position of virus particles at frame 1 (yellow triangles) and frame 50 (red triangles) are indicated. Scale bar = 3 μm. The graph shows quantification of virus speed over 50 s. Seventy-five virus particles were tracked in three independent experiments. (E) Representative images and quantification of plaque diameter produced by the indicated virus in confluent BS-C-1 cells 72 hr post-infection. Seventy-two plaques were measured in three independent experiments. Scale bar = 3 mm. All error bars represent S.D and the distribution of the data from each experiment is shown using a ‘SuperPlot’. Welch’s t test was used to determine statistical significance; ns, p>0.05; * p≤0.05; ** p≤0.01.

Figure 4—source data 1

Datasheets for graphs and summary statistics.

https://cdn.elifesciences.org/articles/74655/elife-74655-fig4-data1-v2.zip
Video 2
Download asset
Phosphotyrosine motif position impacts actin-based motility driven by p14 N-G virus.

HeLa cells stably expressing LifeAct-iRFP670 (green) were infected with either the p14 N-G or p14 G-N virus labelled with RFP-A3 (magenta) for 8 hr. Images were taken every second. Video plays at 5 frames per second. The RFP-A3 signal was used to generate the temporal colour-coded representation in Figure 4D. The time in seconds is indicated, and the scale bar = 3 µm.

Why does the relative position of adaptor binding sites impact actin polymerisation?

To further probe into how pTyr motif positioning impacts signalling output, we focused on the A36 signalling network given we have a deeper understanding of how it functions. The simplest explanation for the difference between the signalling output of the N-G and G-N configurations is that the levels of A36 are different between the two viruses. To examine if this is the case, we generated recombinant viruses where the A36 N-G and G-N variants were tagged at their C-terminus with TagGFP2. We measured the fluorescent intensity ratio of TagGFP2 to the viral core protein A3 fused to RFP. RFP-A3 provides a reliable internal reference marker as its fluorescent intensity is consistent across different viruses and cell lines expressing GFP-tagged components of the Vaccinia signalling network (Figure 5—figure supplement 1A). We found no significant difference between the levels of A36 N-G and G-N relative to RFP-A3 on particles generating actin tails (Figure 5—figure supplement 1B). This suggests that the underlying cause for the difference in signalling output resides in the network itself. We therefore determined the level of recruitment of components involved in activating the Arp2/3 complex on the virus. We infected HeLa cells stably expressing GFP-tagged Nck, Grb2, WIP, or N-WASP (Figure 4—figure supplement 1) and measured their respective GFP intensities on the virus relative to RFP-A3 as an internal fluorescent standard. We found that the levels of Nck are comparable between the A36 N-G and G-N viruses (Figure 5A). In contrast, Grb2 and N-WASP were significantly reduced on the G-N virus (Figure 5A). The level of WIP, which is also recruited to actin tails is lower in the G-N configuration (Figure 5—figure supplement 1C). To confirm these results, we took advantage of Mouse Embryonic Fibroblast (MEF) cell lines stably expressing GFP-tagged Nck- or N-WASP but lacking their respective endogenous proteins (Figure 5—figure supplement 2). We found that as seen in HeLa cells, the levels of GFP-Nck were similar for both viruses but the A36 G-N virus recruited twofold less GFP-N-WASP than the N-G variant (Figure 5B). It is possible that the reduction in N-WASP is a consequence of lower Grb2 levels as this adaptor helps stabilise N-WASP on the virus (Weisswange et al., 2009). To examine this possibility, we measured N-WASP levels on the A36 N-X virus where the Grb2-binding site is abolished by a Tyr132 to Phe mutation. Loss of Grb2 binding had no appreciable impact on the levels of Nck recruited to the A36 N-X virus as compared to those associated with the A36 N-G and G-N viruses (Figure 5C). The levels of N-WASP on the A36 N-X virus were reduced (46.4%) but not to the same extent as the A36 G-N virus (75%). Repositioning the Nck and Grb2 sites clearly leads to a more severe impairment of the ability of the signalling network to activate Arp2/3 complex driven actin polymerisation than loss of the Grb2 site. Moreover, this suggests that Grb2 has a dominant negative effect when it is mis-positioned relative to Nck.

Figure 5 with 2 supplements see all
Download asset Open asset
N-WASP recruitment is impaired when Grb2 binding is repositioned in A36.

(A) Representative images showing the indicated GFP-tagged protein recruitment to RFP-A3 labelled virus particles in live HeLa cells infected with the indicated viruses at 8 hr post-infection. Scale bar = 2 μm. The graphs show quantification of GFP:RFP-A3 fluorescence intensity ratio. Intensity of 90 virus particles was measured in three independent experiments. (B) Left - The graph shows quantification of GFP-Nck:RFP-A3 fluorescence intensity ratio on virus particles in live mouse embryonic fibroblasts (MEFs) lacking both Nck1 and Nck2 and stably expressing GFP-Nck1 at 16 hr post-infection. Intensity of 75 virus particles was measured in three independent experiments. Right - The graph shows quantification of GFP-N-WASP:RFP-A3 fluorescence intensity ratio on virus particles in live N-WASP-/- MEFs stably expressing GFP-N-WASP infected with the indicated viruses at 16 hr post-infection. Intensity of 75 virus particles was measured in three independent experiments. (C) The graphs show quantification of GFP:RFP-A3 fluorescence intensity ratio on virus particles in live HeLa cells stably expressing the indicated GFP-tagged protein infected with the A36 N-G, G-N, or N-X viruses at 8 hr post-infection. Intensity of 90 virus particles was measured in three independent experiments. All error bars represent S.D and the distribution of the data from each experiment is shown using a ‘SuperPlot’. Dunnett’s multiple comparison’s test (for panel C) or Welch’s t test (remaining panels) were used to determine statistical significance; ns, p>0.05; * p≤0.05; ** p≤0.01.

Figure 5—source data 1

Datasheets for graphs and summary statistics.

https://cdn.elifesciences.org/articles/74655/elife-74655-fig5-data1-v2.zip

Adaptor motif repositioning does not affect tyrosine phosphorylation of A36

A possible explanation for the impairment in the A36 G-N signalling network is that adaptor motif repositioning impacts kinase recruitment and/or its ability to induce tyrosine phosphorylation. Immunoblot analysis of whole cell lysates with anti-phosphotyrosine antibody demonstrates that A36 phosphorylation in the A36 G-N virus infected cells is comparable to that seen with the A36 N-G virus (Figure 6—figure supplement 1A). This bulk assay reports on the total cellular pool of A36 rather than the specific fraction of A36 that is phosphorylated by Src and Abl family kinases at the plasma membrane (Newsome et al., 2004). To directly investigate whether kinase recruitment to individual virus particles is affected by motif position, we examined the recruitment of Src-GFP to RFP-A3 labeled A36 N-G or A36 G-N viruses in HeLa cells stably expressing LifeAct iRFP. Quantification of Src-GFP at the tip of actin tails reveals that the A36 N-G and G-N viruses recruit similar levels of the tyrosine kinase (Figure 6A). Furthermore, immunofluorescence analysis with a Src antibody that detects phosphorylated tyrosine 418 (Src pY418) reveals a similar level of activated kinase is associated with both viruses (Figure 6B).

Figure 6 with 1 supplement see all
Download asset Open asset
The Nck and Grb2-binding sites in A36 are phosphorylated when motif positions are changed.

(A) Representative images showing Src-GFP recruitment to RFP-A3 labelled virus particles in live HeLa cells infected with the indicated viruses at 8 hr post-infection. Scale bar = 4 μm. The graphs show quantification of GFP:RFP-A3 fluorescence intensity ratio. Intensity of 90 virus particles was measured in three independent experiments. (B) Representative immunofluorescence images of Src pY418 antibody labelling of indicated virus inducing actin tails in HeLa cells at 8 hr post-infection. Actin is stained with phalloidin. Scale bar = 2 μm. The graph shows quantification of background-subtracted antibody intensity at the tip of actin tails (k=1000 a.u.). Intensity of 75 virus particles was measured in three independent experiments.(C) Representative images showing GFP-Nck (SH2) recruitment to RFP-A3-labelled virus particles in live Nck-/- MEF cells infected with the indicated viruses at 16 hr post-infection. Scale bar = 2 μm. The graphs show quantification of GFP:RFP-A3 fluorescence intensity ratio. Intensity of 75 virus particles was measured in three independent experiments. (D) Representative immunofluorescence images of A36 pY132 antibody labelling of indicated virus inducing actin tails in HeLa cells at 8 hr post-infection. Actin is stained with phalloidin. A36 N-X is a virus where the A36 Grb2-binding site is disrupted with by Tyr to Phe point mutation. Scale bar = 2 μm. The graph shows quantification of background-subtracted antibody intensity at the tip of actin tails. Intensity of 90 virus particles was measured in three independent experiments. All error bars represent S.D. and the distribution of the data from each experiment is shown using a ‘SuperPlot’. Tukey’s multiple comparison’s test (for panel D) and Welch’s t test (remaining panels) were used to determine statistical significance; ns, p>0.05; * p≤0.05; ** p≤0.01. White arrowheads indicate virus position.

Figure 6—source data 1

Datasheets for graphs and summary statistics.

https://cdn.elifesciences.org/articles/74655/elife-74655-fig6-data1-v2.zip

The comparable levels of Nck recruitment to the A36 N-G and G-N viruses (Figure 5A) suggests that phosphorylation of Tyr112 (the Nck-binding site) is not impacted by changing its position within A36. To confirm that this is the case in the absence of downstream components, we examined the ability of A36 N-G and G-N viruses to recruit GFP-Nck SH2 in MEFs lacking both Nck1 and Nck2 (Bladt et al., 2003). GFP-Nck SH2 is a specific probe for pTyr112 as it is not recruited to the A36 X-G virus which lacks this site (Figure 6—figure supplement 1B). We found that both A36 N-G and G-N viruses were equally efficient at recruiting GFP-Nck SH2 (Figure 6C). These data clearly demonstrate that phosphorylation of the Nck binding motif is not affected by its position. As Grb2 recruitment is impaired in the G-N virus we also sought to determine whether phosphorylation of its binding site (Tyr132) is reduced. Immunofluorescence analysis with an antibody that detects pTyr132 (Newsome et al., 2004) reveals that tyrosine 132 is phosphorylated on the A36 N-G and G-N but not N-X (negative control lacking Grb2 binding site) virus particles inducing actin tails (Figure 6D). The lack of labelling of the N-X virus demonstrates that the antibody is specific as it does not detect any other phosphorylated component in the signalling network involved in nucleating actin tails. Moreover, the intensity of labelling was significantly higher on the G-N compared to the N-G virus, suggesting there is no impairment in phosphorylation. This enhanced labelling intensity most likely reflects increased antibody access to its pTyr132 epitope in the absence of Grb2 recruitment (Figure 5A). To test this possibility, we determined the level of pTyr132 antibody labelling on the A36 N-G virus when Grb2 is knocked down using siRNA. We found that there was a trend for increased labelling on the A36 N-G virus when the levels of Grb2 were reduced (Figure 6—figure supplement 1C). This increase is less dramatic than the G-N virus most likely because the knockdown is not complete and the virus efficiently recruits any remaining Grb2. Taken together, our observations suggest that the lower levels of Grb2 recruitment observed when its binding site is repositioned are a consequence of other changes in the signalling network rather than a reduction in phosphorylation of Tyr132.

Position rather than the number of Grb2 sites influences actin polymerisation

Our data indicate that the reduced signalling output of the A36 G-N virus is linked to decreased levels of Grb2 in the signalling network. This suggests that the position of Grb2 binding relative to Nck is the critical factor influencing the functional output of the network formed by the A36 G-N virus. We therefore wondered what impact an additional Grb2 site would have on virus-induced actin polymerisation? More importantly, would any improvement in signalling output be dependent on the position of this second Grb2 site relative to Nck binding? To address these questions, we generated recombinant G-N viruses expressing A36 with an extra Grb2 site N-terminal (A36 G-G-N virus) or C-terminal (A36 G-N-G virus) to the Nck site (Figure 7A). The spacing and linkers between all new motifs were the same (20 amino acids) as in the original A36 N-G virus. All four viruses (N-G, G-N, G-N-G, and G-G-N) recruited similar levels of Nck and induced comparable numbers of actin tails (Figure 7—figure supplement 1A and B). Nevertheless, the A36 G-N and G-G-N viruses induced the formation of equally short actin tails (Figure 7B). In contrast, the actin tails formed by the A36 G-N-G virus are noticeably longer. A similar trend was also observed for virus speed and spread (Figure 7C and D; Figure 7—figure supplement 2). Strikingly, the G-N-G and N-G viruses recruit similar levels of N-WASP, which are ~2 fold greater than the G-G-N and G-N viruses (Figure 7E). They also recruit significantly more GFP-Grb2 (Figure 7—figure supplement 1C). Grb2 is not essential for Vaccinia actin tail formation but its binding position relative to Nck clearly influences the level of N-WASP recruitment. This subsequently influences the output of the signalling network stimulated by phosphorylation of A36.

Figure 7 with 2 supplements see all
Download asset Open asset
Signalling output can be improved by adding a new Grb2 binding site, but only in a position-dependent fashion.

(A) C-terminal amino acid sequence of A36 in recombinant viruses showing the position of phosphotyrosine motifs in wild-type (A36 N-G) and swapped (A36 G-N) configurations and with a new Grb2-binding site C-terminal (G–N–G) or N-terminal (G–G–N) to the swapped configuration. (B) Representative immunofluorescence images of actin tails in HeLa cells infected with the indicated virus at 8 hr post-infection. Actin is stained with phalloidin, and extra-cellular virus particles are labelled using an anti-B5 antibody. Scale bar = 5 μm. The graph shows quantification of actin tail length. 195 actin tails were measured in three independent experiments. (C) The graph shows quantification of virus speed from time-lapse movies tracking the motility of the indicated RFP-A3-labelled virus over 50 s at 8 hr post infection. Ninety virus particles were tracked in three independent experiments. (D) Representative images and quantification of plaque diameter produced by the indicated virus in confluent BS-C-1 cells 72 hr post-infection. Sixty plaques were measured in three independent experiments. Scale bar = 2 mm. (E) Representative images showing GFP-N-WASP and RFP-A3 intensity on virus particles in live HeLa cells infected with the indicated viruses recorded 8 hr post-infection. Scale bar = 4 μm. GFP N-WASP intensity data for A36 N-G and G-N viruses is the same as in Figure 5C. The graph shows quantification of GFP-N-WASP:RFP-A3 fluorescence intensity ratio. Intensity of 90 virus particles was measured in three independent experiments. All error bars represent S.D and the distribution of the data from each experiment is shown using a ‘SuperPlot’. Tukey’s multiple comparison test was used to determine statistical significance; ns, p>0.05; * p≤0.05; ** p≤0.01; *** p≤0.001.

Figure 7—source data 1

Datasheets for graphs and summary statistics.

https://cdn.elifesciences.org/articles/74655/elife-74655-fig7-data1-v2.zip

Discussion

Grb2 modulates the ability of Nck to promote actin polymerisation via N-WASP

The pTyr motifs in Vaccinia A36 engage the SH2-SH3 adaptors Nck and Grb2, which play essential roles in many different cellular signalling cascades. For example, Grb2 directly binds EGFR and Ras via its SH2 domain, while the SH2 domain of Nck binds PDGFR and ephrinb1 receptors among others (Bong et al., 2004; Cowan and Henkemeyer, 2018; Lettau et al., 2009; Nishimura et al., 1993; Pramatarova et al., 2003). These adaptors also participate in signalling networks that can undergo phase transitions, including those assembled by the membrane proteins LAT and nephrin in T-cell activation and kidney podocytes, respectively (Case et al., 2019; Ditlev et al., 2019; Kim et al., 2019; Pak et al., 2016; Su et al., 2016). LAT engages Grb2 for its function while nephrin relies on Nck. In the case of Vaccinia, Nck and Grb2 work together in a signalling network that induces Arp2/3 complex-dependent actin polymerisation to enhance the spread of viral infection (Frischknecht et al., 1999; Ward and Moss, 2004).

The virus provides a great model system to dissect this signalling network as it can be easily manipulated using recombinant viruses, infect different cell lines and the output is robust, so it can be readily quantified (Scaplehorn et al., 2002; Weisswange et al., 2009). Taking advantage of this model we examined whether the relative positioning of pTyr motifs plays a role in the signalling output by generating a series of recombinant Vaccinia viruses expressing different A36 derivatives. We also replaced the A36 pTyr motifs with the C-terminus of the unrelated protein p14 from Orthoreovirus, which promotes N-WASP and Arp2/3 complex dependent cell fusion by interacting with Grb2 via a pTyr motif located in its short cytoplasmic tail (Chan et al., 2020). Interestingly, we found that as seen in A36, p14 also contains a functional Nck binding site 20 residues upstream of the Grb2 site. Moreover, the Nck binding site in both proteins plays the dominant role in promoting actin polymerisation, while Grb2 plays a supporting role. This is consistent with previous in vitro observations demonstrating that Grb2 is significantly less efficient than Nck at promoting actin polymerisation via N-WASP and Arp2/3 complex (Carlier et al., 2000; Okrut et al., 2015). Nck is essential for actin tail formation (Scaplehorn et al., 2002; Weisswange et al., 2009), however, its levels alone do not determine signal output, as its recruitment remains constant across the different A36 variants. Despite being a weak promoter of actin polymerisation, the binding position of Grb2 relative to that of Nck is an important determinant of the signalling output. Swapping the position of the two adaptor-binding sites impairs actin-based motility and spread of the virus. The introduction of an additional Grb2 site also only leads to efficient signalling output when placed C-terminal of the Nck binding site. Grb2 appears to limit or impede the ability of Nck to stimulate N-WASP-dependent actin polymerisation.

Optimal signalling output depends on network configuration

Nck and Grb2 are multivalent adaptors that interact with N-WASP to activate the Arp2/3 complex. Grb2 has two SH3 domains that bind N-WASP while the three SH3 domains of Nck engage with WIP and N-WASP (Carlier et al., 2000; Donnelly et al., 2013; Rivera et al., 2004). The linker between the first and second Nck SH3 domains also contributes to N-WASP activation (Banjade et al., 2015; Bywaters and Rivera, 2021; Okrut et al., 2015). These five SH3 domains and their interactions with polyproline (PxxP) motifs could, in principle, be capable of activating N-WASP via multiple routes, a notion consistent with phase transition-based signalling, which is driven by stochastic, multivalent and weak interactions (Fuxreiter and Vendruscolo, 2021; Lyon et al., 2021). Bioinformatic analysis (scan site and ELM) reveals there are 11 and 17 predicted class I and class II SH3-binding PxxP motifs in human N-WASP and WIP, respectively. We find that Grb2-binding pTyr motifs N-terminal to that of Nck lead to reduced recruitment of Grb2 and N-WASP. This suggests that there are preferred configurations of SH3-PxxP interactions to achieve optimal signalling output (actin polymerisation) via Nck/Grb2/N-WASP. Consistent with this, our previous far western analysis demonstrates that WIP and N-WASP each only contain two Nck-binding PxxP sites (Donnelly et al., 2013). Moreover, these sites have differing preferences for the individual SH3 domains of Nck. Recent evidence also indicates that the function of some cellular condensates such as P granules, stress granules, and puncta formed by FUS (fused in sarcoma) have underlying organisational principles (Bienz, 2020; Folkmann et al., 2021; Jain et al., 2016; Kato and McKnight, 2017; Kato et al., 2012). It may be, as our observations suggest, there is a degree of defined, spatial organisation within the interactions in membrane-associated signalling networks. In line with this idea, the importance of purely weak multivalent interactions in driving the assembly and function of signalling complexes has recently been extensively discussed (Musacchio, 2022).

Why does signal output depend on the position of adaptor binding sites?

The Vaccinia signalling network is initiated by phosphorylation of A36 by Src/Abl family kinases (Frischknecht et al., 1999; Newsome et al., 2004; Newsome et al., 2006; Reeves et al., 2005). Unlike many systems where kinases transiently associate with their substrates, Src/Abl family kinases are constitutively associated with Vaccinia viruses undergoing actin-dependent motility. Importantly, repositioning of A36 tyrosine motifs did not impact the levels of total or activated Src kinase detected at the virus (Figure 6A and B). It is, however, still possible that swapping the positions of Nck and Grb2 sites leads to impairment of phosphorylation of Tyrosine 112 or 132 of A36. Multi-site phosphorylation in a protein can be processive, sometimes promoted by SH2 domains of kinases themselves (Mayer et al., 1995). Furthermore, kinases such as ZAP-70 and Syk have tandem SH2 domains, a regulatory feature that can be affected by tyrosine positions in their substrates (Kulathu et al., 2019). However, swapping Nck and Grb2-binding motifs in A36 does not detectably impair their phosphorylation (Figure 6C and D, Figure 6—figure supplement 1A). Moreover, though Grb2 is poorly recruited to the A36 G-N virus (Figure 5A), its binding site remains phosphorylated (Figure 6D). In other systems, pTyr residues that are not bound by their cognate SH2 binding partners are rapidly dephosphorylated by phosphatases (Jadwin et al., 2018; Rotin et al., 1992). Given that Grb2 has a half-life of 140 msec on the wild type virus (Weisswange et al., 2009), it is possible that Grb2 binds A36 G-N weakly with high turnover, thus outcompeting any dephosphorylation. Adaptor proteins like Grb2 can also promote the activity of phosphatases such as Shp2 (Lin et al., 2021). However, as the phosphatases involved in Vaccinia signalling are unknown, this aspect remains unexplored.

Despite being phosphorylated, repositioning of tyrosine motifs may levy spatial constraints for SH2 domain binding to A36. It is striking that the ~20 amino acid spacing between SH2-binding sites in Vaccinia A36 and Orthoreovirus p14 is also observed in the Grb2-binding Tyr171 and Tyr191 in LAT (Huang et al., 2017), Nck-binding Tyr1176, Tyr1193, Tyr1217 in nephrin (Jones et al., 2006) and Grb2-binding Tyr1092 and Tyr1110 in EGFR (Figure 1—figure supplement 1A). This distance could reflect structural constraints imposed by two SH2 adaptors binding nearby pTyr sites. However, evaluation of structural data of SH2 domains bound to pTyr peptides suggests this may not be the case. The Nck1 SH2 domain has a footprint of 12 residues when bound to a phosphopeptide (EEHI-pY-DEVAADP) of Tir (PDB 2CI9), which is responsible for inducing EPEC actin pedestals (Frese et al., 2006). The Tir peptide has significant homology to the region surrounding Tyr112 of A36 (TEHI-pY-DSVAGSY). Furthermore, structures of Grb2-bound phosphopeptides (PDB 1TZE, PDB 1JYR) indicate that the adaptor has an even smaller footprint than that of Nck (Rahuel et al., 1996; Nioche et al., 2002). This would be consistent with space for independent SH2 binding events on A36 with no steric clash. An additional consideration is that the SH2 domain of Grb2 is unique compared to others because its cognate pTyr motif adopts a β-turn conformation when bound rather than an extended conformation (Ettmayer et al., 1999; Kuriyan and Cowburn, 1997; Rahuel et al., 1996). In the absence of essential structural information including that of full-length Nck, we also cannot predict whether the ability of the Grb2 SH2 domain to bind its pTyr site is influenced by the three Nck SH3 domains in the motif-swapped (A36 G-N) configuration.

It is curious that in the three viral proteins our lab has analyzed that are capable of promoting actin polymerisation via Nck and Grb2, namely A36, p14 and YL126 of Yaba-Like Disease Virus (Dodding and Way, 2009), Grb2 binding is C-terminal to that of Nck. It is also striking that there is no functional evidence for Grb2-binding sites upstream of Nck in any integral membrane protein. Interestingly, Grb2 is not recruited to Vaccinia in the absence of N-WASP even when its SH2-binding site on A36 is available (Weisswange et al., 2009). It is likely that in the A36 G-N virus, the SH3-PxxP binding between Grb2 and N-WASP is suboptimal. Taken together we favour that the configuration of SH2-binding pTyr motifs is critical for optimising downstream SH3 domain interactions that lead to actin polymerisation. This may also explain why adding extra Nck and Grb2 sites in A36 do not boost actin polymerisation (Figure 2—figure supplement 2, Figure 7B).

Broader implications of motif positioning in networks involving disordered proteins

Our finding that specific pTyr motif configurations achieve optimal signalling output (actin polymerisation) is highly relevant to modular signalling involving disordered regions of proteins. Disordered proteins, which constitute 40% of the human proteome, are rich in short linear motifs (SLiMs) (Tompa et al., 2014; van der Lee et al., 2014; Wright and Dyson, 2015). Due to their ubiquity and modularity, networks assembled via SLiMs in unstructured peptides are of immense interest to biologists building synthetic signalling systems (Lim, 2010). In synthetic networks, the optimal organisation of globular domains is recognized to influence functionality, for example in the construction of chimeric antigen receptors (CARs) (Finney et al., 1998). However, the relative position of SLiMs within a complex network was not considered to play a role possibly because poorly structured polypeptides are assumed to be very flexible. More recently, CAR T-cell phenotypes were found to strongly depend on motif positioning in combinatorial libraries of non-natural SLiMs (Daniels et al., 2022). Future studies will confirm whether the influence of motif position on signalling output is a conserved property in other networks. Moreover, as viral proteins are enriched in disordered regions with short host-mimicking motifs (Davey et al., 2011; Uversky, 2019), they offer unique tools to explore the importance of SLiMs positioning on signalling output. Our observations also demonstrate that Vaccinia provides an excellent platform to dissect physiological or synthetic signalling networks activated by Src and Abl family kinases.

Methods

Expression constructs and targeting vectors

The expression vectors pE/L-LifeAct-iRFP670 (Galloni et al., 2021), pLVX-GFP-N-WASP (Donnelly et al., 2013), pE/L-GFP-Nck (SH2) (Frischknecht et al., 1999) and pBS SKII RFP-A3L targeting vector (Weisswange et al., 2009) were previously made in the Way lab. The lentiviral expression construct pLVX-GFP-Nck was generated by sub-cloning the Nck1 coding sequence (Donnelly et al., 2013) into NotI/EcoRI sites of a pLVX-N-term-GFP parent vector (Abella et al., 2016). The expression construct CB6-Src-GFP was generated by sub-cloning Src-GFP (Newsome et al., 2006) into BglII/NotI sites of a CB6 parent vector. All other expression constructs generated for this study were made using Gibson Assembly (New England Biolabs) according to manufacturer’s instructions. Desired amino acid substitutions were introduced by whole-plasmid mutagenesis using complementary mutagenic primers. All primers used in cloning are listed in Table 1. The lentiviral expression construct pLVX-GFP-Grb2 was generated by cloning a GFP-Grb2 (Weisswange et al., 2009) fragment into the XhoI/EcoRI sites of a pLVX parent vector (Abella et al., 2016). The A36R-targeting vector was generated by amplifying a fragment containing the A36R gene including 325  bp upstream and downstream sequences from the WR strain of Vaccinia virus genomic DNA and cloning into the NotI/HindIII sites of pBS SKII. This vector was modified to generate desired A36 truncations and variants. The tagGFP2 coding sequence used in the A36 N-G and A36-G-N fusion constructs was amplified from a plasmid provided by David Drubin (UC Berkeley; Akamatsu et al., 2020). The A36-p14 chimeric construct was obtained as a synthetic gene (Invitrogen; Geneart) and cloned into the A36R-targeting vector using SpeI/BsrGI sites in the sequences flanking the A36R coding region. A36 constructs with modified linker lengths between Nck and Grb2 binding sites were obtained as synthetic genes (IDT gBlock) and cloned into the A36R-targeting vector using KasI/BsrGI sites in the A36R coding/flanking regions. SnapGene software (from Insightful Science; available at snapgene.com) was used to plan and visualise cloning strategies, and to analyse sequencing results.

Table 1
Primers.
No.SequenceConstruct(s) generated
AB004CCAGCAACACTATCGTAAATGTGTTCTGTATTACGATCATTATTTATTAGCAGA36 N-N
AB007ACACATTTTCGATAGTGTTGCTGGA36 X-G
AB008GCAACACTATCGAAAATGTGTTCTGA36 X-G
AB009CAGACTATTTTTCAGAACACTACAGTAGTAA36 N-X, A36 X-N, A36 X-X
AB010CTGTAGTGTTCTGAAAAATAGTCTGTA36 N-X, A36 X-N, A36 X-X
AB105TCAGCCAGCACGAGTTCGAGGACCCCTACGAGCCCCCCAGp14 N-G (Y96F)
AB106CTGGGGGGCTCGTAGGGGTCCTCGAACTCGTGCTGGCTGAp14 N-G (Y96F)
AB107ACGAGTACGAGGACCCCTTCGAGCCCCCCAGCAGGAGGAAp14 N-G (Y100F)
AB108TTCCTCCTGCTGGGGGGCTCGAAGGGGTCCTCGTACTCGTp14 N-G (Y100F)
AB109CTACAGCACCTTCGTGAACATCGACAACGTGAGCGCCATCp14 N-G (Y116F) and p14 N-G (Y96,116F)
AB110GCGCTCACGTTGTCGATGTTCACGAAGGTGCTGTAGGGGp14 N-G (Y116F) and p14 N-G (Y96,116F)
AB040TACCGGACTCAGATCTCGAGATGAGCAAGGGCGAGGAGCpLVX-GFP-Grb2
AB057CGTCGACTGCAGAATTCTTACTAGACGTTCCGGTTCACGGGGGpLVX-GFP-Grb2
AB051CACCGCGGTGGCGGCCGCTCATCATAGCATA36 N-G, A36 G-N, A36 G-N-G, A36 G-G-N
AB052GGTCGACGGTATCGATAAGCTTTATCTATAGAGATAACACA36 N-G, A36 G-N, A36 G-N-G, A36 G-G-N, p14-N-G, p14 G-N, A36 G-G, A36 N-N
AB053TGATTAGTTTCCTTTTTATAAAATTGAAGTAATATTTAGTA36 N-G, A36 G-N, A36 G-G
AB054ATAAAAAGGAAACTAATCACGTGCTTCCAGCAACACTATA36 G-N
AB055ATAAAAAGGAAACTAATCAAATTACTACTGTAGTGTTCTGA36 N-G
AB087TATTTATCAGAACACTACAGTAGTAATTTGATTAGTTTCCTTTTTAA36 G-N-G
AB088AGTGTTCTGATAAATAGTCTGTTCATTACGATCATTATTTATTAGCAGCGTGCTTCCAGCAACAA36 G-N-G
AB089CTAATAAATAATGATCGTAATGAACAGACTATTTATCAGAACA36 G-G-N
AB090ATTACGATCATTATTTATTAGCAGAATTACTACTGTAGTGTTCTGATAAATA36 G-G-N
AB096AAACAATAAATATTGAACTAGTAGTACGTATATTGAGCA36 N-G-TagGFP2, A36 G-N-TagGFP2, p14 N-G, p14 G-N, A36 N-N, A36 G-G
AB097TCCGGTGGCGACCGGTGGATCCGACCCCGACCCAATTACTACTGTAGTGTTCTGATAAA36 N-G-TagGFP2
AB098TCCGGTGGCGACCGGTGGATCCGACCCCGACCCCGTGCTTCCAGCAACACTATCGTAAA36 G-N-TagGFP2
AB099ACAGAACACATTTACGATAGTGTTGCTGGAAGCACGTGATTAGTTTCCTTTTTATAAA36 N-N
AB104TATAAAAAGGAAACTAATCAAATTACTACTGTAGTGTTCTGATAAATAGTCTGTTCATTACGATCA36 G-G
AB121AGGAACAGCTACAGGCTGAGp14 N-G, p14 G-N
AB122CTCAGCCTGTAGCTGTTCCTCGCCATGACATTGGATTp14 N-G, p14 G-N

Cell lines

HeLa cells, Nck -/- MEFs, and N-WASP -/- MEFs were provided, authenticated by STR profiling and mycoplasma-tested by the Francis Crick Institute Cell Services. All cell lines were maintained in minimal essential medium (MEM) supplemented with 10% FBS, 100 U/ml penicillin, and 100 µg/ml streptomycin at 37 °C and 5% CO2. HeLa cell lines stably expressing LifeAct-iRFP670 (Snetkov et al., 2016) and GFP-WIP (Weisswange et al., 2009) were previously generated in the Way lab. Nck -/- MEFs (Bladt et al., 2003) and N-WASP-/-MEFs (Snapper et al., 2001) were provided by the late Tony Pawson (Samuel Lunenfeld Research Institute, Toronto, Canada) and Scott Snapper (Harvard Medical School, Boston, MA), respectively. For this study, lentiviral expression vectors were used to stably express GFP-Nck in HeLa cells and Nck-/- MEFs, GFP-N-WASP in HeLa cells and N-WASP-/- MEFs, and GFP-Grb2 in HeLa cells. All cell lines were generated using the lentivirus Trono group second generation packaging system (Addgene) and selected using puromycin resistance (1 µg/ml) as previously described (Abella et al., 2016). Expression of the relevant fusion proteins was confirmed by live imaging and immunoblot analysis (Figure 4—figure supplement 1, Figure 5—figure supplement 2). The following primary antibodies were used: anti-Nck (BD transduction; 1:1000), anti-vinculin (Sigma #V4505; 1:2000), anti-Grb2 (BD Transduction #610112, 1:3000), anti-N-WASP (Cell Signalling #4,848 S; 1:1000), anti-GFP (3E1 custom made by Cancer Research UK; 1:1000). HRP-conjugated secondary antibodies were purchased from The Jackson Laboratory.

Viral plaque assays

Plaque assays were performed in confluent BS-C-1 cell monolayers. Cells were infected with the relevant Vaccinia virus at a multiplicity of infection (MOI)=0.1 in serum-free MEM for one hour. The inoculum was replaced with a semi-solid overlay consisting of a 1:1 mix of MEM and 2% carboxymethyl cellulose. Cells were fixed with 3% formaldehyde at 72 hr post-infection and subsequently visualised with crystal violet cell stain as previously described (Humphries et al., 2012). To determine plaque size, the diameter of well-separated plaques was measured using the Fiji line tool (Schindelin et al., 2012).

Construction of recombinant Vaccinia viruses

In this study, recombinant Vaccinia viruses in the WR background were isolated by selecting viral plaques based on their size or by introduction of a fluorescently-tagged viral protein as described previously (Snetkov et al., 2016; Weisswange et al., 2009). The former strategy was used to generate recombinants where A36 variants were introduced at the endogenous locus by rescuing plaque size in the WR–ΔA36R virus that makes very small plaques (Parkinson and Smith, 1994; Ward et al., 2003). To introduce relevant constructs into the A36 genomic locus, HeLa cells infected with WR–ΔA36R at MOI = 0.05 were transfected with the appropriate pBS SKII A36R-targeting vectors using Lipofectamine2000 (Invitrogen) as described by the manufacturer. In the case of the p14 N-G virus, a PCR fragment containing the desired construct flanked by recombination arms was used for transfection. When all cells displayed cytopathic effect at 48–72 hr post-infection, they were lysed, and serial dilutions of the lysates were used to infect confluent BS-C-1 cell monolayers in a plaque assay (see above). Plaques were revealed by neutral red staining and recombinants were identified and picked based on increased plaque size. Plaque lysates were used to infect fresh BS-C-1 cell monolayers over at least three rounds of plaque purification. To isolate A36 N-G-TagGFP2 and A36 G-N-TagGFP2 viruses, in addition to size, plaque fluorescence was used to identify recombinants. To generate recombinants where the viral core was fluorescently labelled with RFP, HeLa cells infected with the relevant parent virus were transfected with the pBS SKII RFP-A3-targeting vector (Weisswange et al., 2009). Recombinant viruses were isolated based on RFP fluorescence over at least three rounds of plaque purification. In all cases, successful recombination at the correct locus, loss of the parent variant and virus purity were verified by PCR and sequencing. Plaque sizes of viruses obtained from independent recombination events were also compared where possible, to control for effects arising from off-target mutations (Figure 2—figure supplement 1C, Figure 7—figure supplement 2). For Figure 2—figure supplement 2B and Figure 3—figure supplement 1A, experiments were performed using crudes lysates from cells infected with indicated recombinants. For all remaining experiments, recombinant viruses were purified through a sucrose cushion before use and storage.

Vaccinia virus infection for imaging

For live and fixed cell imaging, cells plated on fibronectin-coated MatTek dishes (MatTek corporation) or coverslips were infected with the relevant Vaccinia virus recombinant in serum-free MEM at MOI = 1. After one hour at 37 °C, the serum-free MEM was removed and replaced with complete MEM. Cells were incubated at 37 °C until further processing.

Transient transfection and siRNA

Transient transfection of A36-p14 hybrid constructs, CB6-Src-GFP, pE/L-GFP-Nck (SH2) and the pE/L-LifeAct-iRFP670 expression in Vaccinia-infected cells was done using FUGENE (Promega) as described by the manufacturer. To transiently express the A36-p14 chimera and its variants (Figure 3B-E), expression vectors containing the relevant construct under the control of the A36 promoter were transfected into cells one hour after infection with the WR-ΔA36 virus (Parkinson and Smith, 1994). pE/L-LifeAct-iRFP670 (Figures 4A and 6A) and pE/L-GFP-Nck(SH2) (Figure 6B) were transfected into cells one hour after infection with the relevant viruses. CB6-Src-GFP (Figure 6A) was transfected into cells 16 hr prior to infection. For knockdown experiments, HeLa cells were transfected with siRNA as previously described (Abella et al., 2016). Cells were infected with Vaccinia virus 72 hr after siRNA transfection, and samples from each siRNA condition were kept for immunoblot analysis. The following siRNAs were used: AllStars (Qiagen; SI03650318), Grb2-targeting siRNA oligos AGGCCGAGCGUAAUGGUAA, GAAAGGAGCUUGCCACGGGUU and CGAAGAAUGUGAUCAGAACUU. The following primary antibodies were used in immunoblots: anti-vinculin (Sigma #V4505; 1:2000), anti-Grb2 (BD Transduction #610112, 1:3000). HRP-conjugated secondary antibodies were purchased from The Jackson Laboratory.

Immunofluorescence

At 8 hr (HeLa) or 16 hr (MEFs) post-infection, cells were fixed with 4% paraformaldehyde in PBS for 10 min, blocked in cytoskeletal buffer (1 mM MES, 15 mM NaCl, 0.5 mM EGTA, 0.5 mM MgCl2, and 0.5 mM glucose, pH 6.1) containing 2% (vol/vol) fetal calf serum and 1% (wt/vol) BSA for 30 min, and then permeabilised with 0.1% Triton-X/PBS for 5 min. To visualise cell-associated enveloped virions (CEV), cells were stained with, with a monoclonal antibody against B5 19C2, rat, 1:1000; (Schmelz et al., 1994) followed by an Alexa Fluor 647 anti-rat secondary antibody (Invitrogen; 1:1000 in blocking buffer) prior to permeabilisation of the cells with detergent. Other primary antibodies used were anti-Nck (Millipore #06–288; 1:100), anti-WIP 1:100; (Moreau et al., 2000), and anti-N-WASP (Cell Signalling #4,848 S; 1:100) followed by Alexa Fluor 488 conjugated secondary antibodies (Invitrogen; 1:1000 in blocking buffer). Actin tails were labeled with Alexa Fluor 488, Alexa Fluor 568 or Alexa Fluor 647 phalloidin (Invitrogen; 1:500). Coverslips were mounted on glass slides using Mowiol (Sigma). Coverslips were imaged on a Zeiss Axioplan2 microscope equipped with a 63 x/1.4 NA Plan-Achromat objective and a Photometrics Cool Snap HQ cooled charge-coupled device camera. The microscope was controlled with MetaMorph 7.8.13.0 software. To measure the levels of A36 pY132 and Src pY418 at the virus (Figure 6) coverslips were fixed with 4% paraformaldehyde containing 0.1% Triton-X prior to staining with an antibody against the A36 phosphotyrosine 132 site 1:100, (Newsome et al., 2004) or the Src phosphotyrosine 418 site (1:300, Life Technologies #44,660 G). Mounted coverslips were imaged on an Olympus iX83 Microscope with Olympus 100 x/1.50NA A-Line Apochromatic Objective Lens, dual Photometrics BSI-Express sCMOS cameras and CoolLED pE-300 Light Source. The microscope was controlled with MicroManager 2.0.0 software.

Live-cell imaging

Live-cell imaging experiments were performed at 8 hr (HeLa) or 16 hr (MEFs) post-infection in complete MEM (10% FBS) in a temperature-controlled chamber at 37 °C. Cells were imaged on a Zeiss Axio Observer spinning-disk microscope equipped with a Plan Achromat 63 x/1.4 Ph3 M27 oil lens, an Evolve 512 camera, and a Yokagawa CSUX spinning disk (Galloni et al., 2021; Pfanzelter et al., 2018). The microscope was controlled by the SlideBook software (3i Intelligent Imaging Innovations). For determining recruitment levels of GFP-tagged molecules to the virus, single snapshots of live cells were acquired. To determine virus speed, images were acquired for 50 s at 1 Hz.

Image analysis and quantitation

Quantification of actin tail number and length was performed using two-colour fixed cell images where actin and extracellular virus were labelled. Ten cells were analysed per condition in each independent experiment. The number of actin tails was measured by blindly selecting 25 isolated extracellular virus particles in each image and determining the presence of a tail in the corresponding actin channel. Actin tail length of 8 randomly selected tails per image was measured using the freehand line drawing function in Fiji.

To analyse virus motility, two-colour time-lapse movies of HeLa cells stably expressing LifeAct-iRFP670 infected with the relevant recombinant virus labelled with RFP-A3 were used. The velocity of virus particles in the RFP channel was measured using a Fiji plugin developed by David Barry (the Francis Crick Institute) as previously described (Abella et al., 2016). Bona fide actin-based virus motility was verified manually using the corresponding iRFP670 channel. Five movies were analysed per condition, and speeds from 30 particles were measured in each independent experiment.

A36 pY132 and Src pY418 antibody intensities were analysed in two-colour fixed cell images where actin was co-labelled. Raw integrated density of the antibody signal was measured at the tip of actin tails after local area-corrected background subtraction in Fiji as detailed elsewhere (Verdaasdonk et al., 2014). Thirty particles were measured per condition in each independent experiment.

Recruitment levels of GFP-tagged molecules to the virus were analysed in two-colour live cell images as an intensity ratio to RFP-A3. Five images were analysed per condition, and 25–30 particles were measured in each independent experiment. Only cells with comparable expression levels of GFP-tagged proteins were used; overexpressing cells were excluded. To focus on late infection stages of viral egress, cells with many particles at the periphery were selected. Particles with RFP-A3 intensity of greater than 3,500 raw grayscale units were excluded because under our imaging conditions these values typically corresponded to two or more overlapping virus particles. GFP images were background subtracted using a median filtered image. The ratio of GFP:RFP intensity was then measured using Fiji at isolated peripheral particles that discernably showed actin-based motility when visualised live. For quantification of GFP-Nck (SH2) in Nck null cells (which cannot form actin tails), particles with any GFP recruitment were used for measurement. In the recombinant viruses we analysed, the percentage of virus particles forming actin tails and recruiting signalling components did not change. Furthermore, by measuring GFP-Nck intensity at extracellular virus particles in fixed cells, it was independently verified that the measurements made as a ratio to RFP A3 intensity as described above, reflected results seen on bona fide CEVs.

Phosphopeptide pulldown assay

Phosphorylated and non-phosphorylated peptides were synthesised in-house (p14 Y96: SQHEpYEDPYEPP, SQHEYEDPYEPP; A36 Y112: APSTEHIpYDSVAGST, APSTEHIYDSVAGST; p14 Y100: YEDPpYEPPSRRK, YEDPYEPPSRRK) containing the predicted Nck-binding sites and an N-terminal biotin tag. These were coupled to streptavidin Dynabeads M-280 (Thermo Fischer Scientific). Uninfected HeLa cells were lysed in a buffer containing 50 mM Tris.HCl pH7.5, 150 mM NaCl, 0.5 mM EDTA, 0.5% NP40, 0.5% Triton-X and a cocktail of protease and phosphatase inhibitors (1 mM orthovanadate, cOmplete (Roche), PHOSstop (Roche)). A postnuclear supernatant was obtained by a 16,000 g centrifugation for 10 min at 4 °C. The peptide-coupled beads were incubated with these clarified cell lysates. Unbound proteins were removed from beads in three washes in the same cell lysis buffer. The proteins bound to beads were resolved on an SDS-PAGE and the presence of Nck was determined by immunoblot analysis using anti-Nck antibody (Millipore #06–288; 1:1000). As a negative control anti-Grb2 (BD Transduction #610112; 1:3000) was used. HRP-conjugated secondary antibodies were purchased from The Jackson Laboratory.

Whole-cell lysate phosphoblot

HeLa cells infected with A36 N-G-TagGFP2 or A36 G-N-TagGFP2 were lysed at 9 hr post-infection in PBS containing 1% SDS, a cocktail of protease and phosphatase inhibitors (1 mM orthovanadate, cOmplete (Roche), PHOSstop (Roche)) and Benzonase (Millipore). Proteins from these lysates were resolved on an SDS-PAGE and the presence of total pTyr and A36 were determined by immunoblot analysis using anti-phosphotyrosine PY99 antibody (Santa Cruz #sc-7020; 1:1000) and anti-TagGFP2 antibody (Evrogen #AB121; 1:3000) respectively. As a loading control anti-Grb2 (BD Transduction #610112; 1:3000) was used. HRP-conjugated secondary antibodies were purchased from The Jackson Laboratory.

Statistical analysis and figure preparation

All data are presented as means  ± S.D. For all experiments, means of at least three independent experiments (i.e. biological replicates) were used to determine statistical significance by a Welch’s t-test (comparing only two conditions), Tukey’s multiple comparisons test (comparing multiple conditions with each other) or a Dunnett’s multiple comparisons test (comparing multiple conditions with a control). All data are represented as SuperPlots to allow assessment of the data distribution in individual experiments (Lord et al., 2020). SuperPlots were generated using the SuperPlotsOfData webapp (Goedhart, 2021) and graphs showing intrinsic disorder predictions were generated in GraphPad Prism 9. All data were analyzed using GraphPad Prism 9 or the SuperPlotsOfData webapp. Temporal overlays of live imaging data to illustrate virus motility were generated using the temporal colour-code function in Fiji. Schematics were created with BioRender.com. Final figures were assembled using Keynote software.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting file; Source Data files have been provided for all graphs and western blots.

References

    1. Finney HM
    2. Lawson ADG
    3. Bebbington CR
    4. Weir ANC
    (1998)
    Chimeric receptors providing both primary and costimulatory signaling in T cells from a single gene product
    Journal of Immunology 161:2791–2797.
    1. Jin J
    2. Pawson T
    (2012) Modular evolution of phosphorylation-based signalling systems
    Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 367:2540–2555.
    https://doi.org/10.1098/rstb.2012.0106
    1. Liu BA
    2. Nash PD
    (2012) Evolution of SH2 domains and phosphotyrosine signalling networks
    Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences 367:2556–2573.
    https://doi.org/10.1098/rstb.2012.0107

Decision letter

  1. Tony Hunter
    Reviewing Editor; Salk Institute for Biological Studies, United States
  2. Anna Akhmanova
    Senior Editor; Utrecht University, Netherlands
  3. Tony Hunter
    Reviewer; Salk Institute for Biological Studies, United States
  4. Bruce Mayer
    Reviewer

In the interests of transparency, eLife publishes the most substantive revision requests and the accompanying author responses.

Decision letter after peer review:

Thank you for sending your article entitled "The Relative Binding Position of Nck and Grb2 Adaptors Dramatically Impacts Actin-Based Motility of Vaccinia Virus" for peer review at eLife. Your article is being evaluated by 4 peer reviewers, including Tony Hunter as Reviewing Editor and Reviewer #1, and the evaluation is being overseen by Anna Akhmanova as the Senior Editor.

All the reviewers agree that your finding that the NCK and GRB2 pTyr-binding sites in the IDR of the Vaccinia A36 protein have to be in a defined order in order to promote effective actin tail formation and virus motility is an interesting and to some extent unexpected observation. However, as you will see from the reviews, the consensus is that at least some additional mechanistic insights into this observation are needed before your paper would be suitable for publication in eLife. The reviews include a number of experimental suggestions for how some clues to mechanism might be obtained. However, before requesting a revised version, we would like you to develop and submit a plan for additional experiments that you could do within a reasonable time frame to provide some further insights into mechanism underlying the required order of binding sites. On the basis of your response a decision will be made whether to request a revised version. We recognize that some of the experiments are likely to require generation of new recombinant viruses, which will be time consuming, and this will be taken into account in making the decision. We hope it will be possible for you to provide further mechanistic insights into your intriguing observations so that we can consider your paper further for eLife.Reviewer #1:

Here the authors have investigated whether the relative positions of the pTyr binding sites for the NCK and GRB2 SH2 domains that bind to Tyr112 and Tyr132, respectively, present in a disordered region in the A36 Vaccinia virus integral viral membrane protein. These sites are phosphorylated by the cellular SRC and ABL tyrosine kinases during Vaccinia virus infection cycle in target cells, and are important for triggering local polymerization of the actin cytoskeleton and actin-dependent cell-to-cell spread of virus. For this purpose, they used a system in which the WR-ΔA36R Vaccinia virus strain lacking the A36 gene was rescued by expression of the A36 N-G variant that terminates after the GRB2 binding site at aa 139, but can still activate actin polymerization, in a manner dependent on the Y112 NCK bindng site, and also mediate microtubule transport via the upstream kinesin-1 bindng sites. They started by swapping the 12 aa sequences sround the NCK pY112 and GRB2 Y120 binding sites generating the A36 G-N variant, and showed that A36 G-N induced significantly shorter F-actin tails than A36 N-G. Next, they made A36 N-X and X-N variants, which both lack a GRB2 binding site, and found these induced F-actin tails of the same length as the corresponding A36 N-G and A36 G-N variants, indicating that the Y112 position of the NCK binding site in A36 is important and sufficient for F-actin tail formation. Consistently, the A36 G-N variant showed reduced virus motility and cell-to-cell spread compared to the WT A36.

To determine the generality of these findings, they devised a synthetic pTyr network in which the N-G region of A36 is replaced with the corresponding region of a different viral protein capable of activating actin polymerization via the NCK and GRB2 adaptors, namely p14, an orthoreovirus integral membrane protein that activates N-WASP via GRB2 bound to pY116 to regulate cell fusion. P14 has two additional Tyr residues 16 and 20 aa upstream of Y116 that have contexts matching NCK SH2 domain binding sites. In the chimera, aa 1-105 of A36 are fused to aa 79-125 of p14, and they showed that A36-p14 N-G induced the formation of F-actin tails efficiently, and that this required N-WASP. Mutation of Y96, a putative NCK binding site, but not Y100 in A36-p14 N-G reduced F-actin tail formation, and the combined Y96/Y116 mutation reduced this further. When HeLa cells were infected with a recombinant Vaccinia virus with A36 replaced by A36-p14 N-G they showed that NCK, WIP and N-WASP as well as GFP-GRB2 were recruited to viriions and induced F-actin tail formation, whereas an A36-p14 G-N virus failed to induce F-actin tails or cell-to-cell spread. The authors concluded that the N-G organization of the two key Tyr phosphorylation sites that recruit NCK and GRB2 is a general feature of viral proteins that initiate F-actin formation to drive virion movement.

Finally, the authors carried out further experiments to elucidate why the N-G site organization is important for inducing proper F-actin reorganization. First, they showed that the A36 N-G and A36 G-N proteins were expressed at the same level in infected cells. Using GFP-tagged NCK, GRB2, WIP and N-WASP, they also found that the levels of recruited NCK were comparable between the A36 N-G and G-N viruses in infected HeLa cells, whereas the levels of GRB2 and N-WASP recruitment were significantly reduced on the A36 G-N virus. Using an A36 N-X virus for infection, they showed that reduction in GRB2 binding did not affect the level of NCK binding, although there was some decrease in N-WASP binding, but less than that observed with A36 G-N. Second, by staining with an anti-pY132 antibody that detects the phosphorylated A36 GRB2 bindng site, they showed that level of pY132 was significantly higher in the A36 G-N than the A36 N-G virus, whereas the anti-pY132 antibodies did not detect the A36 N-X virus. They also found that siRNA knockdown of GRB2 increased pY132 labeling on the A36 N-G virus. Finally, knowing that the position of the GRB2-binding site relative to the NCK binding site is critical for the output of the A36 signaling network, the authors tested whether an additional GRB2 binding site would influence the output by generating recombinant A36 G-N viruses with an extra GRB2 site either N-terminal (A36 G-G-N virus) or C-terminal to the NCK site (A36 G-N-G virus). All four viruses (N-G, G-N, G-N-G and G-G-N) recruited similar levels of NCK and induced comparable numbers of actin tails. However, while the N-G and G-N-G viruses recruited similar levels of N-WASP, these were ~2-fold greater than for the G-N and G-N-G viruses; the actin tail lengths formed by the A36 G-N and G-G-N viruses were equally short, with the G-N-G virus were noticeably longer, but not as long as the N-G virus. The N-G and, particularly, the G-N-G viruses also recruited significantly more GFP-GRB2 than the G-N and G-G-N viruses. They concluded that GRB2 binding to A36 is not essential for Vaccinia infection to induce actin tail formation, but that its binding position on A36 relative to that of NCK influences the level of N-WASP recruitment to promote proper F-actin reorganization.

The finding that the N- to C-terminal order of the NCK and GRB2 pTyr binding sites in the cytoplasmic tail of the A36 Vaccinia virus membrane protein is important for proper activation of local actin polymerization and formation of actin tails, and subsequent virion movement, is interesting, particularly in light of the recent realization that signaling through phosphorylated IDRs is often mediated by formation of local biomolecular condensates that create signaling nodes. However, based on their results, the authors argue that A36-mediated signaling is unlikely to be a simple phase transition mechanism triggered by increased local concentrations of the NCK and GRB2 signaling components, as has been proposed for other signaling biocondensates, and that instead the A36 network has underlying wiring principles with a preferred configuration or directionality. While the data provide convincing evidence that there is a required order of A36 pTyr binding sites,, in the end the results do not provide true mechanistic insights into why this particular binding site order is important.

Overall, these findings will be of interest to people working on signaling biocondensates formed on phosphorylated IDRs, and those studying mechanisms of Vaccinia virus infection and cell to cell movement. Some simple experiments could provide further mechanistic insights, such as varying the distance between the NCK and GRB2 binding sites, determining phosphorylation stoichiometry of the two sites and whether both sites are simultaneously phosphorylated in a single A36 molecules. Further insights into the logic of the network might be gained by biochemical and possibly structural efforts to reconstitute the system using different forms of the phospho-A36 C-terminal region with purified WT and mutant NCK, GRB2, WIP and N-WASP proteins, although admittedly such experiments might be beyond the scope of this paper.

Recommendations for the authors:

Based on the model in Figure 1, it is implicit in the authors' thinking that both NCK and GRB2 can bind simultaneously to a single diphosphorylated pY112/pY132 A36 molecule, but they provide no evidence that this is actually the case, or even evidence that both Y112 and Y132 sites are phosphorylated in a single A36 molecule (digestion of phospho-A36 with a Lys-specific protease, which will put both Y112 and Y132 in the same peptide, followed by MS analysis, perhaps with NCK or GRB2 SH2 domain pre-enrichment, might provide such evidence). If NCK and GRB2 can indeed bind simultaneously to the same A36 molecule, this raises the question of whether the two bound proteins physically interact, and whether such an interaction might have functional consequences. Extending this idea, why then would switching the order of the two pTyr sites reduce signal output? Here, one should note that the binding of the SH2 domains of NCK and GRB2 to their target pTyr sites is directionally oriented, and by reversing the order of the sites such protein-protein interactions might not be able to take place properly. In this regard, perhaps surprisingly, the authors did not test whether the spacing between the two pTyr sites is critical (i.e. does it have to be 20 amino acids? N.B. The spacing between the two pTyr residues in ITAMs is 11 aa, and these bind tandem SH2 domains), which could be the case if specific interactions between the bound NCK and GRB2 proteins are required. Here, it is notable that the spacing of the functional NCK and GRB2 binding sites in the orthoreovirus p14 protein is also 20 amino acids. Although the authors showed that loss of GRB2 binding did not reduce NCK binding, which implies that their binding is not cooperative, it would certainly be informative to test the effects of increasing or decreasing the spacing of the NCK and GRB2 SH2 binding sites on the output of the A36 network.

It might also be worth carrying out structural modeling of a diphosphorylated WT A36 105-140 aa peptide bound simultaneously to an NCK SH2 domain (plus the neighboring SH3 domain?) and a GRB2 SH2 domain (plus the neighboring SH3 domains?) to see if any structural constraints emerge, and whether any differences are apparent when the phosphorylated G-N version of this peptide is used. Such analysis might provide further insights into the preferred directionality.

Points: 1. Figure 2: Did the authors show that the GRB2 Y112 site and NCK Y122 sites in the A36 G-N protein are phosphorylated to the same extent as in A36 N-G protein? In Figure 6, they used anti-pY132 antibodies to demonstrate that phosphorylation of the pY132 GRB2 site was similar or even higher in the G-N protein than the parental N-G protein, but apparently did not do this for the pY112, perhaps due to the lack of suitable phospho-specific antibodies. Instead, it might be possible to use GST-NCK SH2 domain and GST-GRB2 SH2 domain overlay blots of A36 N-G and G-N proteins isolated from infected cells for this purpose.

2. Figure 3F: The authors used phosphopeptide pulldowns to show that a p14 pY96 peptide pulled down NCK and that a p14 pY116 peptide pulled down GRB2, but it appears that they did not test if a p14 pY100 peptide could pull down NCK, which seems important. Even though the Y100F mutant form of A36-p15 did not exhibit a deleterious phenotype, it is unclear whether Y100 is in fact phosphorylated in infected cells, and, more importantly, whether it can recruit NCK if it is phosphorylated, e.g. in a Y96F/Y116F mutant background. As indicated above, it is possible that the shorter 16-residue spacing between pY100 and pY116 is incompatible with appropriate signal output.

3. Figure 4: Did the authors demonstrate directly that both Y96 and Y116 in the A36-p14 N-G fusion are phosphorylated and that A36-p14 N-G binds both NCK and GRB2?

4. Figure 6: The fact that siRNA knockdown of GRB2 increased pY132 antibody labeling on the A36 N-G virus is interesting. However, the authors should note that SH2 domain binding is reported to increase pTyr levels of target residues in vivo (e.g. see PMID: 1537335), presumably because the SH2-bound pTyr residues are protected from dephosphorylation by PTPs. If this is also the case for GRB2, then one might have expected the siRNA-mediated reduction in GRB2 levels to cause a decrease in pY132 levels, rather than an increase as observed. This issue would be worth some discussion.

5. Figure 7: The authors should indicate in the text that spacing of the extra GRB2 sites in A36-G-N-G and G-G-N viruses was also 20 aa.

6. Did the authors make and test an A36 N-N virus? This might generate too "strong" a signal and perturb the output. A pertinent example here would be ES cells in which the key FGFR-GRB2/SOS-RAS-ERK pathway is disrupted when endogenous GRB2 is replaced by a GRB2 with a superbinder SH2 domain that causes pathway hyperactivation and thereby prevents primitive endodermal lineage formation (PMID: 23452850).

7. A propos whether both Y112 and Y132 are simultaneously phosphorylated in a single A36 molecule, is the stoichiometry of phosphorylation at these two sites known. Also, would it be possible for two neighboring A36 molecules in the outer membrane of a single virion to collaborate if Y112 is phosphorylated in one A36 molecule and Y132 phosphorylated in the second A36 molecule?Reviewer #2:

The authors use the Vaccinia virus system to examine the potential role of the position of Nck and Grb2 binding sites within the unstructured viral A36 protein in the assembly of a functional actin comet tail. An advantage of these studies is the Way group's extensive expertise in this system, one of the first and perhaps still one of the best systems for studying how extracellular signals can lead to the assembly of dynamic actin structures through localized activation of N-WASP. They have previously characterized the specific roles of Nck (the primary driver of actin assembly) and Grb2 (which plays a supporting role) in the number, size, and speed of resulting actin structures. Here the goal is to test whether the positioning of the phosphorylated Nck and Grb2 SH2 binding sites affects any of these parameters. They are able to show convincingly that positioning the Nck binding site in an N-terminal (membrane proximal) position leads to more robust actin tail formation (measured primarily by length of the tail, its speed, and plaque size of the recombinant vaccine virus), compared to constructs where the Grb2 binding site is N-terminal.

This result is quite surprising, given the expectation that the A36 intracellular region in unstructured, and raises interesting questions as to the mechanism responsible. They provide fairly strong evidence that viruses with compromised actin assembly also have reduced Grb2 (as well as N-WASP) binding, despite robust phosphorylation of the Grb2 binding site, suggesting that this is primarily responsible for the decreased signal output. They also speculate that this system provides novel insight into the still mysterious design principles underlying phase-separated molecular condensates on the membrane, an area of intense current interest in the fields of cell biology and cell signaling.

In general the experiments are well designed and rigorously interpreted. However the somewhat modest effects, in my view, lessen the impact of the results. As this group showed many years ago, binding of Nck to A36 is the major driver of actin assembly in this system, while Grb2 binding has modest effects on the length and speed of the resulting tails (less than 2-fold difference). Thus the dynamic range of experiments where the positioning of Nck and Grb2 binding sites is manipulated is relatively small. One could legitimately ask if a less than two-fold difference in actin tail length is that biologically meaningful, and whether this is a sufficient basis for extrapolating to the general behavior of membrane-associated molecular condensates.

A larger issue in my mind is that even if one accepts that the differences in output based on positioning of adaptor binding sites is biologically significant, the results don't provide a mechanistic model or even a testable hypothesis for the effect. Thus the impact on our understanding of cell signaling mechanisms in general, or more specifically systems where clustered receptors and their binding proteins may have properties of phase-separated molecular condensates, is rather limited. This is a very interesting and intriguing observation to be sure, but without a mechanistic basis I don't think it advances the field significantly.

Recommendations for the authors:

In my view the most serious concerns with the data as presented relate to mechanisms that might explain the apparent decrease in Grb2 binding when it is positioned N-terminal to the Nck binding site. I think the simplest explanation is that for some reason Grb2 binding sites are not as well phosphorylated when positioned N-terminally. This could be due to decreased accessibility to the kinases, increased accessibility to phosphatases, decreased accessibility of the phosphorylated site to Grb2, or many other possibilities. The experiments that show robust phosphorylation of the N-terminal Grb2 site (Figure 6) are compromised by several factors. First, only a phosphospecific antibody to the Grb2 site is used in these experiments. Similar experiments using a phosphospecific Nck binding site antibody in parallel would control for a number of issues, including whether position consistently affects relative steady state phosphorylation of both sites.

Furthermore, while I understand that the authors are most interested in the phosphorylation state of A36 directly under virus particles (where actin tails are assembling), it would be very informative to see results from simple immunoblots of whole cell lysates to assess bulk phosphorylation of Nck and Grb2 sites in cells infected with various viruses. The argument that the apparent increase in Grb2 binding site phosphorylation might be due to decreased shielding from antibody of sites by bound Grb2 (p. 10) is not very compelling to me, especially since Grb2 knockdown has a very modest (and statistically insignificant) effect on antibody binding to this site. Furthermore, the authors do not account for the effect of bound SH2 domains in increasing overall phosphorylation of their binding sites by protecting them from dephosphorylation; this would tend to oppose any apparent decrease in antibody accessibility due to SH2 binding.

In general, I think it would have been helpful to compare results for various constructs with those for the N-X virus (completely lacking the Grb2 site), in order to assess their activity relative to when Nck binding is maximal and Grb2 binding is abolished. However I don't believe this is essential, given the amount of work required to re-do experiments.Reviewer #3:

The authors investigated the modularity of the viral protein A36, which mediates actin-based motility of vaccinia virus. Tyrosine phosphorylation of two sites on A36 recruit the adaptor proteins Nck and Grb2, ultimately leading to activation of the actin nucleator N-WASP. They manipulated the order of the Nck and Grb2 binding sites in recombinant viruses carrying a minimal A36 backbone and examined the efficiency and speed of actin nucleation in infected cells. They find that the order of these two sites within a largely unstructured region of the protein plays an important role in governing signal strength, and swapping these motifs attenuated virus motility. They demonstrated that these findings might be broadly applicable to how cell signalling circuits are wired by replacing the Nck and Grb2 sites with sites from an unrelated reovirus protein that signals in a mechanistically similar fashion, and found identical results.

The authors are able to to build on a very well described signalling module that enables cell signalling to be dissected in vivo using powerful pathogen and host genetics. All the manipulations to binding sites were performed with recombinant viruses allowing correlations of virus motility, signalling, adaptor recruitment and virus spread. There is robust quantification of the data provided and high quality imaging. Extending their analysis to the reovirus p14 actin nucleator demonstrates the applicability of this research to the field of synthetic biology, and the plastic nature of these circuits.

A limitation of the study is that every manipulation to A36 effectively compromises the function of the protein. The ability to predict modifications that enhance signalling output will reveal true mastery of this signalling cassette.

Recommendations for the authors:

A key question is whether the authors are assessing exclusively the impact of the order of sites, or whether some sites are more or less efficient within the context of the full-length protein. Figure 2B Suppl 1 may indicate the authors' interpretation is not as straightforward as it seems, all three replicates reveal a downward trend in actin tail length when comparing A36-NX with A36-X-N. While not significant according to the authors' statistical test, this may be a question of sensitivity. This suggests that the difference between the two sites is not as black and white as the authors interpret. Conversely, when it suits the authors' hypotheses, they choose to interpret non-significant differences as supporting their claims (increased pY132 labelling in 6B). I recommend couching the interpretation of Figure 2B Suppl 1 to include the possibility that the sites may not be equivalent or provide data that better supports the authors' interpretation.

Some details on the validation of recombinant viruses appears to be missing. Were multiple independent clones testing to exclude the possibility that selected viruses didn't carry extraneous (off-target) mutations. The information that multiple clones had similar plaque sizes, for example, would strengthen the analysis.

In general, the manuscript was clear, concise and well written. I do think the sentence on L274 should be reworded: "This increase was less dramatic than the G-N virus as the knockdown was not complete and the virus is good at recruiting any remaining Grb2". The 'increase' being less dramatic due to incomplete knockdown is an interpretation, not a statement of fact; and the virus being 'good' at recruiting Grb2 sounds overly colloquial.Reviewer #4:

There are several strengths to this manuscript. The experiments are well thought out and performed, the data and analysis are high quality, and the writing is clear and concise. The data obtains from the experiments that the authors performed support their conclusions and create new and interesting questions that focus on the organization of protein oligomers that make up numerous signal transduction networks at the plasma membrane. Perhaps the most important observation is that the arrangement of Grb2 and Nck binding sites on disordered tails controls actin polymerization on more than just A36. By testing this arrangement on an unrelated viral protein, p14, the authors reinforce that the spatial positioning of Grb2 and Nck binding sites on disordered tails is a general principle that should be considered and tested when studying membrane-associated signaling systems. The major weakness of this paper lies over-extending the general principles to the field of biological phase separation. This isn't to say that the general principles revealed in their manuscript aren't applicable to the field, but the connection, as is, is overstated. Because the referenced LAT and nephrin phase separating systems are dependent on multivalency for either Grb2 or Nck, it is unclear how well A36, which contains only a single binding site for either Grb2 or Nck and has not been shown to undergo phase separation, will be predictive of LAT or nephrin condensates. However, this weakness can be easily addressed by either a deeper discussion of the implications for biological condensate formation, and function by phase separation or by toning down the assertion that there are implications for biological phase separation. Regardless of the implications for phase separation biology, this study offers a unique look into the spatial arrangement that regulates pathogen signaling and behavior and is therefore of wide interest across multiple fields of biology.

Comments:

1) 'Arp2/3' should be 'Arp2/3 complex' throughout the manuscript (it is currently written as both Arp2/3 or Arp2/3 complex).

2) In lines 99-102, the authors state that "both WIP and N-WASP only have two Nck binding sites, each with distinct preferences for the three adaptor SH3 domains." The way that this is written implies that there is a single binding configuration for the three SH3 domains of Nck for the PRMs in WIP and N-WASP which would generate heterodimers of Nck with either WIP or N-WASP. I'm not sure this is what the authors intended to say; from a biochemical perspective each SH3 domain of Nck has a different affinity for individual PRMs in WIP and N-WASP and a more likely outcome at high concentrations, like those bound at A36, would result in a network in which individual Nck SH3 domains simultaneously bind any of the numerous PRMs in WIP and N-WASP (>6 in N-WASP) to generate an Nck-WIP-N-WASP network.

3) The authors make a viral mutant that contains two Grb2 binding sites (G-G-N and G-N-G and state that their data demonstrates that the position Nck and Grb2 binding sites controls signaling output and that the number of Grb2 binding sites does not influence signaling output (Line 280, section title). While this is certainly the case for actin polymerization, it may not be accurate for other signaling pathways downstream of Grb2. To this reviewer, there are two avenues to address this: 1) Change the section title to reflect only actin polymerization, which their data supports, or 2) perform additional experiments to assess Grb2-specific signaling networks. Given that the authors have previously not observed Sos1 at Vaccinia A36 with wild-type tails (Scaplehorn et al., 2002), perhaps adding a second binding sites would result in Sos1 recruitment and alter signaling downstream of A36. The impact of the manuscript will not be lessened by changing the section title, but the impact of the manuscript will be expanded with this analysis, even if it is a bit tangential to the story.

4) There are two changes to the discussion that this reviewer would appreciate. The first is expanding the discussion of potential underlying mechanisms that would require specific positioning of Nck and Grb2 considering the data presented in the manuscript. Might the positioning of N-WASP nearer the membrane be important for N-WASP – PIP2 binding (Benesch et al., J Biol Chem 2002; Papayannopoulos et al., Mol Cell 2005; Rivera et al., Mol Cell 2009)? Or might the positioning of N-WASP, due to the spatial arrangement of Nck and Grb2 binding sites, result in better access to the existing actin cortex at the plasma membrane of the cell?

5) The second change is reducing the emphasis on the implications for membrane associated condensate formation and behavior. Given the inherent differences in valency between A36 and LAT and Nephrin, it is a little bit of a stretch to directly compare A36 with these signaling networks. However, if there is evidence of A36 undergoing a phase transition on membranes, this should be noted and emphasized. Otherwise, there is the possibility that A36 isn’t undergoing a phase transition. Instead, it could be a part of an oligomeric signaling network at the membrane. To this reviewer, this is a more interesting take on these results, as it would provide an alternative mechanism for promoting actin polymerization at the cell membrane which may be applicable to other signaling networks that control actin polymerization, such as those associated with Listeria or Shigella, where there is a fixed number (and density?) of receptors on the membrane that contain a single binding site for effector proteins. This isn’t to say that the authors should remove the current discussion, as it is an important consideration for the community of biological phase separation. Rather, the authors should de-emphasize this portion of their abstract and discussion because there are other incredibly interesting implications for the presented observations that can be emphasized to a greater degree.

https://doi.org/10.7554/eLife.74655.sa1

Author response

Reviewer #1:

Based on the model in Figure 1, it is implicit in the authors’ thinking that both NCK and GRB2 can bind simultaneously to a single diphosphorylated pY112/pY132 A36 molecule, but they provide no evidence that this is actually the case, or even evidence that both Y112 and Y132 sites are phosphorylated in a single A36 molecule (digestion of phospho-A36 with a Lys-specific protease, which will put both Y112 and Y132 in the same peptide, followed by MS analysis, perhaps with NCK or GRB2 SH2 domain pre-enrichment, might provide such evidence).

We agree this would be wonderful to know. However, we have talked to our mass spec facility and based on the sequence of A36 they have told us that the resulting peptide with both Y112 and Y132 residues would be too big to analyse in their machine. Independent of this, any mass spec analysis will examine a peptide from a population of A36 molecules so it would be impossible to know if Y112 and Y132 are both phosphorylated in a single peptide from one A36 molecule unless all A36 molecules are phosphorylated. However, we don’t know if every A36 molecule is even phosphorylated (see point 10 below). If they are also in separate peptides there is also the issue of how well the peptides fly in the mass spec. This again will cause issues in determining stoichiometry of the phosphorylation sites.

If NCK and GRB2 can indeed bind simultaneously to the same A36 molecule, this raises the question of whether the two bound proteins physically interact, and whether such an interaction might have functional consequences. Extending this idea, why then would switching the order of the two pTyr sites reduce signal output? Here, one should note that the binding of the SH2 domains of NCK and GRB2 to their target pTyr sites is directionally oriented, and by reversing the order of the sites such protein-protein interactions might not be able to take place properly. In this regard, perhaps surprisingly, the authors did not test whether the spacing between the two pTyr sites is critical (i.e. does it have to be 20 amino acids? N.B. The spacing between the two pTyr residues in ITAMs is 11 aa, and these bind tandem SH2 domains), which could be the case if specific interactions between the bound NCK and GRB2 proteins are required. Here, it is notable that the spacing of the functional NCK and GRB2 binding sites in the orthoreovirus p14 protein is also 20 amino acids. Although the authors showed that loss of GRB2 binding did not reduce NCK binding, which implies that their binding is not cooperative, it would certainly be informative to test the effects of increasing or decreasing the spacing of the NCK and GRB2 SH2 binding sites on the output of the A36 network.

We agree this is important to know and have in the past considered how to tackle this point. As the reviewer rightly points out, ITAMs can be closely spaced to facilitate binding of tandem SH2 domains in the same molecule, for example those of Syk kinase, which in turn amplifies B cell signalling. Interestingly in several cases we have noticed that the spacing between tyrosines that bind separate SH2 adaptor molecules is approximately 20 amino acids, for example: Grb2-binding Tyr171 and Tyr191 in LAT (Huang et al., 2017, PMID: 29182244), Nck-binding Tyr1176, Tyr1193, Tyr1217 in nephrin (Jones et al., 2006, PMID: 16525419) and Grb2-binding Tyr1092 and Tyr1110 in EGFR (as described in Figure 1 suppl1 of our manuscript).

To test whether this spacing is important in our signalling network, we have analyzed the impact of making the linker between the SH2 binding sites 3 times its original length. We find that actin tails induced by the new recombinant virus are still shorter when in the swopped configuration (G-N rather than N-G) (Figure 2 supplement 2B).

It might also be worth carrying out structural modeling of a diphosphorylated WT A36 105-140 aa peptide bound simultaneously to an NCK SH2 domain (plus the neighboring SH3 domain?) and a GRB2 SH2 domain (plus the neighboring SH3 domains?) to see if any structural constraints emerge, and whether any differences are apparent when the phosphorylated G-N version of this peptide is used. Such analysis might provide further insights into the preferred directionality.

There is unfortunately no structure of full length Nck. However, there is a structure (PDB 2CI9) of the SH2 domain of Nck1 bound to a phosphopeptide (EEHI-pY-DEVAADP) of Tir, which is responsible for inducing EPEC actin pedestals (Frese et al., 2006 PMID: 16636066). This Tir peptide has significant homology to the region surrounding Tyrosine112 of A36 (TEHI-pY-DSVAGSY). It is therefore likely that A36 will bind the Nck SH2 domain in a very similar fashion. There is more structural information available for Grb2 and its association with phosphotyrosine ligands. Grb2 has an exposed pY binding pocket on the SH2 domain that is well removed from its two SH3 domain, thus allowing phosphotyrosine ligand binding independent of SH3 domain engagement. Binding of ifferl ligands is, however, thought to facilitate subsequent SH3 domain interactions. For example, the association of HER2 pY with GRB2 drives SOS1 association with Grb2 nSH3 and induces a conformational change in GRB2, allowing GAB1 to access the cSH3 domain in a non-competitive manner. Based on the available information and discussions with Neil McDonald (a structural biologist at the Crick who studies RTK/RET signalling) we believe that the footprint and size of Nck1 SH2 and Grb2 SH2 binding sites for pY and domain size and orientation is consistent with space for independent binding events (no steric clash). The striking 20 amino acid spacing between phosphotyrosine SH2 binding sites in LAT, EGFR and Nephrin (see point 2 above) as well as orthoreovirus p14 also supports this notion.

We have now added an additional paragraph in the discussion in which we bring out these points including the unique nature of the Grb2 Sh2 interaction with P-tyr ligands (see section starting at line 395). Clearly we are still lacking many important structures including that of full length Nck that would significantly improve our mechanistic understanding of organization signalling networks.

Points: 1. Figure 2: Did the authors show that the GRB2 Y112 site and NCK Y122 sites in the A36 G-N protein are phosphorylated to the same extent as in A36 N-G protein? In Figure 6, they used anti-pY132 antibodies to demonstrate that phosphorylation of the pY132 GRB2 site was similar or even higher in the G-N protein than the parental N-G protein, but apparently did not do this for the pY112, perhaps due to the lack of suitable ifferl-specific antibodies. Instead, it might be possible to use GST-NCK SH2 domain and GST-GRB2 SH2 domain overlay blots of A36 N-G and G-N proteins isolated from infected cells for this purpose.

We previously tried to generate a phosphoY112 antibody, when we generated the phosphoY132 antibody (Newsome 2004) but unfortunately it did not work. Given the unpredictability of the immune response required to generate phosphoY112 antibody we have instead used GFP-Nck (SH2) recruitment in Nck-/- cells as a reporter for phosphorylation of tyrosine 112. Using only the SH2 domain ensures any recruitment must be due to phosphorylation and not any other interaction. The use of Nck-/- cells also ensures there is no competition from endogenous Nck. This new data (Figure 6C) reveals that swopping the positions of the two adaptor binding sites does not impact on the level of GFP-Nck (SH2) recruitment, which indicates Tyr112 is similarly phosphorylated in the A36 N-G and G-N viruses. Importantly, this GFP reporter is not recruited to the virus when Tyrosine 112 is mutated to Phenylalanine (Figure 6 supplement 1B). We used this direct approach of looking at the phosphoprotein at its functional site rather than the overlay blot approach suggested by the reviewer because it does not involve making cell extracts in which it would be necessary to inhibit phosphatases which may change relative phosphorylation levels.

2. Figure 3F: The authors used phosphopeptide pulldowns to show that a p14 pY96 peptide pulled down NCK and that a p14 pY116 peptide pulled down GRB2, but it appears that they did not test if a p14 pY100 peptide could pull down NCK, which seems important. Even though the Y100F mutant form of A36-p15 did not exhibit a deleterious phenotype, it is unclear whether Y100 is in fact phosphorylated in infected cells, and, more importantly, whether it can recruit NCK if it is phosphorylated, e.g. in a Y96F/Y116F mutant background. As indicated above, it is possible that the shorter 16-residue spacing between pY100 and pY116 is incompatible with appropriate signal output.

We have provided the requested pulldowns, which demonstrate the ifferl Y100 peptide does not interact with Nck or Grb2 (Figure 3 supplement 1B).

3. Figure 4: Did the authors demonstrate directly that both Y96 and Y116 in the A36-p14 N-G fusion are phosphorylated and that A36-p14 N-G binds both NCK and GRB2?

The reviewer is correct that we did not provide any data in cells confirming that phosphorylated Y96 and Y116 recruit Nck and Grb2 respectively. We have now examined the recruitment of GFP-tagged Nck and Grb2 to two new recombinant viruses in which Y96 and Y116 are mutated. These new data in (Figure 3 supplement 1A) demonstrate that loss of Y96 but not Y116 leads to a loss of Nck recruitment. Mutation of either residue leads to loss of Grb2 recruitment. We assume the loss of Grb2 recruitment in the Y96F mutant reflects a requirement for the presence of N-WASP (recruited downstream of Nck) for the presence of this adaptor as also seen with Vaccinia (Scaplehorn et al., 2002 and Weisswange et al., 2009).

4. Figure 6: The fact that siRNA knockdown of GRB2 increased pY132 antibody labeling on the A36 N-G virus is interesting. However, the authors should note that SH2 domain binding is reported to increase pTyr levels of target residues in vivo (e.g. see PMID: 1537335), presumably because the SH2-bound pTyr residues are protected from dephosphorylation by PTPs. If this is also the case for GRB2, then one might have expected the siRNA-mediated reduction in GRB2 levels to cause a decrease in pY132 levels, rather than an increase as observed. This issue would be worth some discussion.

We initially had this in the discussion of an earlier draft of the manuscript before submission but it got edited out when we were reducing the word count. We have now added the removed text and discuss its relevance in light of our observations (see lines 395 to 415).

5. Figure 7: The authors should indicate in the text that spacing of the extra GRB2 sites in A36-G-N-G and G-G-N viruses was also 20 aa.

We have indicated this in the text (see line 316).

6. Did the authors make and test an A36 N-N virus? This might generate too “strong” a signal and perturb the output. A pertinent example here would be ES cells in which the key FGFR-GRB2/SOS-RAS-ERK pathway is disrupted when endogenous GRB2 is replaced by a GRB2 with a superbinder SH2 domain that causes pathway hyperactivation and thereby prevents primitive endodermal lineage formation (PMID: 23452850).

We have generated recombinant viruses and examine the impact of having both two Nck or two Grb2 binding sites on actin tail formation. These data in (Figure 2 supplement 2A) reveals that there is no improvement in the number of virus inducing actin tails or their length when there are two binding sites for either adaptor.

7. A propos whether both Y112 and Y132 are simultaneously phosphorylated in a single A36 molecule, is the stoichiometry of phosphorylation at these two sites known. Also, would it be possible for two neighboring A36 molecules in the outer membrane of a single virion to collaborate if Y112 is phosphorylated in one A36 molecule and Y132 phosphorylated in the second A36 molecule?

The reviewer raises an interesting point, which to our knowledge has not been addressed in any system (eg phosphorylated receptors) as mass spec and ifferl-blots are bulk rather than single molecule assays. Our ongoing estimates of the number of A36 molecules on the virus, using GFPnanocages as a reference is over 500. However, the number of these molecules that are actually phosphorylated remains unknown. Independent of this issue, we would rather favour both residues are phosphorylated in a single molecule although we have no formal evidence that this is actually true. One reason to think this is we and the Kalman lab have seen that active Src/Abl family kinases are constitutively associated with virus undergoing actin dependent motility (Newsome et al., 2004. PMID: 15297625 and 2006 PMID: 16441434; Reeves et al., 2005 PMID: 15980865). This contrasts the situation in most other contexts where, Src/Abl kinases are only associated transiently to phosphorylate their substrates. This constitutive association of Src /Abl with the virus might explain why we don’t see a reduction in P-tyr signal when Grb2 is not recruited (see point 7 above). Our new data in Figure 6 A, B also reveals that swopping the position of the adaptor binding sites does not impact the levels of activated Src associated with the virus.

Reviewer #2:

In my view the most serious concerns with the data as presented relate to mechanisms that might explain the apparent decrease in Grb2 binding when it is positioned N-terminal to the Nck binding site. I think the simplest explanation is that for some reason Grb2 binding sites are not as well phosphorylated when positioned N-terminally. This could be due to decreased accessibility to the kinases, increased accessibility to phosphatases, decreased accessibility of the phosphorylated site to Grb2, or many other possibilities. The experiments that show robust phosphorylation of the N-terminal Grb2 site (Figure 6) are compromised by several factors. First, only a phosphospecific antibody to the Grb2 site is used in these experiments. Similar experiments using a phosphospecific Nck binding site antibody in parallel would control for a number of issues, including whether position consistently affects relative steady state phosphorylation of both sites.

Reviewer 1 raised a similar issue (see Q4 and response above) which we have addressed using the recruitment of GFP-Nck (SH2) domain in Nck-/- cells as a reporter for phosphorylation of tyrosine 112. This new data in figure 6C confirms tyrosine 112 is equally well phosphorylated in the swopped configuration.

Furthermore, while I understand that the authors are most interested in the phosphorylation state of A36 directly under virus particles (where actin tails are assembling), it would be very informative to see results from simple immunoblots of whole cell lysates to assess bulk phosphorylation of Nck and Grb2 sites in cells infected with various viruses.

Only a small proportion of A36 is phosphorylated at the plasma membrane in infected cells as most of the protein remains in the Golgi. It was for this reason we decided to look directly at the tyrosine phosphorylated population by IF rather than indirect immunoblots. In the past we have struggled to do tyrosine phosphoblots on A36. However, after testing several different phosphotyrosine antibody and gel running conditions we now show that the level of A36 phosphorylation of A36 in N-G and G-N virus infected cells is similar (Figure 6 supplement 1A).

The argument that the apparent increase in Grb2 binding site phosphorylation might be due to decreased shielding from antibody of sites by bound Grb2 (p. 10) is not very compelling to me, especially since Grb2 knockdown has a very modest (and statistically insignificant) effect on antibody binding to this site.

We agree that the result is not as impressive as one would like. However, in many respects it is amazing that there is a difference as we know the virus is very efficient at recruiting host factors. Basically, it is very good at recruiting any residual protein after an RNAi knockdown. The other issue is we do not have an antibody to look at endogenous Grb2 localization. To get around the lack of antibody we have made use of a GFP-GRB2 stable cell line to look at recruitment (see Figure 4A and 5A).

We have now repeated our knockdown experiment with new siRNA oligos to deplete endogenous Grb2. The level of Grb2 knockdown was better although still not complete. We have replaced the original graph with the new data (Figure 6 supplement 1C) but once again the difference is not statistically significant although the ratio of the means has changed to 1.64 from 1.24 fold. As an alternative to RNAi, we also tried to use CRISPR based approaches to make a Grb2 KO HeLa cell line. Unfortunately, our HeLa cells did not survive single cell cloning or FACS sorting after transfection of three different targeting vectors.

Furthermore, the authors do not account for the effect of bound SH2 domains in increasing overall phosphorylation of their binding sites by protecting them from dephosphorylation; this would tend to oppose any apparent decrease in antibody accessibility due to SH2 binding.

This point was also raised by reviewer 1 (Q 7 and 10). We assume that our phosphoY132 antibody would only work if there was a free phosphate group that is not bound by the SH2 domain of Grb2. If this is the case, then the lack of Grb2 recruitment to the A36 G-N virus would explain why the signal of the pY132 antibody is greater than the A36 N-G virus (Figure 6D).

We have previously looked to see if the virus recruited tyrosine phosphatases (Tensin1, 2 and 3 as well as SHP1 and SHP2). We saw no evidence for recruitment. This doesn’t rule out that another tyrosine phosphatase is present in the system. However, as mentioned above (reviewer 1 Q10) the virus constitutively recruits and activates Src/Abl family kinases. In light of this, it is possible that there is little or no role for a tyrosine phosphatase in the system (an interesting notion in itself). This would also help explain why in the A36 G-N virus we see more pY132 signal (Figure 6D) and also why knockdown of Grb2 leads to a modest increase in signal (Figure 6 supplement 1C). We mention these issues/possibilities in the discussion.

In general, I think it would have been helpful to compare results for various constructs with those for the N-X virus (completely lacking the Grb2 site), in order to assess their activity relative to when Nck binding is maximal and Grb2 binding is abolished. However I don’t believe this is essential, given the amount of work required to re-do experiments.

This data was provided for Figure 5C and it is not immediately clear to us which additional experiments the reviewer would like to see or if it is more about putting the existing N-X data into graphs in the main figures? Given, this we have not added any additional data to address the reviewers question given they state it is not essential and the amount of additional work that would be required will not impact on the take home message of our study.

Reviewer #3:

A key question is whether the authors are assessing exclusively the impact of the order of sites, or whether some sites are more or less efficient within the context of the full-length protein. Figure 2B Suppl 1 may indicate the authors’ interpretation is not as straightforward as it seems, all three replicates reveal a downward trend in actin tail length when comparing A36-NX with A36-X-N. While not significant according to the authors’ statistical test, this may be a question of sensitivity. This suggests that the difference between the two sites is not as black and white as the authors interpret. Conversely, when it suits the authors’ hypotheses, they choose to interpret non-significant differences as supporting their claims (increased pY132 labelling in 6B). I recommend couching the interpretation of Figure 2B Suppl 1 to include the possibility that the sites may not be equivalent or provide data that better supports the authors’ interpretation.

We have changed the text accordingly to ensure we are consistent in our language and interpretations throughout the manuscript.

Some details on the validation of recombinant viruses appears to be missing. Were multiple independent clones testing to exclude the possibility that selected viruses didn’t carry extraneous (off-target) mutations. The information that multiple clones had similar plaque sizes, for example, would strengthen the analysis.

We actually isolated two independent clones for most of the virus strains. We have now provided plaque sizes for key viruses A36 G-N (Figure 2 supplement 1C) and A36 G-N-G and A36 G-G-N (Figure 7 supplement 2A, B). These new data reveal there are no differences between the different independent virus isolates.

In general, the manuscript was clear, concise and well written. I do think the sentence on L274 should be reworded: “This increase was less dramatic than the G-N virus as the knockdown was not complete and the virus is good at recruiting any remaining Grb2”. The ‘increase’ being less dramatic due to incomplete knockdown is an interpretation, not a statement of fact; and the virus being ‘good’ at recruiting Grb2 sounds overly colloquial.

This point was raised by reviewer 2 and we have edited the text as requested in the absence of being able to generate a Grb2 KO HeLa cell line using CRISPR based approaches.

Reviewer #4 (Recommendations for the authors):

There are several strengths to this manuscript. The experiments are well thought out and performed, the data and analysis are high quality, and the writing is clear and concise. The data obtains from the experiments that the authors performed support their conclusions and create new and interesting questions that focus on the organization of protein oligomers that make up numerous signal transduction networks at the plasma membrane. Perhaps the most important observation is that the arrangement of Grb2 and Nck binding sites on disordered tails controls actin polymerization on more than just A36. By testing this arrangement on an unrelated viral protein, p14, the authors reinforce that the spatial positioning of Grb2 and Nck binding sites on disordered tails is a general principle that should be considered and tested when studying membrane-associated signaling systems. The major weakness of this paper lies over-extending the general principles to the field of biological phase separation. This isn’t to say that the general principles revealed in their manuscript aren’t applicable to the field, but the connection, as is, is overstated. Because the referenced LAT and nephrin phase separating systems are dependent on multivalency for either Grb2 or Nck, it is unclear how well A36, which contains only a single binding site for either Grb2 or Nck and has not been shown to undergo phase separation, will be predictive of LAT or nephrin condensates. However, this weakness can be easily addressed by either a deeper discussion of the implications for biological condensate formation, and function by phase separation or by toning down the assertion that there are implications for biological phase separation. Regardless of the implications for phase separation biology, this study offers a unique look into the spatial arrangement that regulates pathogen signaling and behavior and is therefore of wide interest across multiple fields of biology.

We have modified the text as requested to avoid over statements.

Comments:

1) ‘Arp2/3’ should be ‘Arp2/3 complex’ throughout the manuscript (it is currently written as both Arp2/3 or Arp2/3 complex).

We have modified the text so we always use Arp2/3 complex throughout the manuscript.

2) In lines 99-102, the authors state that “both WIP and N-WASP only have two Nck binding sites, each with distinct preferences for the three adaptor SH3 domains.” The way that this is written implies that there is a single binding configuration for the three SH3 domains of Nck for the PRMs in WIP and N-WASP which would generate heterodimers of Nck with either WIP or N-WASP. I’m not sure this is what the authors intended to say; from a biochemical perspective each SH3 domain of Nck has a different affinity for individual PRMs in WIP and N-WASP and a more likely outcome at high concentrations, like those bound at A36, would result in a network in which individual Nck SH3 domains simultaneously bind any of the numerous PRMs in WIP and N-WASP (>6 in N-WASP) to generate an Nck-WIP-N-WASP network.

Our original experiments with peptide arrays and recombinant Nck demonstrated that there are only two binding sites for the adapter in both WIP and N-WASP (Donnelly et al., 2013 PMID: 23707428). These experiments were performed at concentrations which are likely to be much higher than on the virus. Furthermore, our pulldowns with GFP-WIP lacking these two binding sites failed to interact with Nck although the protein was still capable of binding N-WASP via its WH1 domain (See Donnelly Figure 2B). In addition, GFP-N-WASP but not the mutant lacking the two Nck binding sites was unable to interact with Nck in the absence of WIP and its homologue WIRE (See Donnelly Figure 3C). In our mind these well controlled data demonstrate independent of the different affinities each Nck SH3 might have for PRMS that there are only 2 Nck binding sites in WIP and N-WASP. Furthermore, additional in vitro peptide pulldown experiments with recombinant Nck SH3 mutants demonstrated that the two binding sites in WIP are only recognized by the first and third Nck SH3 domains, while the first and second SH3 domains have a higher affinity for the two sites in N-WASP (See Donnelly Figure 4B). Nck with a mutated second SH3 binding site is also incapable of pulling down N-WASP in cell lysates (See Donnelly Figure 4E). Given this, we think that different SH3 sites are capable of interacting but at the end of the day there are only two Nck binding sites in WIP and N-WASP rather than the higher numbers as many people think. Moreover, I think there is a lot more to SH3 binding site specificity beyond PxxP that the field still needs to explore. We have modified the discussion to bring these points out (see text starting at line 369).

3) The authors make a viral mutant that contains two Grb2 binding sites (G-G-N and G-N-G and state that their data demonstrates that the position Nck and Grb2 binding sites controls signaling output and that the number of Grb2 binding sites does not influence signaling output (Line 280, section title). While this is certainly the case for actin polymerization, it may not be accurate for other signaling pathways downstream of Grb2. To this reviewer, there are two avenues to address this: 1) Change the section title to reflect only actin polymerization, which their data supports, or 2) perform additional experiments to assess Grb2-specific signaling networks. Given that the authors have previously not observed Sos1 at Vaccinia A36 with wild-type tails (Scaplehorn et al., 2002), perhaps adding a second binding sites would result in Sos1 recruitment and alter signaling downstream of A36. The impact of the manuscript will not be lessened by changing the section title, but the impact of the manuscript will be expanded with this analysis, even if it is a bit tangential to the story.

We have changed the title of the section so it only reflects actin polymerization.

4) There are two changes to the discussion that this reviewer would appreciate. The first is expanding the discussion of potential underlying mechanisms that would require specific positioning of Nck and Grb2 considering the data presented in the manuscript. Might the positioning of N-WASP nearer the membrane be important for N-WASP – PIP2 binding (Benesch et al., J Biol Chem 2002; Papayannopoulos et al., Mol Cell 2005; Rivera et al., Mol Cell 2009)? Or might the positioning of N-WASP, due to the spatial arrangement of Nck and Grb2 binding sites, result in better access to the existing actin cortex at the plasma membrane of the cell?

In the absence of solid structural data, including knowing how A36 is orientated relative to the membrane (Figure 1 shows it perpendicular for ease of illustration but it might be more parallel to the membrane) we feel it is difficult to speculate whether the distance between N-WASP and the plasma membrane is important. Notwithstanding this, the A36 N-X and X-N viruses (Figure 2 supplement 1B) have similar actin tail lengths even though the Nck binding site is 20 residues further away from the A36 transmembrane domain.

5) The second change is reducing the emphasis on the implications for membrane associated condensate formation and behavior. Given the inherent differences in valency between A36 and LAT and Nephrin, it is a little bit of a stretch to directly compare A36 with these signaling networks. However, if there is evidence of A36 undergoing a phase transition on membranes, this should be noted and emphasized. Otherwise, there is the possibility that A36 isn't undergoing a phase transition. Instead, it could be a part of an oligomeric signaling network at the membrane. To this reviewer, this is a more interesting take on these results, as it would provide an alternative mechanism for promoting actin polymerization at the cell membrane which may be applicable to other signaling networks that control actin polymerization, such as those associated with Listeria or Shigella, where there is a fixed number (and density?) of receptors on the membrane that contain a single binding site for effector proteins. This isn't to say that the authors should remove the current discussion, as it is an important consideration for the community of biological phase separation. Rather, the authors should de-emphasize this portion of their abstract and discussion because there are other incredibly interesting implications for the presented observations that can be emphasized to a greater degree.

As requested we have modified the abstract and discussion.

https://doi.org/10.7554/eLife.74655.sa2

Article and author information

Author details

  1. Angika Basant

    Cellular Signalling and Cytoskeletal Function Laboratory, The Francis Crick Institute, London, United Kingdom
    Contribution
    Conceptualization, Formal analysis, Investigation, Visualization, Methodology, Writing - original draft, Writing - review and editing
    For correspondence
    angika.basant@crick.ac.uk
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4754-6647

  2. Michael Way

    Cellular Signalling and Cytoskeletal Function Laboratory, The Francis Crick Institute, London, United Kingdom
    Contribution
    Conceptualization, Supervision, Funding acquisition, Project administration, Writing - review and editing
    For correspondence
    michael.way@crick.ac.uk
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7207-2722

Funding

Cancer Research UK (FC001209)

  • Michael Way

Medical Research Council (FC001209)

  • Michael Way

Wellcome Trust (FC001209)

  • Michael Way

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. For the purpose of Open Access, the authors have applied a CC BY public copyright license to any Author Accepted Manuscript version arising from this submission.

Acknowledgements

We thank Nicola O'Reilly, Dhira Joshi and Stefania Federico (Peptide Chemistry, the Francis Crick Institute) for synthesizing peptides. We thank Cell Services and Genomics Equipment Park at the Francis Crick Institute for their help with maintaining cell lines and DNA sequencing respectively. We thank members of the Way Laboratory for useful discussions and suggestions, in particular Davide Carra, for nucleating the idea of adding an extra Grb2 site, and Alessio Yang for help in generating the Src-GFP construct. We also thank Frank Uhlmann and Neil McDonald (the Francis Crick Institute) for helpful comments on the manuscript. Michael Way was supported by Cancer Research UK (FC001209), UK Medical Research Council (FC001209), and Wellcome Trust (FC001209) funding at the Francis Crick Institute. For the purpose of Open Access, the authors have applied a CC BY public copyright license to any Author Accepted Manuscript version arising from this submission.

Senior Editor

  1. Anna Akhmanova, Utrecht University, Netherlands

Reviewing Editor

  1. Tony Hunter, Salk Institute for Biological Studies, United States

Reviewers

  1. Tony Hunter, Salk Institute for Biological Studies, United States
  2. Bruce Mayer

Version history

  1. Preprint posted: October 8, 2021 (view preprint)
  2. Received: October 12, 2021
  3. Accepted: July 6, 2022
  4. Accepted Manuscript published: July 7, 2022 (version 1)
  5. Version of Record published: July 27, 2022 (version 2)

Copyright

© 2022, Basant and Way

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,090
    Page views
  • 323
    Downloads
  • 2
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Angika Basant
  2. Michael Way
(2022)
The relative binding position of Nck and Grb2 adaptors impacts actin-based motility of Vaccinia virus
eLife 11:e74655.
https://doi.org/10.7554/eLife.74655

Categories and tags

Further reading

    1. Cell Biology
    2. Stem Cells and Regenerative Medicine

    Activin A marks a novel progenitor cell population during fracture healing and reveals a therapeutic strategy

    Lutian Yao, Jiawei Lu ... Maurizio Pacifici
    Research Article

    Insufficient bone fracture repair represents a major clinical and societal burden and novel strategies are needed to address it. Our data reveal that the TGF-β superfamily member Activin A became very abundant during mouse and human bone fracture healing but was minimally detectable in intact bones. Single cell RNA-sequencing revealed that the Activin A-encoding gene Inhba was highly expressed in a unique, highly proliferative progenitor cell (PPC) population with a myofibroblast character that quickly emerged after fracture and represented the center of a developmental trajectory bifurcation producing cartilage and bone cells within callus. Systemic administration of neutralizing Activin A antibody inhibited bone healing. In contrast, a single recombinant Activin A implantation at fracture site in young and aged mice boosted: PPC numbers; phosphorylated SMAD2 signaling levels; and bone repair and mechanical properties in endochondral and intramembranous healing models. Activin A directly stimulated myofibroblastic differentiation, chondrogenesis and osteogenesis in periosteal mesenchymal progenitor culture. Our data identify a distinct population of Activin A-expressing PPCs central to fracture healing and establish Activin A as a potential new therapeutic tool.

    1. Biochemistry and Chemical Biology
    2. Cell Biology

    Mitochondrial temperature homeostasis resists external metabolic stresses

    Mügen Terzioglu, Kristo Veeroja ... Howard T Jacobs
    Research Article

    Based on studies with a fluorescent reporter dye, Mito Thermo Yellow (MTY), and the genetically encoded gTEMP ratiometric fluorescent temperature indicator targeted to mitochondria, the temperature of active mitochondria in four mammalian and one insect cell line was estimated to be up to 15°C above that of the external environment to which the cells were exposed. High mitochondrial temperature was maintained in the face of a variety of metabolic stresses, including substrate starvation or modification, decreased ATP demand due to inhibition of cytosolic protein synthesis, inhibition of the mitochondrial adenine nucleotide transporter and, if an auxiliary pathway for electron transfer was available via the alternative oxidase, even respiratory poisons acting downstream of oxidative phosphorylation (OXPHOS) complex I. We propose that the high temperature of active mitochondria is an inescapable consequence of the biochemistry of OXPHOS and is homeostatically maintained as a primary feature of mitochondrial metabolism.

    1. Cell Biology

    Rab12 is a regulator of LRRK2 and its activation by damaged lysosomes

    Xiang Wang, Vitaliy V Bondar ... Anastasia G Henry
    Short Report Updated

    Leucine-rich repeat kinase 2 (LRRK2) variants associated with Parkinson’s disease (PD) and Crohn’s disease lead to increased phosphorylation of its Rab substrates. While it has been recently shown that perturbations in cellular homeostasis including lysosomal damage can increase LRRK2 activity and localization to lysosomes, the molecular mechanisms by which LRRK2 activity is regulated have remained poorly defined. We performed a targeted siRNA screen to identify regulators of LRRK2 activity and identified Rab12 as a novel modulator of LRRK2-dependent phosphorylation of one of its substrates, Rab10. Using a combination of imaging and immunopurification methods to isolate lysosomes, we demonstrated that Rab12 is actively recruited to damaged lysosomes and leads to a local and LRRK2-dependent increase in Rab10 phosphorylation. PD-linked variants, including LRRK2 R1441G and VPS35 D620N, lead to increased recruitment of LRRK2 to the lysosome and a local elevation in lysosomal levels of pT73 Rab10. Together, these data suggest a conserved mechanism by which Rab12, in response to damage or expression of PD-associated variants, facilitates the recruitment of LRRK2 and phosphorylation of its Rab substrate(s) at the lysosome.