Chlamydomonas ARMC2/PF27 is an obligate cargo adapter for intraflagellar transport of radial spokes
- Department of Cellular Biology, University of Georgia, United States
- Department of Biological Sciences, Marquette University, United States
- Division of Natural Sciences,, Oglethorpe University, United States
Figures
Figure 1 with 2 supplements
PF27 encodes ARMC2.
(A) Map of the ARMC2 gene. The open arrowhead indicates the position of the insertion in the CLiP mutant LMJ.RY0402.155726. (B) Average swimming velocity of the strains as indicated. The standard …
Figure 1—figure supplement 1
Cloning, mass spectroscopy, and structure of Chlamydomonas ARMC2.
(A) Western blots of flagella isolated from control, pf27, and armc2 probed with antibodies against RSP3 or RSP23/NDK5; to test for equal loading, we used antibodies directed against the outer …
Figure 1—video 1
armc2 has a paralyzed flagella phenotype.
Time lapse video of armc2 mutant cells. The video was recorded at 3 fps using phase contrast and a Nikon Eclipse 55i microscope equipped with a 40×/0.65 objective and a Zeiss AxioCam ERc5S. The …
Figure 2 with 3 supplements
ARMC2-3xTAG is highly enriched in regenerating flagella.
(A) TIRF imaging of ARMC2-3xTAG in the pf27 background (a, b) and the pf14 armc2 double mutant background (c, d) in full-length (a, c) and in regenerating flagella (b, d). Bars = 2 s 2 µm. The …
Figure 2—figure supplement 1
ARMC2-3xTAG accumulates at the tip of growing flagella.
(A) Bright field (a, d, g), TIRF (b, e, h), and merged images (c, f, i) of ARMC2-3xTAG in full-length (a–c) and regenerating (d–i) flagella of the pf27 ARMC2-3xTAG strain. Bar = 2 µm. (B) Schematic …
Figure 2—figure supplement 2
ARMC2-3xAG is enriched in growing flagella.
(A, B) Quantification of the Western blot shown in Figure 2E. (A) Quantification of lanes 1 and 2, in which equal number of flagella were loaded. To normalize, the signal obtained with the …
Figure 2—video 1
Anterograde intraflagellar transport (IFT) of ARMC2-3xTAG.
Video and corresponding kymogram showing transport of ARMC2-3xTAG by anterograde IFT to the flagellar tip, dwelling at the tip, and return to the ciliary base by diffusion. The video was recorded at …
Figure 3 with 1 supplement
ARMC2-mS and RSP3-NG co-migrate by anterograde intraflagellar transport.
(A) Two-color TIRF imaging of a regenerating (a–c) and a full-length (d–f) flagellum of the armc2 pf14 ARMC2-mS RSP3-NG strain. Horizontal trajectories result from residuals unbleached RSP3-NG in …
Figure 3—video 1
Cotransport of RSP3-NG and ARMC2-mS.
Movies and corresponding kymograms of a flagellum form armc2 pf14 ARMC2-mS RSP3-NG cells. Shown are the RSP3-NG and ARMC2 single channels and the merged image. An out-of-focus stretch of frames was …
Figure 4
RSP3-NG ARMC2-mS complexes dissociate at the flagellar tip.
Kymograms from simultaneous imaging of the cargo adapter ARMC2-mS (a, d, g) and its cargo RSP3-NG (b, e, h); the merged images are shown in c, f, and i. The end of the dwell phase and concomitant …
Figure 5 with 3 supplements
ARMC2-3xTAG transport is upregulated in short flagella.
(A) Gallery of brightfield (BF) and TIRF still images and the corresponding kymograms of long-short p27 ARMC2−3xTAG cells. No BF image was recorded for the cell shown in a. The length of the long (L)…
Figure 5—figure supplement 1
ARMC2-FP forms a pool near the basal bodies.
(A) Two-color epifluorescence image of the pf14 armc2 RSP3-NG ARMC2-mS strain. Note accumulation of ARMC2-mS (red) at the flagellar base. The bright signal of the cell body likely results from …
Figure 5—video 1
ARMC2-3xTAG transport in long-short cells.
Bright-field and TIRF video and the corresponding kymogram of a long-short pf27 ARMC2-3xTAG cell. Cells were sheared to generate long-zero cells and allowed to regrow missing flagella. The video was …
Figure 5—video 2
ARMC2-3xTAG transport in long-short cells.
Bright-field and TIRF video and the corresponding kymogram of a long-short pf27 ARMC2-3xTAG cell. Cells were treated for 1 hr in CHX, sheared to generate long-zero cells and allowed to regrow …
Figure 6
ARMC2-mS is transported independently of IDA3-NG and IC2-NG.
(A) Schematic presentation of two models for intraflagellar transport (IFT)-cargo interaction using radial spokes (RSs), outer dynein arms (ODAs), and I1 inner dynein arms (IDAs) and their adapters …
Tables
Table 1
Frequency of cargo cotransport.
The table list the observed anterograde transports for ARMC2-mS, RSP3-NG, IDA3-NG, and IC2-NG in flagella of the corresponding double-mutant-double-rescue strains. For calculating the probability, …
| Strain | ARMC2-mS (n) | RSP3-NG (n) | Cotransports (n) | Time(s) | P(ARMC2-mS) | P(RSP3-NG) | P(cotransports-observed) | P(cotransport-calculated) | Cilia (n) |
|---|---|---|---|---|---|---|---|---|---|
| pf14 armc2RSP3-NG ARMC2-mS (full length) | 125 | 42 | 26 | 1504 | 0.083 | 0.028 | 0.017 | 0.0023 | 17 |
| pf14 armc2RSP3-NG ARMC2-mS (regenerating) | 578 | 130 | 104 | 1622 | 0.36 | 0.08 | 0.064 | 0.029 | 20 |
| ARMC2-mS (n) | IDA3-NG (n) | Cotrans-ports (n) | Time(s) | P(ARMC2-mS) | P(IDA3-NG) | P(cotransports-observed) | P(cotransport-calculated) | Cilia (n) | |
| ida3 armc2IDA3-NG ARMC2-mS (regenerating) | 243 | 106 | 20 | 905 | 0.27 | 0.12 | 0.022 | 0.03 | 35 |
| ARMC2-mS (n) | IC2-NG(n) | Cotrans-ports (n) | Total time(s) | P(ARMC2-mS) | P(IC2-NG) | P(cotransports-observed) | P(cotransport-calculated) | Cilia (n) | |
| oda3 oda armc2 ODA6-NG ARMC2-mS (regenerating) | 82 | 78 | 3 | 1575 | 0.052 | 0.049 | 0.0019 | 0.0026 | 20 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Chlamydomonas reinhardtii) | CC-1387, pf27, mt+ | Chlamydomonas Resource Center | RRID: SCR_014960 | |
| Genetic reagent (Chlamydomonas reinhardtii) | CC-613, pf14, mt- | Chlamydomonas Resource Center | RRID: SCR_014960 | |
| Genetic reagent (Chlamydomonas reinhardtii) | LMJ.RY0402.155726, armc2 mt- | Chlamydomonas Resource Center | RRID: SCR_014960 | |
| Genetic reagent (Chlamydomonas reinhardtii) | CC-2238 oda16 mt+ | Chlamydomonas Resource Center | RRID: SCR_014960 | |
| Genetic reagent (Chlamydomonas reinhardtii) | CC-5412, ida3:IDA3-NG, mt+ | Chlamydomonas Resource Center | RRID: SCR_014960 | |
| Transfected construct (Escherichia coli) | DH10B cells | New England BioLabs | – | Competent cells |
| Antibody | Rabbit anti-Sheep IgG (H + L) Secondary Antibody, HRP | Thermo Fisher | Catalog #: 31480. http://antibodyregistry.org/AB_228457 | WB 1:2000–5000 |
| Antibody | Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody | Thermo Fisher | Catalog #: 31432. http://antibodyregistry.org/AB_228302 | WB 1:2000–5000 |
| Antibody | IgG (H + L) Goat anti-Rat, HRP, Invitrogen | Thermo Fisher | Catalog #: 31470. http://antibodyregistry.org/AB_228356 | WB 1:2000–5000 |
| Antibody | Goat anti-mouse IgG (H + L) Alexa Fluor 488 (mouse polyclonal) | Invitrogen | Catalog #: A-11029.RRID: AB_2534088 | IF 1:800 |
| Antibody | Goat anti-rabbit IgG (H + L) Alexa Fluor 568 (rabbit polyclonal) | Invitrogen | Catalog #: 11,036.RRID: AB_10563566 | IF 1:800 |
| Antibody | Anti-HA, High Affinity (rat monoclonal, clone 3F10) | Roche/Sigma | Catalog #: 11867423001 | WB 1:800 |
| Recombinant DNA reagent | pGEMT-ARMC2(–3xTAG/mS) plus Hyg | This paper | Expression vector encompassing the up- and downstream flanking regions of the ARMC2 gene, optional mS or 3xTAG (NG-3xHA-6xHis) epitope tags and the aph7” selectable marker gene. Available from the corresponding authors. | |
| Sequence-based reagent | S1** | This paper | PCR Primer | CCGCCTGCACCCTTATCGCTGCCTCTGTCCCTCTTCC |
| Sequence-based reagent | AS2 | This paper | PCR Primer | CCTGTTCCGCACGCTGGTCTACCGTCTACC |
| Sequence-based reagent | S3* | This paper | PCR Primer | CGAGGCGGTGAGCGAGCACGTGTTCCGACTCATG |
| Sequence-based reagent | AS3* | This paper | PCR Primer | GCCTCACGGTACCGTGAGCACATGCATGGGTTTGC |
| Sequence-based reagent | S4 | This paper | PCR Primer | CGCAACCCCCGCTACTCTAACCTCGAGG |
| Sequence-based reagent | AS4Hind | This paper | PCR Primer | CAGAAGCTTGAAGCCCGAAAGCTGACGAAGTGGG |
| Sequence-based reagent | HindS6.1 | This paper | PCR Primer | GAGAAGCTTACCTACCTGGGTCTTGACATGCCCTGTCC |
| Sequence-based reagent | AS5Xho | This paper | PCR Primer | CCTCGAGCTCCGGCAACGCCTCCAGCTCC |
| Sequence-based reagent | XhoS7 | This paper | PCR Primer | CCTCGAGTAGGGGCCCTTGCTTAGGGAATTCAGGG |
| Sequence-based reagent | AS6 | This paper | PCR Primer | CTCGCTTTCACAACTCCAGGGTGCCCATGC |
| Sequence-based reagent | ida3f | This paper | PCR Primer | ATTTGGACGGAGCCTTGAC |
| Sequence-based reagent | ida3r | This paper | PCR Primer | TGTTTCGCACGCCTTCA |
| Chemical compound, drug | ProLong Gold Antifade Mountant | Thermo Fisher | Catalog #: P36934. RRID:SCR_015961 | Catalog number #: P36930 |
