We sought to better understand the processes that govern the choice and efficiency of DNA repair in CRISPR-Cas9-induced breaks. To this end, we conducted arrayed screens where we fused ~450 human proteins and protein domains involved in DNA repair to the C-terminus of wild-type (WT) Streptococcus pyogenes Cas9 (Cas9WT, Figure 1a, b, Figure 1—figure supplement 1, Supplementary file 1). The DNA repair protein ORFs were cloned to a Gateway-compatible Cas9 destination plasmid, and the plasmids and a repair DNA template transfected to a clonal HEK293T reporter cell line. The line contains a non-functional green fluorescent protein (GFP), a guide targeting the mutant GFP (sgGFP), and functional blue fluorescent protein (BFP) as a positive selection marker. The proportion of cells that turned GFP positive was used as a proxy for HDR efficiency.

Figure 1 with 6 supplements see all

Download asset Open asset

After the initial screen, we chose to validate Cas9WT fusions with >4% GFP+ cells per well or HDR improvement >2 times relative to experiment average (total 52 fusions from two independent screens) (Figure 1b, and Materials and methods). We transfected the Cas9 fusion plasmids to clonal reporter HEK293T and RPE-1 (hTERT immortalized retinal pigment epithelium) cell lines. RPE-1 has a near-normal karyotype and is the target cell type in eye gene therapy.

We found that in the GFP reporter locus, the proteins that improved HDR above the experiment mean were largely similar between RPE-1 and HEK293T cells, with Cas9-HMGB1, a previously published editing-enhancing fusion (Ding et al., 2019), among the good performers (Figure 1c, d and Figure 1—figure supplement 2a). We chose to further validate 31 fusions that performed comparably in these two cell lines. We transfected the fusion plasmids to four different HEK293T cell lines that expressed a guide targeting three transcribed and one non-transcribed endogenous loci, respectively. We quantified the HDR and NHEJ editing by droplet digital PCR (ddPCR) (Figure 1e, f and Figure 1—figure supplement 2b, Figure 1—figure supplements 3–6,). ddPCR is a sensitive and quantitative method to detect HDR and NHEJ at endogenous gene loci after gene editing (Miyaoka et al., 2018, Miyaoka et al., 2016), and the results are comparable to next-generation sequencing-based genome editing quantification (Figure 2—figure supplement 1k,l). We discovered several polymerases among the better-performing fusions (POLD3, POLD2, POLR2H, POLE2) (Figure 1—figure supplement 2b, Figure 1—figure supplements 3–6). In addition, the replication factor C subunits RFC4 and RFC5 performed well in most of the tested loci. POLD3, POLE2, RFC4, and RFC5 are all members of the DNA replication fork machinery Figure 1i.

We chose seven Cas9 fusions for the final validation and transfected them as mRNA to human hTERT immortalized fibroblast lines (BJ-5ta) that each expressed a guide targeting five different endogenous loci, respectively (Figure 2a, b, Figure 2—figure supplement 1a-j). The fusion performance was strongly dependent on individual loci, with POLD3 outperforming the other fusions across the majority of the tested conditions (Figure 2b, Figure 2—figure supplement 1a-j). We further tested the performance of Cas9-POLD3 across decreasing concentrations in the RPE-1 reporter cells and noted that in all four different concentrations, Cas9-POLD3 outperformed Cas9WT (Figure 2—figure supplement 2).

Figure 2 with 2 supplements see all

Download asset Open asset

POLD3 is a component of the replicative polymerase δ, and we hypothesized that POLD3 fusion improves genome editing by speeding up the removal of Cas9 from the cut site (Clarke et al., 2018). The faster Cas9 removal results in early recruitment of the DNA damage response machinery to the break and speeds up the DNA repair progression.

To understand whether the speed of the overall DSB DNA repair is increased after Cas9-POLD3 editing, we transfected eight fusion plasmids in the RPE-1 reporter cells and quantified the HDR and NHEJ repair across time by ddPCR (Figure 3a,b). For Cas9WT and the other fusions, there was a linear increase in successful editing toward later (72 hr) time points. For Cas9-POLD3, the editing peaked earlier (24 hr) and plateaued at the later (72 hr) time point. To further quantify how rapidly the DNA damage response activates upon cutting the DNA, we compared the emergence of the early-stage DNA damage marker γH2AX (Mah et al., 2010) which arrives at DNA double-strand breaks within minutes after CRISPR cutting (Figure 3c-e). We transfected BJ-5ta fibroblasts with Cas9WT or Cas9-POLD3 mRNA and a pool of four synthesized or expressed guides targeting three coding (RNF2, STAT3, Enh 4–1) and one non-coding locus (CTCF1) and quantified the γH2AX foci with immunofluorescence microscopy. For Cas9WT, the number of foci steadily increased and peaked at 24 hr, after which the count declined. For Cas9-POLD3 the number of foci was already high in the early time points (Figure 3e), suggesting rapid Cas9-POLD3 recruitment and removal from the DNA. In parallel to γH2AX foci counting, we quantified the NHEJ progression across time by ddPCR in each individual locus (Figure 3f-i). We saw a profoundly increased NHEJ in Cas9-POLD3 treated samples in early (8–12 hr) time points, with the exact change depending on the locus and becoming less distinct after 24 hr. All these experiments suggest that the mechanism for improved gene editing for Cas9-POLD3 is the rapid initiation of DNA repair, possibly due to the early recruitment and removal of the fusion from the DNA. The effect size is locus dependent and is not evident in other fusions where the editing follows the kinetics of Cas9WT.

Figure 3

Download asset Open asset

To better understand how the fusion proteins modify editing, we looked at their formed molecular interactions (interactomes) using affinity purification mass spectrometry (AP-MS) (Figure 4a, b, Supplementary file 2). We first constructed HEK293T cell lines consisting of the GFP reporter and tet-inducible, MAC-tagged (Liu et al., 2018) Cas9 fusions in the isogenic flip-in locus (Figure 4—figure supplement 1). When Cas9 expression is induced, it complexes with the GFP targeting guide and binds and cuts the GFP sequence. The MAC tag in the Cas9 ribonucleoprotein (RNP) complex enables the affinity purification of the complex. Additionally, the MAC tag enables proximity-dependent biotinylation of the interacting and close proximity proteins that can be subsequently purified and identified by mass spectrometry (BioID labelling).

Figure 4 with 1 supplement see all

Download asset Open asset

We mapped the stable molecular interactions for Cas9WT and five Cas9 fusions. These include three DNA replication fork proteins (POLD3, RFC4, and RFC5), the RNA polymerase POLR2H and HMGB1, which is a structural chromatin component and a nucleosome remodeler. We recovered a total of 76 Cas9-POLD3 interactions, none of which have been previously reported (there are a total of nine reported POLD3 interactions). We did not recover any polymerase δ subunit components, likely because the fusion uses the short POLD3 isoform 3 (ENST00000532497.5) which lacks the amino acids (AAs) 1–106 that interact with other polymerase δ subunits (Lancey et al., 2020). Cas9-RFC4 and Cas9-RFC5 had one known interactor for each (both RFC4 and RFC5 have >40 reported interactions). Cas9-HMGB1 had 103 interactors (29 previously reported for HMGB1). The landscape for the Cas9 fusions thus differs somewhat from their corresponding endogenous proteins, particularly for the replication fork components.

Cas9WT and all of the fusions recovered a large number of RNA-binding proteins that presumably bind to the guide, as well as histones and other structural DNA components. The unique interactions of the Cas9 fusions included proteins with known nucleosome remodeling and helicase activity (Supplementary file 3). These include the minichromosome maintenance protein complex (MCM) that interacts with POLD3. Other helicases were RUVB1 and -2 that interacted with the other fusions. MCM and RUVB1-2 are helicase complexes that participate in DNA repair and replication fork stability maintenance (Rajendra et al., 2014; Lossaint et al., 2013). The helicases might aid editing by opening DNA and making it more accessible to Cas9 binding. After cutting, they might dislodge Cas9 from the cutting site and make the DNA ends available for processing by the DNA repair machinery (Richardson et al., 2016, Jones et al., 2017, Clarke et al., 2018).

The POLD3 fusion alters the DNA-binding kinetics of the CRISPR complex and might affect the specificity of the CRISPR binding and cutting. Therefore, we compared the off-target profiles of the Cas9WT and Cas9-POLD3 using GUIDE-Seq (Tsai et al., 2015). Briefly, we electroporated HEK293T cells with a plasmid encoding the fusion, a plasmid encoding the guide, and blunt phosphorylated double-stranded oligodeoxynucleotides (dsODN), which incorporate in the DNA double-strand breaks and are used for selective amplification and sequencing of the DNA break sites. We used a previously published guide (Tsai et al., 2015) against HEK site 4, which is a non-coding target in the HEK293T genome. The cutting with this guide leads to a large number of off-target events, with several off-target sequences being cut more frequently than the on-target site (Tsai et al., 2015). The off-target signature of the Cas9-POLD3 was largely overlapping with the WT nuclease, with slightly less cut sites for Cas9-POLD3 (Figure 5a, b). Based on this data, it is unlikely that the polymerase fusion affects the cutting specificity of Cas9.

Figure 5 with 1 supplement see all

Download asset Open asset

CRISPR-Cas9 gene editing triggers p53-mediated DNA damage response (Haapaniemi et al., 2018) that is proportional to the degree of DNA cutting (Schiroli et al., 2019). To quantify p53 activation, we analyzed the p21 (CDKN1A) expression from RPE-1 cells edited with Cas9WT and Cas9-POLD3 plasmids and an RNF2-targeting guide with no reported off-target effects (Tsai et al., 2015). We noted no difference in p53 activation between the treatment groups (Figure 5—figure supplement 1), suggesting that Cas9-POLD3 does not trigger an overt or long-lasting DNA damage response.

Finally, we compared the indel profiles of Cas9WT and Cas9-POLD3 by deep sequencing of the RNF2 and ELANE target loci (Figure 5c-f). We used unique molecular identifiers (UMIs) in the amplicon primers to account for potential PCR bias. The indel profiles were dependent on the target sequence, with NHEJ (1 bp deletion) dominating in RNF2 and MMEJ (23 bp deletion) dominating in ELANE locus (Figure 5g, h). The outcomes were generally similar between Cas9WT and Cas9-POLD3. Based on these experiments, the polymerase fusion does not affect the CRISPR on- or off-target repair outcomes. However, a larger experiment is necessary for a more comprehensive map of the specificity and the repair outcomes for Cas9-POLD3.

Several Cas9 fusions have previously been reported to increase HDR editing (Charpentier et al., 2018, Jayavaradhan et al., 2019, Yang et al., 2018). Of the published fusions, our screening independently identified Cas9-HMGB1 (Ding et al., 2019) as an editing enhancer. For a broader comparison, we evaluated the performance of Cas9-POLD3 against five additional published fusions: Cas9-DN1S (fragment inhibiting NHEJ initiation by 53BP1 blockade) (Jayavaradhan et al., 2019), Cas9-CtIP (a protein that promotes HDR pathway choice) (Charpentier et al., 2018), Cas9-HE (active fragment of CtIP) (Charpentier et al., 2018), Cas9-Geminin (fragment that targets the Cas9 expression to S-G2 phases of the cell cycle) (Yang et al., 2018), and Cas9 HE-Geminin (the fusion combines both HE and Geminin fragments) (Charpentier et al., 2018). The five fusions showed comparable performance with Cas9-POLD3 in GFP locus in our model cell line, with S cell cycle phase targeting providing the highest benefit (Figure 6a). We further tested four fusions in four endogenous loci in BJ-5ta, RPE-1 and HEK293T lines using two delivery modes (plasmid and mRNA) (Figure 6b and Figure 6—figure supplement 1). The editing enhancement was locus- and cell-type dependent, in line with our observations from the larger screens.

Figure 6 with 2 supplements see all

Download asset Open asset

To understand whether it was possible to use the fusions as CRISPR-Cas9 RNP complexes, we produced Cas9 fusions to POLD3, HMGB1, and HMGB2 in Escherichia coli and transfected them with cationic lipid transfer to RPE-1 and HEK293T reporter cell lines. We excluded Cas9-Geminin, as it has previously been tested as an RNP complex (Gutschner et al., 2016). Cas9-POLD3 performed best in both cell lines, although we cannot exclude differences in transfection efficiency and fusion protein folding to affect editing outcomes (Figure 6c). We also tested the effect of Cas9-POLD3 fusion activity in human embryonic stem cells (hESCs) line and stimulated peripheral blood mononuclear cells (PBMCs) (Figure 6—figure supplement 2). Although the POLD3 fusion showed a trend for improvement in both cell types, the benefit is less pronounced than in the model RPE-1 and fibroblast cells possibly due to cell-type-specific differences in cell proliferation rate and DNA damage and repair signaling (Miyaoka et al., 2016).

hTERT immortalized retinal pigment epithelium cells were purchased from ATCC. HEK293T cells and BJ-5ta cells (to prepare lentiviral constructs for crispr screens) were purchased from ATCC. The hESC H13 line was obtained from the WiCell Research Institute (Madison, WI). Cell lines were purchased directly from the vendor. ATCC uses short tandem repeat profiling to confirm identity of the cell lines. In addition, the cell morphology was consistent with RPE-1, HEK293T, BJ-5ta, and hESC morphology. All cell lines tested negative for mycoplasma during the time of the study. We used Mycoplasmacheck service from Eurofins Genomics. Cell samples were prepared according to the company instructions, labeled with individual barcodes and sent for the testing. No misidentified cell lines were used in the study.

HEK293T, RPE-1, and BJ-5ta cells were cultured at 37°C in a humidified incubator in DMEM (Thermo Fisher Scientific) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific) and 1% penicillin-streptomycin (Thermo Fisher Scientific). After electroporation, cells were cultured in DMEM (Thermo Fisher Scientific) supplemented with 10% FBS (Thermo Fisher Scientific), but without penicillin-streptomycin. Cells were split routinely twice a week using TrypLE Express Enzyme (Thermo Fisher Scientific).

For easy detection of CRISPR-Cas9-mediated homologous recombination, we created a cassette encoding (1) Zeocin resistance gene for selecting stable integrants, (2) mutant GFP (37A-38A-39A) sequence, (3) BFP or red fluorescent protein (RFP) sequence separated from GFP by a 2A self-cleaving peptide, and (4) sgRNA targeting the mutant GFP. When Cas9 along with a repair template correcting the GFP mutation is introduced into these cell lines, gene correction will give rise to functional GFP. GFP fluorescence was measured by fluorescence-activated cell sorting (FACS) after 5 days if Cas9 was delivered as a plasmid, or 4 days if Cas9 was delivered as RNP.

The reporter cassette sequence was cloned to pLenti sgRNA(MS2) plasmid backbone (Addgene #61427). The cassette sequence is shown in Supplementary file 8 and the plasmid will be deposited to Addgene.

The reporter cassette was packaged into lentiviral particles by transfecting HEK293T cells with the reporter cassette plasmid and the two packaging plasmids psPAX2 (Addgene #12260) and pCMV-VSV-G (Addgene # 8454) in equimolar ratios. After 48 hr, the virus-containing supernatant was concentrated 40-fold using Lenti-X concentrator (Clontech). Single-use aliquots were prepared and stored at –140°C.

The cassette was transduced to HEK293T and RPE-1 cells by lentivirus at low multiplicity of infection. The cells were propagated in Zeocin (500 μg/ml) selection media for 2 weeks. After selection, single-cell clones were obtained by sorting BFP+ cells to 96-well plates by flow cytometry. The clones were expanded and frozen for future use.

The cell lines express a guide targeting one of the six endogenous loci: RNF2, ELANE, Enh1-4, STAT3, FANCF. The CRISPR RNA sequences (shown in Supplementary file 5) were synthesized by Eurofins Genomics and cloned to pLentiPuro plasmid (Addgene #52963) according to published instructions (Sanjana et al., 2014). The plasmid identities were verified by Sanger sequencing.

The lentiviruses were prepared and transduced to HEK293T and BJ-5ta cells as described above. The cells were selected with 10 µg/ml puromycin (Thermo Fisher Scientific) or 10 µg/ml blasticidin (Sigma Aldrich) for 7 days prior to aliquoting and freezing.

The DNA repair protein open reading frames (ORFs) and their corresponding sequences are found in the Supplementary file 1 . In addition, the screen set contains 21 prokaryotic exonucleases as well as four engineered protein tags that are inert and function comparably to WTCas9. The corresponding full-lenght ORFs were either picked from the human ORFeome (hORF8.1) or synthesized by Genscript Inc Since Cas9 is a large protein of >2000 AAs, we expected the largest DNA repair proteins (>1000 AA) to lead to a failure in fusion protein expression. Therefore, the DNA repair proteins that exceeded the size of 600 AAs were processed into smaller fragments (100-500 AAs) in between the domain boundaries. The fragments were synthesized by Genscript Inc.

By utilizing the commercial pcDNA-DEST40 backbone (Invitrogen), we constructed a custom mammalian expression plasmid containing a WTCas9 sequence with N- and C-terminal nuclear localization signals, followed by a Gateway recombination site (referred to as Cas9-GW plasmid). Genscript Inc performed the insert synthesis and cloning to pcDNA-DEST40 backbone.

The DNA repair protein inserts were cloned to Cas9-GW plasmids in 96-well plates in 5 l reactions, with 1 μl Gateway LR clonase II enzyme mix (Invitrogen), 50 ng entry plasmid, and 100 ng destination plasmids, respectively, and Tris-EDTA (TE) buffer (pH 8) added to a final volume of 5 μl. After overnight incubation, we transformed 1 μl of the reaction mix to 15–20 μl of DH5-α competent cells (Invitrogen). Plasmids were extracted in 96-well format using the Wizard SV 96 plasmid miniprep kit (Promega) according to manufacturer’s instructions using the Biomek FXP liquid handling system (Beckman Coulter), and eluted to 100 μl TE buffer (pH 8). This yielded a destination plasmid concentration of ~150 ng in the majority of the wells.

Of the resulting five 96-well destination clone plates, we verified one plate by Sanger sequencing. After each screening round, the top hits were validated by Sanger sequencing.

HEK293T cells containing the GFP-BFP-sgRNA reporter cassette were split into 24-well plates at ~100,000 cells/well, 500 μl final volume. The next day, we replaced the media and prepared the transfection complexes in 96-well plates using Fugene HD (Promega) with the following modifications: with 25 μl Opti-MEM (Thermo Fisher), 2 μl Fugene HD (Promega), 400 ng plasmid, and 12.5 pmol repair DNA (synthesized by Eurofins Genomics). After 20 min incubation, the cells were transfected in triplicate, with the end volume of 25 μl transfection mix in each well. Transfections were conducted with Biomek FXP liquid handling system (Beckman Coulter). The cells were grown for 5 days and GFP expression evaluated by FACS as described in the corresponding section.

For the detection of corrected GFP, the Cas9-transfected cells were cultured for 5 days, trypsinized, resuspended in warm culture medium and immediately subjected to FACS. The data was acquired by CyAn II flow cytometer (Beckman Coulter) coupled with Hypercyte robotics (Intellicyt) or iQue screener plus (Intellicyt).

Well information was extracted from the plate fcs file using Kaluza v.1.2 or 2.1 (Beckman Coulter). The number of GFP+ cells per well was obtained by batch gating. The gates used in analyzing the screen FACS data are shown in Supplementary file 6. The effect size for each Cas9 fusion was calculated by normalizing the GFP expression of the individual well either to the average GFP expression of all wells in the plate or to the overall experimental average. The statistical significance was calculated using standard one-way ANOVA test (Supplementary file 4).

We chose 52 Cas9WT-DNA repair fusion constructs for validation. We picked the constructs from the original plates using Biomek i7 robotics and prepared new minipreps from the original constructs using the Wizard SV 96 Plasmid DNA Purification System (Promega), according to the manufacturer’s instructions. The constructs were Sanger sequenced to validate construct identity.

HEK293T cells containing the GFP-RFP-sgRNA reporter cassette were transfected as described in the corresponding section, with the following modifications: seeding on the 48-well plate, 30,000 cells/well; transfection mix: 12.5 μl Opti-MEM (Thermo Fisher), 1.25 μl Fugene HD (Promega), 250 ng plasmid, and 6 pmol repair DNA (synthesized by Eurofins Genomics). After 20 min incubation, the cells were transfected in four replicas. The transfections were performed in parallel plates to account for batch variation between cell culture plates. Transfections were conducted with Biomek i7 liquid handling system (Beckman Coulter). The cells were grown for 5 days and GFP expression evaluated by FACS.

RPE cells containing the GFP-RFP-sgRNA or GFP-BFP-sgRNA reporter cassette were electroporated with Lonza 4D 96-well electroporation system; 400 ng of the plasmid was pre-mixed with 40 pmol of the repair template on the 96-well PCR plate. RPE cells were trypsinized, washed with PBS, and resuspended in the 1 M electroporation buffer (5 mM KCl, 15 mM MgCl₂, 120 mM Na₂HPO₄/NaH₂PO₄, pH 7.2, and 50 mM mannitol) to obtain a cell density of 200,000 cells per 20 μl of the buffer (ratio is for single-well reaction in the electroporation plate); Twenty μl of the cell suspension was then dispensed in each well of the 96-well plate containing pre-mixed plasmids and repair template, gently mixed and transferred to the 96-well electroporation plate (Lonza). Electroporation was conducted using the pulse code EA-104. Instantly after electroporation, 80 µl of pre-warmed medium (DMEM, supplemented with 10% FBS, no antibiotics) was added into each well. Cells were collected and plated on 48-well plates (Costar) containing 300 μl of pre-warmed medium (DMEM, supplemented with 10% FBS, no antibiotics). Liquid handling steps were done with the Biomek i7 platform. Electroporated cells were cultured for 5 days, after which the GFP expression was evaluated by FACS.

We chose 31 Cas9WT-DNA repair fusion constructs for validation in endogenous loci in HEK293T cells. We used four different HEK293T lines, each stably expressing one of the sgRNAs targeting ELANE, CTCF1, Ench4-1, RNF2 genomic loci (CRISPR RNA sequences in Supplementary file 5). Cells seeded to 24-well plates at ~100,000 cells/well were transfected as described above, with the following modifications: 25 μl Opti-MEM (Thermo Fisher), 2.5 μl Fugene HD (Promega), 480 ng of Cas9 fusion plasmid, and 10 pmol repair DNA. After 20 min incubation, the cells were transfected in triplicate. After 5 days of incubation, DNA was extracted with PureLink 96 Genomic DNA kit (Invitrogen) and analyzed using ddPCR.

We performed ddPCR assays to estimate NHEJ and HDR efficiencies at the RNF2, Enh 4–1, FANCF, ELANE, STAT3, CTCF1, and GFP guide target loci. The assay schematic is shown in Supplementary file 7. The fwd and reverse amplicon primers bind outside the homology arms of the repair DNA template. The ddPCR was performed on the QX200 system (Bio-Rad Laboratories). Final reaction mixture volume was 20 µl: 10 µl of 2× ddPCR Supermix for Probes (Bio-Rad Laboratories, 1863024), 8 µl of DNA (concentration normalized to 8 ng/µl), primers (900 nM), reference probe (250 nM), and HDR or NHEJ probe (250 nM). The HDR and NHEJ detection occurs in two separate ddPCR. Each reaction was then loaded into a sample well of an eight-well disposable cartridge (DG8; Bio-Rad Laboratories) along with 70 μl of droplet generation oil (Bio-Rad Laboratories). Droplets were formed using a QX200 Droplet Generator (Bio-Rad Laboratories). Droplets were transferred to a 96-well PCR plate, heat-sealed with foil, and amplified using a conventional thermal cycler. The thermocycling protocol was the following: (1) 95°C - 10 min, (2) 94°C – 30 s, 56°C – 3 min, step repeated 42 times (3) 98°C – 10 min, (4) 4°C – hold. The resulting PCR products were loaded on a QX200 Droplet Reader (Bio-Rad Laboratories), and the data analyzed using QuantaSoft software (Bio-Rad Laboratories). Primer and probe sequences are listed in Supplementary file 7. The data was analyzed with QuantaSoft software. Representative gatings are shown in Supplementary file 7.

RNA was extracted from the frozen cell pellets using the Total RNA Purification Kit (Nordic BioSite, 298–17200) according to manufacturer’s instructions, including the DNAse treatment step (Nordic BioSite, 298–25710). cDNA synthesis was accomplished using the iScript Advanced cDNA Synthesis Kit (Bio-Rad, Cat. no. 1725038), according to the manufacturer’s instructions. Final reaction mixture volume was 20 µl: 10 µl of 2× ddPCR Supermix for Probes (Bio-Rad Laboratories, 1863024), 5 µl of cDNA (concentration normalized to 0.2 ng/µl), 1 µl of Primer-Probe Mix for reference gene (Bio-Rad, GAPDH/HEX ddPCR assay dHsaCPE5031597), 1 µl of Primer-Probe Mix for gene of interest (Bio-Rad, CDKN1A/FAM ddPCR assay dHsaCPE5052298, or IFNB1/FAM ddPCR assay dHsaCPE5040802), 3 µl of DNAse/RNAse milliQ. Each reaction was then loaded into a sample well of an eight-well disposable cartridge (DG8; Bio-Rad Laboratories) along with 70 μl of droplet generation oil (Bio-Rad Laboratories). Droplets were formed using a QX200 Droplet Generator (Bio-Rad Laboratories). Droplets were transferred to a 96-well PCR plate, heat-sealed with foil, and amplified using a conventional thermal cycler. The thermocycling protocol was the following: (1) 95°C – 10 min, (2) 94°C – 30 s, 55°C – 1 min, step repeated 39 times, (3) 98°C – 10 min, (4) 4°C – hold. The resulting PCR products were loaded on a QX200 Droplet Reader (Bio-Rad Laboratories), and the data analyzed using QuantaSoft software (Bio-Rad Laboratories).

Cas9WT fusion mRNA was prepared with HiScribe T7 ARCA mRNA Kit with tailing (NEB-bionordika), according to the manufacturer’s instructions. Total of 8000 ng stock plasmid was digested with 2 μl FastDigest MssI enzyme in the supplemented restriction-digestion buffer, total reaction volume 20 μl. Incubation was carried out at 37°C overnight. Length of the digested product was confirmed by gel electrophoresis. For the IVT reaction, 1000 ng of the linearized plasmid was mixed with 10 μl of 2xARCA/NTP mix and 2 μl of T7 RNA Polymerase mix, and the reaction was incubated for 30 min at 37°C. Sequentially, 2 μl of DNAse enzyme was added and the mixture was incubated at 37°C for 15 min. Poly(A) tailing step was performed by adding 20 μl of milliQ (RNAse free), 5 μl of 10× PolyA polymerase reaction buffer, and 5 μl of 10× PolyA polymerase directly to the IVT reaction, which was incubation at 37°C for 30 min. mRNA was purified using LiCl solution, as described in the manufacturer’s protocol. Aliquots were frozen in –80°C for future use.

We chose seven Cas9WT fusion constructs for validation in endogenous loci in immortalized BJ-5ta fibroblasts. We used five different BJ-5ta lines, each stably expressing one of the sgRNAs (IDT) targeting FANCF, Enh 4–1, STAT3, ELANE, or RNF2 genomic loci (CRISPR RNA sequences in Supplementary file 7). The Cas9 fusion constructs were transfected as mRNA; IVT was performed as described above. BJ-5ta-sgRNA cell lines were electroporated with Lonza 4D 96-well electroporation system as described in corresponding section, with following modifications: 1000 ng of mRNA and 100 pmol of the corresponding HDR repair template per well, cell density 500,000 of cells per 20 µl of the electroporation buffer. Cells were pulsed using code CA-137. Cell culture was carried out on six-well plates for 5 days, followed by the DNA isolation (DNeasy Blood & Tissue Kit (250), Qiagen). Editing efficiency was evaluated by ddPCR as described in the corresponding section.

PBMCs were isolated from whole blood by density gradient separation method using Lymphoprep (StemCell Technologies, #07851). Obtained cells were cultured in the T cell expansion media (RPMI 1640 Medium, GlutaMAX Supplement, HEPES [Gibco, #72400–021] supplemented with 10% FBS [certified, heat inactivated, Gibco, #10082147], 25 μl/ml anti-human CD3/CD28 [StemCell Technologies, #10970], 200 U/ml IL-2 [Recombinant Human IL-2, Peprotech, #200–02], 5 ng/ml IL-7 [Recombinant Human IL-7, Peprotech, #200–07], 5 ng/ml IL-15 [Recombinant Human IL-15, Peprotech, #200–15] with 1× P/S [Penicillin-Streptomycin-Glutamine 100×, Gibco #10378016]) for 3 days prior to the electroporation at 1 × 10⁶ cells/ml density.

Electroporation was performed using the Lonza 4D Nucleofector System, Core Unit (Lonza Cat. no. AAF-1002B) with a 96-well Shuttle Device (Lonza Cat. no. AAM-1001S). 1 × 10⁶ of cells were resuspended in 20 μl of the home-made electroporation buffer (5 mM KCl, 15 mM MgCl₂, 120 mM Na₂HPO₄/NaH₂PO₄, and 50 mM mannitol, pH 7.2), combined with 1000 ng of nuclease/fusion encoding mRNA, 100 pmol of the corresponding sgRNA and 100 pmol of the repair template (ssODN) and electroporated using EO-115 pulse code. After the electroporation, 80 μl of the recovery media (RPMI 1640 Medium, GlutaMAX Supplement, HEPES [Gibco, #72400–021] supplemented with 10% FBS [certified, heat inactivated, Gibco, #10082147], IL-2 at 500 U/ml, without any antibiotics) was added to each well and cells were incubated for 15 min in the 37°C, 5% CO₂. Subsequently, cell suspension from each well was transferred to the 400 μl of the recovery medium pre-dispensed on the 24-well plates. Half of the medium volume from each well was replaced with fresh recovery medium supplemented with 1× P/S (Penicillin-Streptomycin-Glutamine 100×, Gibco #10378016) daily, until the sample collection time point at 96 hr post-electroporation. DNA extraction was done using the DNeasy 96 Blood & Tissue Kit (4) (Qiagen, #69581) according to the kit instructions.

The hESC H13 line (Thomson et al., 1998) was obtained from the WiCell Research Institute (Madison, WI) and cultured on mitomycin-C-treated mouse embryonic fibroblasts (MEFs). HESCs were maintained in DMEM/F-12 (Sigma, #D8900-50L) media containing 15% FBS (Capricorn Scientific, #FBS-ES-HI12A), 5% KnockOut Serum Replacement (Gibco, #10828–028), 1% MEM Non-essential Amino Acids (Gibco, #11140–068), 1% GlutaMAX (Gibco, #35050–038), 1% antibiotic-antimycotic solution (Gibco, #15240–062), 55 μM 2-mercaptoethanol (Gibco, #31350–010), and 5 ng/ml of recombinant human bFGF (Miltenyi Biotec, #130093842). The cells were first passaged 5–6 days prior to the start of the experiment using collagenase type IV (1 mg/ml, Life Technologies, #17104019) and transferred into MEF-coated six-well plates. The media was exchanged 24 hr prior to the electroporation and supplemented with 10 µM Rho Kinase (ROCK)-inhibitor (ATCC, Y-27632).

Immediately before the electroporation, hESC colonies were detached from plates using 1 mg/ml collagenase IV (Gibco, #17104019) and sedimented in 10 ml of PBS, pH 7.4, for 5 min. After brief centrifugation (100× g, 1 min) PBS was removed and hESC were disrupted into single cells using 0.25% trypsin/EDTA solution (Gibco, 25200–114) for 3 min at the 37°C, 5% CO₂. Trypsin was neutralized with hESC media and the cells were pelleted at 150× g for 5 min. The cell pellet was resuspended in 2 ml PBS, pH 7.4, and cells were counted using Trypan blue on the automated cell counter (Countess). Electroporation was performed using the MaxCyte Expert electroporation system with OC-25 × 3 Electroporation Cuvettes (MaxCyte, #238537). For each reaction, 0.4 × 10⁶ of cells were resuspended in 25 µl of the MaxCyte electroporation buffer (MaxCyte, #EPB1), combined with 1000 ng of Cas9 mRNA, 100 pmol sgRNA (IDT) targeting the RNF2 locus and 100 pmol of the repair DNA template and electroporated using Optimization-8 pulse code. After the electroporation, cells in the electroporation cuvettes were incubated for 15 min in the 37°C, 5% CO₂. Then, the cell suspension was transferred to 24-well plates pre-coated with Matrigel (Corning, #734–1440) and supplemented with 1 ml hESC culture media (no antibiotics, supplemented with 10 µM ROCK-inhibitor). The media was exchanged 24 and 72 hr after the electroporation. The DNA was extracted after 96 hr using the DNeasy Blood & Tissue Kit (Qiagen, # 69504) according to the manufacturer’s instructions.

The hit Cas9 fusion proteins were synthesized by GeneArt Inc and cloned to pET301/CT-DEST vector (Invitrogen) or pTH21 vector (van den Berg et al., 2006) for E. coli expression. The Cas9 sequence as well as the sequence and position of nuclear localization signal and GS linker were similar to the Cas9-GW sequence presented in Supplementary file 8 . The exact sequences are listed in the file DNA repair protein domain library.xlsx.

All proteins contained C-terminal His-tags and were expressed in E. coli BL21 (DE3) T1R pRARE2 at 18°C and purified by the Protein Science Facility (PSF) at Karolinska Institutet, Stockholm. Purification was performed using the HisTrap HP column (GE Healthcare) followed by gel filtration step with a HiLoad 16/60 Superdex 200 (GE Healthcare). Purity of the protein preparation was examined using SDS-PAGE followed by Commassie staining. All purified proteins were concentrated, aliquoted, and stored in a storage buffer (20mM HEPES, 300mM NaCl, 10% glycerol, 2mM TCEP, pH 7.5) at –80°C.

We obtained the mGFP-targeting CRISPR and TRACR RNAs from Integrated DNA Technologies (IDT). The CRISPR/TRACR hybridization was performed by incubation of crRNA tracrRNA in equimolar concentrations at 95°C followed by gradual cooling down to room temperature (RT). For RNP complex formation nuclease (protein or fusion) was mixed gRNA in 1:2 molar ratio and incubated 15 min RT. For transfection, reporter HEK293T and RPE-1 cells were plated in 48-well plates at 100,000 cells/well and reverse transfected with 13 pmol of RNP and 6 pmol of repair DNA template using the CRISPRmax transfection reagent (Thermo Scientific) according to the manufacturer’s instructions. For the detection of corrected GFP, the transfected cells were cultured for 4 days, trypsinized, resuspended in warm culture medium, and immediately subjected to FACS. The data was acquired by CyAn II flow cytometer (Beckman Coulter) coupled with Hypercyte robotics (Intellicyt) and analyzed with Kaluza v.1.2 (Beckman Coulter).

HEK293T cells containing the GFP-BFP-sgRNA reporter cassette were transfected as described in the corresponding section, with the following modifications: seeding on the 48-well plate: 30,000 cells/well; transfection mix: 12.5 µl Opti-MEM (Thermo Fisher), 1.25 µl Fugene HD (Promega), 250 ng plasmid, and 6 pmol repair DNA (synthesized by Eurofins Genomics). After 15 min incubation, the cells were transfected in four replicas. The transfections were performed in parallel plates to account for batch variation between cell culture plates.The cells were grown for 5 days and GFP expression evaluated by FACS.

We used immortalized fibroblasts (BJ-5ta) expressing a guide that targets the CTCF1 locus. The cells were electroporated as described above with a pool of sgRNAs (IDT) targeting the Enh 4–1, STAT3, and RNF2 loci, 100 pmol RNA per reaction. The purpose of using the pool is to increase the total number of edited alleles per nucleus for better visualization. After the electroporation, cells were plated on six-well plates containing clean glass coverslips and cultured as described above.

Samples were collected for staining at 8, 12, 24, 48, 72, and 96 hr post-electroporation. We used the coverslips for γH2AX foci quantification, and the cells in the surrounding space in the well for NHEJ quantification by ddPCR (described in the corresponding section). For confocal microscopy, each sample slide was washed twice with PBS and fixed with 4% PFA for 15 min at RT, followed by another PBS washing step and storage at +4°C in PBS, pH 7.4 until the sample collection was finished. The samples were then permeabilized (0.1% Triton X-100 in PBS for 45 min RT) and blocked (PBS with 0.1% Triton X-100, 5% BSA, and 5% goat serum for 45 min RT). After blocking, Anti-phospho-H2AX (Ser139) (Millipore, 05-636-25UG) was added in 1:500 ratio, diluted in 0.1% Tween-20, 0.5% BSA, and 0.5% goat serum in PBS, and the samples were incubated overnight at 4°C. The following day, coverslips with samples were washed three times with 0.1% Triton X-100 in PBS with shaking and Goat anti-Mouse IgG (H + L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 (Thermo Fisher, A-11001) was added in 1:1000 dilution in 0.1% Triton X-100 in PBS and incubated for 1 hr at RT, protected from light. After three additional washes in PBS, nuclei were stained with DAPI (1 µg/ml in PBS). The slides were mounted using Fluoromount Aqueous Mounting Medium (Sigma Aldrich, F4680).

Widefield fluorescence imaging (Z-stacks) was done using Zeiss AxioObserver Z1, with a Plan Apo 40×/1.4 Oil objective and a Hamamatsu ImagEMX2 EMCCD. Imaging settings (filter set, lamp power, and camera exposure) were kept constant for image collection for all samples. Image analysis was done with batch mode in FIJI (ImageJ) with two main steps: (1) Segmentation of region of interest (ROI) to outline cell nuclei with DAPI channel with the FIJI plugin Auto Threshold (Mean) and watershed algorithm. (2) Counting the γH2AX foci in ROIs identified in Step 1 with the FIJI plugin Find Maxima (prominence = 2000). Average foci/nucleus ratio was calculated for each sample based on the quantified results.

The Cas9 fusions that showed a trend for improving over Cas9WT were Sanger sequenced to validate construct identity. We then prepared new minipreps from the original constructs using Qiaprep spin Miniprep kit (Qiagen) according to manufacturer’s instructions.

For the time course experiment, RPE-GFP-BFP-gRNA cells were electroporated using the Lonza 4D 96-well electroporation system as described in the corresponding section with the following modifications: 200,000 cells per each well in 24-well plates; 400 ng of plasmid, 100 pmol of GFP repair template; pulse code changed to EA-104. Cells were gradually collected at 24, 48, 72 hr post-electroporation. DNA extracted using DNeasy Blood & Tissue Kit (250) (Qiagen, #69504). Editing efficiency was evaluated by ddPCR as described in the corresponding section.

For the gradient titration, RPE-GFP-BFP-gRNA cells were electroporated with Lonza 4D 16-well electroporation system as described in corresponding section with the following modifications: 200,000 cells per each well in 24-well plates; 15, 30, 60, 120 pmol of plasmid, 40 pmol of GFP repair template; pulse code changed to EA-104. FACS analysis was performed after 5 days by iQue screener plus (Intellicyt) and analyzed using Kaluza v 2.1 software (Beckman Coulter), as described in corresponding section.

The hit Cas9 fusion proteins were synthesized and cloned to pDNOR221 Gateway entry vector (Invitrogen) by GeneArt Inc Sequences are listed in Supplementary file 1. The inserts were cloned to MAC-Tag-C vector (Liu et al., 2018)(PMID29568061, Addgene ID #108077), which adds a C-terminal MAC tag (contains Strep-tag and modified minimal biotin ligase) to the Cas9 fusion.

For generation of the stable cell lines inducibly expressing the MAC-tagged versions of the baits, Flp-In T-REx 293 cell lines (Invitrogen, Life Technologies, R78007) were first transduced with the lentivirus containing the GFP-BFP-sgRNA cassette, as described in corresponding section. The cells were co-transfected with the MAC-tagged expression vector and the pOG44 vector (Invitrogen) using the Fugene HD transfection reagent (Promega). Two days after transfection, cells were selected in 50 μg/ml streptomycin and hygromycin (100 μg/ml) for 2 weeks.

We tested the presence of the fusion and the functionality of the GFP-BFP-sgRNA reporter cassette by FACS prior to the experiment. The Cas9 expression was induced with 1 μg/ml tetracycline for 24 hr, followed by GFP repair template transfection by RNAiMax transfection reagent (Thermo Fisher Scientific) according to manufacturer’s instructions.

For AP-MS experiments, each stable cell line was expanded to 80% confluence in 20 × 150 mm² cell culture plates. 2 × 5 plates were used for AP-MS approach, in which 1 μg/ml tetracycline was added for 30 hr induction, and 2 × 5 plates for BioID approach, in which in addition to tetracycline, 50 μM biotin was added for 30 hr before harvesting. Cells from 5 × 150 mm fully confluent dishes (~5 × 10⁷ cells) were pelleted as one biological sample. Thus, each bait protein has two biological replicates in two different experiments. All samples from one experiment were processed in parallel. Samples were snap-frozen and stored at −80°C. Analyses of the baits were performed as two biological replicates.

For the AP-MS approach, the sample was lysed in 3 ml of lysis buffer 1 (0.5% IGEPAL, 50 mM HEPES, pH 8.0, 150 mM NaCl, 50 mM NaF, 1.5 mM NaVO₃, 5 mM EDTA, supplemented with 0.5 mM PMSF and protease inhibitors; Sigma).

For BioID approach, cell pellet was thawed in 3 ml ice-cold lysis buffer 2 (0.5% IGEPAL, 50 mM HEPES, pH 8.0, 150 mM NaCl, 50 mM NaF, 1.5 mM NaVO₃, 5 mM EDTA, 0.1% SDS, supplemented with 0.5 mM PMSF and protease inhibitors; Sigma). Lysates were sonicated and treated with benzonase.

Cleared lysate was obtained by centrifugation and loaded consecutively on spin columns (Bio-Rad) containing lysis buffer 1, prewashed 200 μl Strep-Tactin beads (IBA, GmbH). The beads were then washed 3 × 1 ml with lysis buffer 1 and 4 × 1 ml with wash buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 50 mM NaF, 5 mM EDTA). Following the final wash, beads were then resuspended in 2 × 300 μl elution buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 50 mM NaF, 5 mM EDTA, 0.5 mM biotin) for 5 min and eluates collected into Eppendorf tubes, followed by a reduction of the cysteine bonds with 5 mM tris(2-carboxyethyl)phosphine (TCEP) for 30 min at 37°C and alkylation with 10 mM iodoacetamide. The proteins were then digested to peptides with sequencing grade-modified trypsin (Promega, V5113) at 37°C overnight. After quenching with 10% TFA, the samples were desalted by C18 reversed-phase spin columns according to the manufacturer’s instructions (Harvard Apparatus). The eluted peptide sample was dried in vacuum centrifuge and reconstituted to a final volume of 30 μl in 0.1% TFA and 1% CH₃CN.

Analysis was performed on a Q-Exactive mass spectrometer using Xcalibur version 3.0.63 coupled with an EASY-nLC 1000 system via an electrospray ionization sprayer (Thermo Fisher Scientific). In detail, peptides were eluted and separated with a C18 precolumn (Acclaim PepMap 100, 75 μm × 2 cm, 3 μm, 100 Å, Thermo Scientific) and analytical column (Acclaim PepMap RSLC, 75 μm × 15 cm, 2 μm, 100 Å; Thermo Scientific), using a 60 min buffer gradient ranging from 5% to 35% buffer B, followed by a 5 min gradient from 35% to 80% buffer B and 10 min gradient from 80% to 100% buffer B at a flow rate of 300 nl/min (buffer A: 0.1% formic acid in 98% HPLC grade water and 2% acetonitrile; buffer B: 0.1% formic acid in 98% acetonitrile and 2% water). For direct LC-MS analysis, 4 μl peptide samples were automatically loaded from an enclosed cooled autosampler. Data-dependent FTMS acquisition was in positive ion mode for 80 min. A full scan (200–2000 m/z) was performed with a resolution of 70,000 followed by top 10 CID-MS2 ion trap scans with resolution of 17,500. Dynamic exclusion was set for 30 s.

Acquired MS2 spectral data files (Thermo.RAW) were searched with Proteome Discoverer 1.4 (Thermo Scientific) using SEQUEST search engine of the selected human component of UniProtKB/SwissProt database (http://www.uniprot.org/, version 2015–09). The following parameters were applied: Trypsin was selected as the enzyme and a maximum of two missed cleavages were permitted, precursor mass tolerance at ±15 ppm and fragment mass tolerance at 0.05 Da. Carbamidomethylation of cysteine was defined as a static modification. Oxidation of methionine and biotinylation of lysine and N-termini were set as variable modifications. All reported data were based on high-confidence peptides assigned in Proteome Discoverer with FDR < 1%.

The mass spectrometric data was searched with Proteome Discover 1.4 (Thermo Scientific) using the SEQUEST search engine against the UniProtKB/SwissProt human proteome (http://www.uniprot.org/, version 2015–09). Search parameters were set either as in PMID: 29568061(QE runs; BioID) (Liu et al., 2018) or in PMID: 28054750 (Orbitrap Elite runs; AP-MS)(Heikkinen et al., 2017) All data was filtered to medium- (AP-MS) or high-confidence (BioID) peptides according to Proteome Discoverer FDR 5% or 1%, respectively. The lists of identified proteins were conventionally filtered to remove proteins that were recognized with less than two peptides and two PSMs. The high-confidence interactors were identified using SAINT and CRAPome as in Liu et al., 2018. Each sampl22e’s abundance was normalized to its bait abundance. These bait-normalized values were used for data comparison and visualization.

HEK293T cells were cultured in DMEM (Life Technologies) supplemented with 10% FBS, and penicillin/streptomycin at 37°C with 5% CO₂. For each replicate, 300,000 cells were transfected in 20 μl Solution P3 (Lonza) on a Lonza Nucleofector 4-D using the program CM-137, according to the manufacturer’s instructions; 400 ng of pcDNA-pDEST-Cas9wt-POLD3, 150 ng of gRNA encoding plasmid (pU6-gRNA-HEK site 4), and 5 pmol of dsODN were transfected.

The blunt-ended dsODN used in our GUIDE-Seq experiments was the same as which was used in the original publication ( Tsai et al., 2015), and then was prepared by annealing the two modified oligonucleotides of the following compositions:

• 5ʹ- P-G*T*TTAATTGAGTTGTCATATGTTAATAACGGT*A*T -3ʹ and

• 5ʹ- P-A*T*ACCGTTATTAACATATGACAACTCAATTAA*A*C -3ʹ

P represents a 5ʹ phosphorylation and * indicates a phosphorothioate linkage.

Genomic DNA was isolated using Qiagen DNeasy Blood & Tissue Kit (250) (#69506) and sheared with a Bioruptor Pico instrument (15 s ON, 90 s OFF, 7 cycles) to an average length of around 400–500 bp. The sheared gDNA were then end-repaired, A-tailed, and ligated to half-functional adapters, incorporating an 8-nt random molecular index according to the details of the GUIDE-Seq protocol provided in the original GUIDE-Seq paper (Tsai et al., 2015). Next, two rounds of nested anchored PCR, with primers complementary to the oligo tag, were used for target enrichment, as described in original publication (Tsai et al., 2015). Next, the samples were QC by BioAnalyzer 2100, DNA concentrations quantified by Qubit, and samples were pooled together and sequenced using the Illumina MiSeq instrument.

Data analysis was performed using the GUIDE-Seq analysis pipeline (Zhu et al., 2017) . We used custom scripts (https://bitbucket.org/valenlab/guide-seq-pold3; Labun, 2021; copy archived at swh:1:rev:ea73a563ebb6e6679709edeed4ba0cd077b4eece) to extract UMI from the demultiplexed fastq reads and trimmed adapters with cutadapt v2.8 (TTGAGTTGTCATATGTTAATAACGGTAT and ACATATGACAACTCAATTAAAC). Afterward, the data was aligned to the human genome (hg38) using bowtie2 v2.3.5.1 (with options –local –very-sensitive-local). The GUIDE-Seq v1.18 package from Bioconductor was used to call off-targets with the default settings. Final off-targets were normalized against control data (HEK293T cells transfected with dsODN only). Control data was processed in the same pipeline as the modified Cas9 samples.

BJ-5ta cell lines expressing guides against RNF2 and ELANE loci were electroporated as described earlier. The DNA was extracted using the DNeasy Blood Tissue Kit (Qiagen, #69504) according to the kit instructions.

Library preparation was performed using a two-step PCR method. For the first PCR, a pair of target-specific primers was designed to amplify the 150 bp area surrounding the cutting site. Each target primer additionally includes an extension at the 5’ end: for forward primers, this contains the Illumina Read1 primer sequence (see below, nucleotides in bold) and an 8 bp UMI (nucleotides underlined), and for the reverse primers, this contains the Illumina Read2 primer sequence only (see below, nucleotides in bold):

• RNF2 fwd 5’–3’: ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN NNG ACA AAC GGA ACT CAA CCA T

• RNF2 rev 5’–3’: GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC TTG TTC TAT TTA AGT TTT CAT GTT CT

• ELANE fwd 5’–3’: ACA CTC TTT CCC TAC ACG ACG CTC TTC CGA TCT NNN NNN NNC TCC CCG GCA GAA ACG TC

• ELANE rev 5’–3’: GTG ACT GGA GTT CAG ACG TGT GCT CTT CCG ATC TGA GAA TCA CGA TGT CGT TGA GC

For the second PCR, the amplified products were purified using AMPure XP magnetic (Beckman Coulter, #A63882) according to the manufacturer’s instructions, pooled and annealed with i5 and i7 Illumina Index primers. Both primers contain flow-cell-binding region (see below, highlighted in bold), index region (see below, underlined) and Illumina Read1 or Read2 primer binding regions, correspondingly (see below, italics): i5-PCR Index 11:

• AAT GAT ACG GCG ACC ACC GAG ATC TAA CCT GGT TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC*T i5-PCR Index 13:

• AAT GAT ACG GCG ACC ACC GAG ATC TAC GGA ACA AAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC*T i7-PCR Index 13:

• CAA GCA GAA GAC GGC ATA CGA GAT TTC CTC CTG TGA CTG GAG TTC AGA CGT GTG CTC TTC CGA TC*T i7-PCR Index 14:

• CAA GCA GAA GAC GGC ATA CGA GAT TGC TTG CTG TGA CTG GAG TTC AGA CGT GTG CTC TTC CGA TC*T i7-PCR Index 15:

• CAA GCA GAA GAC GGC ATA CGA GAT GGT GAT GAG TGA CTG GAG TTC AGA CGT GTG CTC TTC CGA TC*T i7-PCR Index 16:

• CAA GCA GAA GAC GGC ATA CGA GAT AAC CTA CGG TGA CTG GAG TTC AGA CGT GTG CTC TTC CGA TC*T

PCR products were purified using AMPure XP magnetic beads (Beckman Coulter, #A63882) according to the manufacturer’s instructions and DNA concentrations were measured with Qubit HS kit (Thermo Fisher Scientific, #2113695). Final products were pooled in equimolar concentrations into a single library with final concentration 250 nM (50× concentrate). Sequencing was done using an Illumina MiSeq v2 Micro flow cell, including 10% PhiX. The data analysis was performed using the AmpliCan software package (Labun et al., 2019).

Throughout the article text, we use the term ‘replicates’ to describe biological replicates (measurements of biologically distinct samples which represent biological variation), as opposed to the technical replicates (repeated measurements of the same sample to detect the variations stemming from measurement technique).

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Norwegian Research Council, the South-Eastern Norway Regional Health Authority, Knut and Alice Wallenberg Foundation, Cancerfonden, Barncancerfonden, Instrumentarium Foundation, and Academy of Finland supported this work. Part of this work was carried out at the High Throughput Genome Engineering Facility and the Swedish National Genomics Infrastructure funded by Science for Life Laboratory. We would like to thank the PSF at Karolinska Institutet for recombinant Cas9 production, and the HSØ Genomics Core Facility at Oslo University Hospital for providing the high-throughput sequencing. Sini Nieminen is acknowledged for expert technical assistance. We thank Alicia Roig-Merino and Caoimhe Nic An tSaoir for their advice on MaxCyte electroporation experimental design.

© 2021, Reint, Li et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.