1. Neuroscience

Drosulfakinin signaling modulates female sexual receptivity in Drosophila

  1. Tao Wang
  2. Biyang Jing
  3. Bowen Deng
  4. Kai Shi
  5. Jing Li
  6. Baoxu Ma
  7. Fengming Wu  Is a corresponding author
  8. Chuan Zhou  Is a corresponding author
  1. School of Life Sciences, University of Science and Technology of China, China
  2. State Key Laboratory of Integrated Management of Pest Insects and Rodents Institute of Zoology, Chinese Academy of Sciences, China
  3. University of Chinese Academy of Sciences, China
  4. State Key Laboratory of Membrane Biology, College of Life Sciences, IDG/McGovern Institute for Brain Research, Peking-Tsinghua Center for Life Sciences, Academy for Advanced Interdisciplinary Studies, Center for Quantitative Biology, Academy for Advanced Interdisciplinary Studies, Peking University, China
  5. Chinese Institute for Brain Research, Peking-Tsinghua Center for Life Sciences, Zhongguangcun Life Sciences Park, China
  6. Institute of Molecular Physiology, Shenzhen Bay Laboratory, China
https://doi.org/10.7554/eLife.76025
Share this article
Cite this article
  1. Tao Wang
  2. Biyang Jing
  3. Bowen Deng
  4. Kai Shi
  5. Jing Li
  6. Baoxu Ma
  7. Fengming Wu
  8. Chuan Zhou
(2022)
Drosulfakinin signaling modulates female sexual receptivity in Drosophila
eLife 11:e76025.
https://doi.org/10.7554/eLife.76025
  2. Download BibTeX
  3. Download .RIS

Abstract

Female sexual behavior as an innate behavior is of prominent biological importance for survival and reproduction. However, molecular and circuit mechanisms underlying female sexual behavior is not well understood. Here, we identify the Cholecystokinin-like peptide Drosulfakinin (DSK) to promote female sexual behavior in Drosophila. Loss of DSK function reduces female receptivity while overexpressing DSK enhances female receptivity. We identify two pairs of Dsk-expressing neurons in the central brain to promote female receptivity. We find that the DSK peptide acts through one of its receptors, CCKLR-17D3, to modulate female receptivity. Manipulation of CCKLR-17D3 and its expressing neurons alters female receptivity. We further reveal that the two pairs of Dsk-expressing neurons receive input signal from pC1 neurons that integrate sex-related cues and mating status. These results demonstrate how a neuropeptide pathway interacts with a central neural node in the female sex circuitry to modulate sexual receptivity.

Editor's evaluation

The manuscript by Wang and colleagues expands our understanding of the neural circuit mechanisms underpinning innate sexual behaviors in Drosophila. It exploits an arsenal of sophisticated tools to demonstrate that the neuropeptide Drosulfakinin (DSK) modulates female sexual receptivity via pC1-DSK-MP1-CCKLR-17D3 receptor expressing neurons. The study also introduces new transgenic tools that will be valuable for the community and will be of interest to neuroscientists exploring neuropeptide function and female sexual behavior.

https://doi.org/10.7554/eLife.76025.sa0

Introduction

Upon encountering a suitable courtship object, Drosophila males display a series of stereotypic courtship rituals, such as following the target, tapping, producing courtship song by extending a wing and vibrating it, licking, and attempting copulation (Yamamoto and Koganezawa, 2013). Yet, it is the female who decides whether to accept or reject the male based on her assessment of male courtship quality and her own readiness to mate (Dickson, 2008). Once the female is willing to accept a courting male, she would slow down and open her vaginal plate to allow copulation (Ferveur, 2010; Greenspan and Ferveur, 2000; Hall, 1994). Conversely, the female rejects the male by extruding her ovipositor or flying away (Cook and Connolly, 1973; Dickson, 2008). Males and females play different roles in the sex life and take on different contribution in reproductive success. It is essential to understand and identify genetic and neural circuits that modulate innate sexual behavior. For male courtship, a number of genes controlling male courtship have been identified (Billeter et al., 2002; Emmons and Lipton, 2003) and corresponding neural circuits have been dissected (Broughton et al., 2004; Clowney et al., 2015; Demir and Dickson, 2005; Kimura et al., 2008; Kohatsu et al., 2011; Pan and Baker, 2014; Ryner et al., 1996; Stockinger et al., 2005; Tanaka et al., 2017; Yamamoto and Koganezawa, 2013; Yu et al., 2010), whereas molecular and circuit mechanisms underlying female sexual behavior are less clear.

In recent years, genetic studies have shown that several genes play critical roles in regulating female sexual behavior. For example, mutant females of icebox and chaste show lower mating success rates while mutant females of pain show higher mating success rates than wild-type females (Carhan et al., 2005; Juni and Yamamoto, 2009; Kerr et al., 1997; Sakai et al., 2009), and mutant females of spinster show enhanced rejection behavior (Suzuki et al., 1997). Moreover, specific subsets of neurons in the brain and ventral nerve cord are found to be involved in female sexual behavior. A significant decline of female sexual receptivity is observed when silencing specific neuron clusters in the central brain, such as two subsets of doublesex-expressing neurons (pCd and pC1) and two interneuron clusters (Spin-A and Spin-D) (Sakurai et al., 2013; Zhou et al., 2014). Female-specific vpoDNs in the brain integrate mating status and courtship song to control vaginal plate opening and female receptivity (Wang et al., 2021). Silencing either Abd-B neurons or SAG neurons located in the abdominal ganglion reduces female sexual receptivity (Bussell et al., 2014; Feng et al., 2014). In addition, female sexual behavior is also modulated by monoamines. In particular, dopamine not only plays a key role in regulating female sexual receptivity (Neckameyer, 1998), but also controls behavioral switching from rejection to acceptance in virgin females (Ishimoto and Kamikouchi, 2020); and octopamine is pivotal to female sexual behavior (Rezával et al., 2014). Neuropeptides including SIFamide and Mip are involved in female sexual receptivity (Jang et al., 2017; Terhzaz et al., 2007). Nevertheless, we know very little on how neuropeptides and peptidergic neurons control female sexual receptivity.

Drosulfakinin (DSK) is a neuropeptide, which is ortholog of Cholecystokinin (CCK) in mammals, and its two receptors (CCKLR-17D1 and CCKLR-17D3) have been identified in Drosophila (Chen and Ganetzky, 2012; Kubiak et al., 2002; Nichols et al., 1988; Staljanssens et al., 2011). Previous studies have revealed that DSK peptide is involved in multifarious regulatory functions including satiety/food ingestion (Nässel and Williams, 2014; Söderberg et al., 2012; Williams et al., 2014b), male courtship (Wu et al., 2019), and aggression (Agrawal et al., 2020; Williams et al., 2014a; Wu et al., 2020). However, whether DSK peptide and DSK neurons are crucial for female sexual behavior is not clear.

In this study, we find that DSK mutant females show reduced receptivity, and overexpression of DSK enhances female receptivity. We further show that DSK is crucial in two pairs of DSK neurons that function downstream of core sex-promoting neurons and upstream of CCKLR-17D3 neurons to modulate female sexual behavior. Our results reveal how the neuropeptide DSK functions in a subset of DSK neurons to interact with neural nodes in the sex circuity and acts through its receptor CCKLR-17D3 to control female sexual behavior.

Results

Neuropeptide DSK is crucial for virgin female receptivity

We previously found that neuropeptide DSK regulates intermale aggression in flies (Wu et al., 2020). To investigate the potential function of DSK in modulating female behaviors, we first monitored the change of virgin female receptivity in Dsk mutant (∆Dsk), which was generated previously (Wu et al., 2020). In brief, the 5’-UTR and coding region were deleted by the CRISPR-Cas9 system (Figure 1A), which was validated by PCR (Figure 1B and C). No anti-DSK signal was detected in ∆Dsk female brains, whereas four pairs of neurons were detected in wide-type and ∆Dsk/+ female brains by immunostaining with anti-DSK antibody (Figure 1D), which does not label the full set of DSK neurons as previously found (Nichols and Lim, 1996). Courtship chamber was used to examine mating behavior (Figure 1—figure supplement 1), and two parameters including copulation rate and latency were used to characterize female receptivity (Ferveur, 2010). Interestingly, Dsk null mutant displayed reduced copulation rate and prolonged latency to copulation compared with wild-type (Figure 1E) and ∆Dsk/+ virgin females (Figure 1F). We asked whether the phenotype of decreased female receptivity in ∆Dsk flies is due to elevated rejection behaviors such as ovipositor extrusion, and found that ∆Dsk virgin females displayed similarly low levels of ovipositor extrusion like wild-type and ∆Dsk/+ virgin females (Figure 1—figure supplement 2).

Figure 1 with 7 supplements see all
Download asset Open asset
Drosulfakinin (Dsk) gene is important for female receptivity.

(A) Organization of Dsk gene and generation of ΔDsk. (B–C) Validation of ΔDsk. PCR analysis at the deletion locus on genomic DNA samples of ΔDsk/ΔDsk, +/ΔDsk, +/+. (B) RT-PCR analysis from cDNA samples of ΔDsk/ΔDsk, +/ΔDsk, +/+ (C). (D) Brain of indicated genotype, immunostained with anti-DSK antibody (green) and counterstained with nc82 (magenta). Arrows show cell bodies (green) stained with anti-DSK antibody. Scale bars, 50 μm. (E–F) Receptivity of virgin females within 30 min. Dsk mutant females reduced copulation rate and prolonged the latency to copulation compared with wild-type (E) and heterozygous females (F). (G) Schematic of experimental design. (H) Conditional overexpression of Dsk under the control of elav-GeneSwitch (elav-GS) significantly increased copulation rate and shortened the latency to copulation after feeding RU486 compared without feeding RU486. (I) Overexpression of Dsk in DSK neurons significantly increased copulation rate and shortened the latency to copulation compared with genetic controls. (J) Decreased female sexual behavior phenotypes of ΔDsk/ΔDsk were rescued by elavGAL4 driving UAS-Dsk. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Mann-Whitney U test is applied in (E, F, and H), Kruskal-Wallis and post hoc Mann-Whitney U tests are applied in (I–J). Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001.

Figure 1—source data 1

Source data for Figure 1B–C, D–E and H–J.

https://cdn.elifesciences.org/articles/76025/elife-76025-fig1-data1-v1.xlsx

To further confirm the decreased receptivity phenotype in ∆Dsk females, we knocked down the expression of Dsk using RNA interference (RNAi) under the control of a pan-neuronal elavGAL4 driver, which significantly decreased DSK immunoreactivity (Figure 1—figure supplement 3A, B). We found that knocking down Dsk expression pan-neuronally significantly reduced female receptivity (Figure 1—figure supplement 3C). Furthermore, we also observed reduced female receptivity in females with Dsk knockdown using a knock-in DskGAL4 generated previously (Wu et al., 2020; Figure 1—figure supplement 3D-F). This DskGAL4 only labeled four pairs of neurons in the brain and no expression in the glia or gut (Figure 1—figure supplement 3D-E). It should be mentioned that this DskGAL4 did not label insulin-producing cells (IPCs) in the PI region as previously found (Nichols and Lim, 1996). Thus, to investigate whether DSK peptide released from IPCs is involved in female sexual behavior, we knocked down the expression of Dsk only in these IPCs by using Dilp2-GAL4 and found that restricting the expression of DskRNAi in IPCs did not affect virgin female receptivity (Figure 1—figure supplement 3G). No significant change of locomotor activity was detected in females with Dsk mutant or knockdown (Figure 1—figure supplement 4).

To investigate whether reduced copulation rate in ∆Dsk females is due to potential abatement of female sexual appeal, we examined courtship levels in wild-type males paired with ∆Dsk or control females and observed similarly high levels of courtship in all cases (Figure 1—figure supplement 5). Thus, the decreased receptivity in ∆Dsk females is not due to any change in male courtship efficiency, but rather a decline of willingness for copulation in these females.

As recently mated females may reduce receptivity and increase egg laying, we asked whether the decreased receptivity could be a post-mating response and correlate with elevated egg laying. To address this, we examined the number of eggs laid by virgin females with Dsk mutant or knockdown, and found that manipulation of Dsk did not enhance egg laying in these virgin females (Figure 1—figure supplement 6A). To investigate whether DSK neurons respond to mating status, we measured the activity of these neurons using the transcriptional reporter of intracellular Ca2+ (TRIC) in virgin and mated females. TRIC is designed to quantitatively monitor the change of neural activity by the reconstitution of a functional transcription factor in the presence of Ca2+ (Gao et al., 2015). As mentioned above, four pairs of neurons were labeled by DskGAL4 driving the expression of UAS-mCD8::GFP (Figure 1—figure supplement 3D). However, we only observed TRIC signals in the two pairs of neurons in the middle area of female brains (Figure 1—figure supplement 6B,C). Quantification of these TRIC signals showed no significant difference in virgin and mated females (Figure 1—figure supplement 6D). These results further indicate that DSK neurons do not respond to mating status.

We next asked whether overexpression of Dsk would enhance virgin female receptivity. Conditional overexpression of Dsk under the control of elav-GeneSwitch (elav-GS), a RU486-dependent pan-neuronal driver (Osterwalder et al., 2001), induced copulation more quickly than control females without RU486 feeding (Figure 1G and H, Figure 1—figure supplement 7). In addition, overexpression of Dsk in DSK neurons using DskGAL4 also increased copulation rate and shortened latency to copulation compared with genetic control females (Figure 1I). Furthermore, we carried out genetic rescue experiments to further confirm the function of Dsk in modulating female sexual receptivity. To address this question, we used the pan-neuronal driver elavGAL4 to drive UAS-Dsk expression in Dsk mutant background, and found that neuron-specific expression of Dsk could restore the decreased receptivity in ∆Dsk virgin females (Figure 1J). Taken together, these results indicate that the function of Dsk is crucial for female sexual receptivity, which also suggest that DSK neurons play a role in female sexual receptivity.

DSK neurons promote virgin female receptivity

To further study how Dsk-expressing neurons regulate female sexual behavior, we first activated DSK neurons with DskGAL4 expressing the heat-activated Drosophila transient receptor potential channel (dTrpA1) (Hamada et al., 2008). Activation of DSK neurons increased virgin female receptivity at 29°C relative to 21°C (Figure 2A), whereas female receptivity was not changed between 29°C and 21°C in controls with either UAS-dTrpA1 alone or DskGAL4 alone (Figure 2B and C). Meanwhile, we further analyzed whether activating DSK neurons would affect ovipositor extrusion in females with courting males and found that manipulation of DSK neurons did not affect ovipositor extrusion (Figure 2—figure supplement 1). We next tried to silence DSK neurons by using DskGAL4 to express tetanus toxin light chain (TNT), which blocks synaptic vesicle exocytosis (Sweeney et al., 1995), and found a significant reduction of receptivity in virgin females (Figure 2D). To test whether alteration of receptivity in females with DSK neurons activated or silenced is due to potential changes in general locomotion, we tested locomotor activity in individual females and found that the activating or silencing DSK neurons did not significantly affect locomotion (Figure 2—figure supplement 2A,B). Note that temperature shift did not affect female sexual behavior, although higher temperature induced higher locomotion velocity (Soto-Padilla et al., 2018). We further expressed an inwardly rectifier potassium channel (Kir2.1) that hyperpolarizes neurons and suppresses neural activity (Baines et al., 2001; Thum et al., 2006) in DSK neurons, and observed a decrease of virgin female receptivity (Figure 2—figure supplement 3).

Figure 2 with 3 supplements see all
Download asset Open asset
Drosulfakinin (DSK) neurons promote female receptivity.

(A) Activation of DSK neurons significantly increased copulation rate and shortened the latency to copulation at 29°C relative to 21°C. DskGAL4 driving UAS-dTrpA1 activated DSK neurons at 29°C. (B–C) The controls with either UAS-dTrpA1 alone or DskGAL4 alone did not alter the copulation rate and the latency to copulation at 29°C relative to 21°C. (D) Inactivation of DSK neurons significantly decreased copulation rate and prolonged the latency to copulation compared with controls. DskGAL4 driving UAS-TNT inactivated DSK neurons. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Mann-Whitney U test is applied in (A–C), Kruskal-Wallis and post hoc Mann-Whitney U tests are applied in (D). Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001, NS indicates no significant difference.

Figure 2—source data 1

Source for Figure 2.

https://cdn.elifesciences.org/articles/76025/elife-76025-fig2-data1-v1.xlsx

Female receptivity depends on the female’s sexual maturity and mating status. Very young virgins display low receptivity level to courting males and mated females become temporarily unreceptive to courting males (Dickson, 2008; Rezával et al., 2012). We tested whether activation of DSK neurons could also promote female sexual receptivity in very young virgins or mated females, and found that activation of DSK neurons did not alter female receptivity in either young virgins or mated females (Supplementary file 1). Together these results indicate that DSK neurons promote sexual behavior in virgin females.

Two pairs of DSK-MP1 neurons promote virgin female receptivity

Analyses of the expression pattern of DskGAL4 revealed that four pairs of neurons were specifically labeled in the brain, which were classified into two types (two pairs of MP1 and two pairs of MP3) based on the location of cell bodies (Nichols and Lim, 1996; Figure 1—figure supplement 3D), and the two pairs of MP1 neurons were further classified into MP1a and MP1b based on the single-cell morphology of these neurons (Wu et al., 2019). However, the functional difference between MP1 and MP3 neurons was not characterized in female files due to the lack of genetic access.

To investigate whether one or both of the types are involved in regulating female sexual behavior, we used intersectional strategy to subdivide DSK neurons and manipulate DSK-MP1 and DSK-MP3 neurons separately. We screened ~100 knock-in GAL4 lines from the Drosophila chemoconnectome (CCT) project (Deng et al., 2019) combined with DskFlp to drive UAS > stop > myr::GFP (a Gal4/Flp-responsive membrane GFP reporter) expression, and further confirmed the identity of these neurons using the anti-DSK antibody. Interestingly, we found that intersection of GluRIAGAL4, which targets glutamate receptor IA (GluRIA) cells, with DskFlp specifically labeled DSK-MP1 neurons (Figure 3A, Figure 3—figure supplement 1A), while intersection of TβHGAL4, which targets octopaminergic neurons, with DskFlp specifically labeled DSK-MP3 neurons (Figure 3B, Figure 3—figure supplement 1B). Next, we investigated the behavioral relevance of specific subtypes of DSK neurons. Activation of DSK-MP1 neurons significantly increased virgin female receptivity (Figure 3C, Figure 3—figure supplement 2A-C), while inactivation of DSK-MP1 neurons significantly reduced virgin female receptivity (Figure 3D). In contrast, neither activation nor inactivation of DSK-MP3 neurons altered virgin female receptivity (Figure 3E and F, Figure 3—figure supplement 2C-E). Taken together, these results indicate that DSK-MP1 neurons, rather than DSK-MP3 neurons, play an essential role in regulating female sexual behavior.

Figure 3 with 2 supplements see all
Download asset Open asset
DSK-MP1 neurons play a critical role in female receptivity.

(A) Intersectional expression of Drosulfakinin (Dsk) neurons and glutamate receptor IA (GluRIA) neurons were detected by immunostaining with anti-GFP (green) and anti-DSK (magenta) antibodies in female brain and were counterstained with anti-nc82 (blue). Magnification of white boxed region in (A) is shown in (A2–A7). Genotype: UAS > stop > myr::GFP/+;GluRIAGAL4/DskFlp. (B) Intersectional expression of Dsk neurons and TβH neurons were detected by immunostaining with anti-GFP (green) and anti-DSK (magenta) antibodies in female brain and were counterstained with anti-nc82 (blue). Magnification of white boxed region in (B) is shown in (B2–B7). Genotype: UAS > stop > myr::GFP/+;TβHGAL4/DskFlp. Scale bars are 50 μm in (A1 and B1), 5 μm in (A2–A7) and (B2–B7). (C) Activation of co-expression neurons of Dsk and GluRIA significantly increased copulation rate and shortened the latency to copulation at 29°C relative to 21°C. Genotype: UAS > stop > dTrpAmyrc/+;GluRIAGAL4/DskFlp. (D) Inactivation of co-expression neurons of Dsk and GluRIA significantly decreased the copulation rate and prolonged the latency to copulation compared with controls. Genotype: UAS > stop > kireGFP/+;GluRIAGAL4/DskFlp, +/+;GluRIAGAL4/DskFlp, UAS > stop > kireGFP/+;GluRIAGAL4/+, UAS > stop > kireGFP/+;+/DskFlp. (E) Activation of co-expression neurons of Dsk and TβH did not alter the copulation rate and copulation latency at 29°C relative to 21°C. Genotype: UAS > stop > dTrpAmyrc/+;TβHGAL4/DskFlp. (F) Inactivation of co-expression neurons of Dsk and TβH did not alter the copulation rate and copulation latency compared with controls. Genotype: UAS > stop > kireGFP/+;TβHGAL4/DskFlp, UAS > stop > kireGFP/+;+/DskFlp, UAS > stop > kireGFP/+;TβHGAL4/+, +/+;TβHGAL4/DskFlp. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Mann-Whitney U test is applied in (C and E), Kruskal-Wallis and post hoc Mann-Whitney U tests are applied in (D and F). Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001, NS indicates no significant difference.

Figure 3—source data 1

Source for Figure 3.

https://cdn.elifesciences.org/articles/76025/elife-76025-fig3-data1-v1.xlsx

DSK regulates female receptivity via its receptor CCKLR-17D3

Next, we asked how DSK regulates female receptivity through its receptors. Two DSK receptors were previously identified: CCKLR-17D1 and CCKLR-17D3 (Chen and Ganetzky, 2012; Kubiak et al., 2002), and it would be essential to distinguish which receptor is or both of receptors are critical for modulating female sexual behavior. We first examined virgin female receptivity in either CCKLR-17D1 mutant female, which was generated previously (Wu et al., 2020), or CCKLR-17D1 RNAi knockdown female, and did not observe any effect on female receptivity (Figure 4—figure supplement 1). We then examined virgin female receptivity in CCKLR-17D3 mutant female, which was also generated previously (Wu et al., 2020). In brief, the last four exons were deleted by the CRISPR-Cas9 system (Figure 4A), which was validated by PCR (Figure 4B and C). Interestingly, mutation of CCKLR-17D3 reduced mating success rate in virgin females compared with wide-type and heterozygous control females (Figure 4D). Moreover, RNAi knockdown of CCKLR-17D3 under the control of the pan-neuronal elavGAL4 driver or CCKLR-17D3GAL4 also significantly reduced female receptivity (Figure 4—figure supplement 2A,B). Conditional knockdown of CCKLR-17D3 using the elav-GS system to avert the potential developmental effect also significantly decreased female receptivity (Figure 4—figure supplement 2C-E). In addition, no significant change of locomotor activity was detected in CCKLR-17D3 mutant or knockdown females (Figure 4—figure supplement 3). Furthermore, the reduced female receptivity of CCKLR-17D3 mutant females could be rescued by expression of UAS-CCKLR-17D3 driven by elav-GS (Figure 4E–G). These results demonstrate that DSK acts through CCKLR-17D3 but not CCKLR-17D1 to promote female sexual receptivity.

Figure 4 with 4 supplements see all
Download asset Open asset
Drosulfakinin (Dsk) regulates female receptivity via CCKLR-17D3 receptor.

(A) Organization of CCKLR-17D3 and generation of Δ17D3. (B–C) Validation of Δ17D3. PCR analysis from genomic DNA samples of Δ17D3/Δ17D3, +/Δ17D3, +/+ (B). RT-PCR analysis from cDNA samples of Δ17D3/Δ17D3, +/Δ17D3, +/+ (C). (D) CCKLR-17D3 mutant females significantly decreased copulation rate and prolonged the latency to copulation compared with wild-type and heterozygous. (E) Conditional expression of UAS-CCKLR-17D3 in the Δ17D3 mutant background after feeding RU486 significantly increased copulation rate and shortened the latency to copulation compared without feeding RU486. (F–G) The controls with either UAS-CCKLR-17D3 alone or elav-GeneSwitch (elav-GS) alone did not rescue the phenotypes of Δ17D3/Δ17D3 at feeding RU486 relative to without feeding RU486. (H) Activating CCKLR-17D3 neurons significantly increased copulation rate and shortened the latency to copulation at 29°C relative to 21°C. CCKLR-17D3GAL4 driving UAS-dTrpA1 activated CCKLR-17D3 neurons at 29°C. (I) The control with CCKLR-17D3GAL4 alone did not alter the copulation rate and the latency to copulation at 29°C relative to 21°C. (J) Inactivation of CCKLR-17D3 neurons significantly decreased copulation rate and prolonged the latency to copulation compared with controls. DskGAL4 driving UAS-TNT inactivated DSK neurons. (K) The copulation rate and the latency to copulation have no difference at 29°C relative to 21°C in the case of activating DSK neurons in the Δ17D3 mutant background. (L) The positive control significantly increased copulation rate and shortened the latency to copulation at 29°C relative to 21°C. (M) The negative control did not alter the copulation rate and the latency to copulation by heating. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal-Wallis and post hoc Mann-Whitney U tests are applied in (D and J), Mann-Whitney U test is applied in (E–I and K–M). Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001, NS indicates no significant difference.

Figure 4—source data 1

Source data for Figure 4.

https://cdn.elifesciences.org/articles/76025/elife-76025-fig4-data1-v1.xlsx

To further determine whether CCKLR-17D3 neurons are functionally important for female sexual receptivity, we manipulated neurons labeled by the CCKLR-17D3GAL4, which was generated previously (Wu et al., 2020). The CCKLR-17D3GAL4 labeled neuronal clusters in the central complex, SOG, and ventral nerve cord (Figure 4—figure supplement 4A). We activated CCKLR-17D3GAL4 neurons using dTrpA1 and observed significantly increased mating success rate in virgin females at 29°C than 21°C (Figure 4H), whereas female receptivity was not changed between 29°C and 21°C in control females (Figure 4I). Moreover, we also inactivated CCKLR-17D3GAL4 neurons by expressing TNT and found that female receptivity was decreased after inactivating these neurons (Figure 4J). Thus, CCKLR-17D3GAL4 neurons positively regulate virgin female receptivity.

It has been well established that doublesex (dsx) expressing neurons play a key role in regulating female sexual behavior (Feng et al., 2014; Rideout et al., 2010; Wang et al., 2021; Zhou et al., 2014). Thus, we asked whether CCKLR-17D3GAL4 drives expression in dsx neurons to regulate female receptivity. However, intersection between CCKLR-17D3GAL4 and dsxLexA only labeled projections from peripheral sensory neurons that innervate the SOG region (Figure 4—figure supplement 4B). Furthermore, either overexpressing or knocking down CCKLR-17D3 in all dsx neurons did not alter virgin female receptivity (Figure 4—figure supplement 4C,D). These results indicate that CCKLR-17D3 did not function in dsx neurons to regulate female sexual behavior.

To further confirm whether CCKLR-17D3 is the downstream target of DSK on female receptivity, we tested receptivity in females with DSK neurons activated by dTrpA1 under the CCKLR-17D3 mutant background. We found that loss of CCKLR-17D3 function could block the increased levels of female receptivity caused by activating DSK neurons (Figure 4K–M). Together these results demonstrate that DSK released from DSK-MP1 neurons acts on its receptor CCKLR-17D3 to promote female sexual receptivity.

DSK neurons function downstream of the sex-promoting R71G01-GAL4 neurons

In males, R71G01-GAL4 drives the expression of P1 neurons that interact with DSK neurons to regulate male courtship (Wu et al., 2019) and aggression (Wu et al., 2020). Previous studies employed the intersection of R71G01-LexA with dsxGAL4 to specifically label and manipulate pC1 neurons, which integrate male courtship and pheromone cues to promote virgin female receptivity (Wang et al., 2020; Zhou et al., 2014). We found that activation of R71G01-GAL4 neurons consisting of pC1 and a few other neurons promoted female receptivity (Figure 5—figure supplement 1), similarly as previously activating pC1 neurons using the intersectional strategy (Zhou et al., 2014). Thus, we asked whether DSK neurons would interact with R71G01-GAL4 neurons to control female sexual behavior. To address this question, we first sought to detect whether Dsk-expressing neurons had potential synaptic connection with R71G01-GAL4 neurons via GFP reconstitution across synaptic partners (GRASP) (Feinberg et al., 2008; Gordon and Scott, 2009). Interestingly, we detected significant reconstituted GFP signals between R71G01-LexA and DskGAL4 labeled neurons (Figure 5—figure supplement 2), suggesting that these neurons might have synaptic connection. Next, we surveyed whether Dsk-expressing neurons are immediate downstream of R71G01-GAL4 neurons by using trans-Tango, a method of anterograde transsynaptic tracing (Talay et al., 2017). Interestingly, R71G01-GAL4 downstream trans-Tango signals were observed in DSK neurons by co-staining the trans-Tango flies with the anti-DSK antibody (Figure 5A and B, Figure 5—figure supplement 3). Moreover, we registrated R71G01-GAL4 neurons and DSK neurons, and found that axons of R71G01-GAL4 neurons partly overlapped with dendrites of DSK neurons (Figure 5C).

Figure 5 with 4 supplements see all
Download asset Open asset
Drosulfakinin (DSK) neurons are functional targets of R71G01-GAL4 neurons in regulating mating behavior.

(A–B) Transsynaptic circuit analysis using trans-Tango confirms that Dsk-expressing neurons are postsynaptic neurons of R71G01-GAL4 neurons. In the central brain, expression of the Tango ligand in R71G01-GAL4 neurons (green) (A) induced postsynaptic mtdTomato signals (anti-HA, red) (B). Cell bodies of Dsk were stained with anti-DSK (blue) (B). Magnification of white boxed region in (B) is shown in (B1–B3) and (B4–B6). Scale bars are 50 μm in (A–B), 5 μm in (B1–B3) and (B4–B6). (C) Axons of R71G01-GAL4 neurons overlapped with dendrites of DSK neurons by anatomical registration. Magnification of white boxed region in (C) is shown in (C1–C3) and (C4–C6). Yellow arrowheads indicated the region of overlaps between R71G01-GAL4 neurons axons with DSK neurons dendrites. R71G01-GAL4-driven UAS-sytGFP expression (green), DskGAL4-driven UAS-Denmark expression (red). Scale bars are 50 μm in (C), 5 μm in (C1–C3) and (C4–C6). (D) The copulation rate and the latency to copulation had no difference at 29°C relative to 21°C in the case of activation of R71G01-GAL4 neurons in the ΔDsk mutant background. (E) The positive control significantly increased copulation rate and shortened the latency to copulation at 29°C relative to 21°C. (F–G) The negative controls did not alter the copulation rate and the latency to copulation by heating. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Mann-Whitney U test is applied. Error bars indicate SEM. ***p < 0.001, NS indicates no significant difference.

Figure 5—source data 1

Source data for Figure 5.

https://cdn.elifesciences.org/articles/76025/elife-76025-fig5-data1-v1.xlsx

In addition, we performed behavioral epistasis experiment to confirm functional interactions between DSK neurons and R71G01-GAL4 neurons. We activated R71G01-GAL4 neurons by dTrpA1 in the Dsk mutant background, and found that increased levels of female receptivity caused by activation of R71G01-GAL4 neurons were suppressed by the mutation in Dsk (Figure 5D–G). Taken together, these results further demonstrate that DSK neurons are the functional targets of R71G01-GAL4 neurons in controlling female sexual behavior.

As the R71G01-GAL4 labels pC1 neurons as well as a few other neurons, we further utilized the recently generated pC1 splitGAL4 drivers (Wang et al., 2020). We registrated pC1 neurons labeled by two independent pC1 splitGAL4 (pC1-ss1 and pC1-ss2) with DSK neurons, and found that axons of pC1 neurons overlapped with dendrites of DSK neurons (Figure 5—figure supplement 4). Furthermore, we utilized the recently generated full adult female brain (FAFB) electron microscopic (EM) image set (Scheffer et al., 2020), and found that pC1 neurons have intense synaptic input on DSK-MP1 neurons, especially the single pair of DSK-MP1b neurons, and few input on DSK-MP3 neurons (Supplementary file 2). These results indicate that DSK neurons are direct targets of R71G01-GAL4 labeled pC1 neurons.

Functional connectivity between pC1 neurons and DSK neurons

The above results showed that DSK neurons act downstream of R71G01-GAL4 labeled pC1 neurons to promote female sexual receptivity. To further reveal the functional connectivity between pC1 neurons and Dsk-expressing neurons, we activated all R71G01-GAL4 neurons through ATP activation of ATP-gated P2X2 channel (Brake et al., 1994; Yao et al., 2012) and recorded the electrical responses in DSK-MP1 neurons and DSK-MP3 neurons using patch clamp (Figure 6A). In perforate patch recordings, ATP/P2X2 activation of R71G01-GAL4 neurons induced strong electrical responses from DSK-MP1 neurons and relatively weaker responses from DSK-MP3 neurons in female brains (Figure 6B and C). Thus, these results together with the above EM data unambiguously demonstrate that Dsk-expressing DSK-MP1 neurons receive input from sex-promoting pC1 neurons.

Figure 6
Download asset Open asset
Functional connectivity between R71G01-GAL4 neurons and Drosulfakinin (DSK) neurons.

(A) Left: ATP stimulation and recording arrangement. The chemical stimulation is implemented using a three-barrel tube (with the tip positioned ~50 μm away from the brain), controlled by a stepper for rapid solution change. Right: schematic illustrating the activation of R71G01-GAL4 neurons by ATP and patch-camp recording of DSK neurons. R71G01-GAL4 neurons were activated by ATP in +/+;R71G01-LexA/+;DskGAL4/LexAop-P2X2,UAS-GCaMP6m files. (B–C) The electrical responses of medial DSK neurons (DSK-MP1) and lateral DSK neurons (DSK-MP3) to the ATP activation of 2X2-expressing R71G01-GAL4 neurons. ATP: 2.5 mM. Left: ATP-induced spiking firing (current clamp). Middle: current responses (voltage clamp). Right: quantification of absolute current responses. n = 6 for DSK-MP1, DSK-MP1 control, DSK-MP3, DSK-MP3 control. Genotype: +/+;+/+;DskGAL4/LexAop-P2X2,UAS-GCaMP6m for DSK-MP1 control and DSK-MP3 control. **p < 0.01 (Mann-Whitney U tests).

Figure 6—source data 1

Source for Figure 6.

https://cdn.elifesciences.org/articles/76025/elife-76025-fig6-data1-v1.xlsx

Discussion

In this study, we systematically investigated DSK-mediated neuromodulation of female sexual receptivity. At the molecular level, we revealed that DSK neuropeptide and its receptor CCKLR-17D3 are crucial for modulating female sexual receptivity. At the neuronal circuit level, we identified that DSK neurons are the immediate downstream targets of sex-promoting pC1 neurons in controlling female sexual receptivity. Moreover, we employed intersectional tools to subdivide DSK neurons into medial DSK neurons (DSK-MP1) and lateral DSK neurons (DSK-MP3) and uncovered that DSK-MP1 neurons rather than DSK-MP3 neurons play essential roles in modulating female receptivity. Collectively, our findings illuminate a pC1-DSK-MP1-CCKLR-17D3 pathway that modulates female sexual behaviors in Drosophila.

The female sexual behavior is a complex innate behavior. The decision for the female to accept a courting male or not depends on not only sensory stimulation but also internal states. If the female is willing to mate, she slows down, pauses, and opens her vaginal plates to accept a courting male (Bussell et al., 2014; Laturney and Billeter, 2014; Wang et al., 2021), if not, she extrudes her ovipositor to deter a courting male or flies away (Cook and Connolly, 1973). Our results show that DSK signaling is crucial for virgin female receptivity but has no effect on ovipositor extrusion behavior. How exactly does the DSK signaling regulate virgin female receptivity is still not clear. One possibility is that DSK signaling regulates pausing behavior in response to male courtship (Bussell et al., 2014), as DSK receptor CCKLR-17D3 expresses in the central complex that has been found to be crucial for locomotor behaviors (Strauss, 2002). However, we did not observe any change in locomotor activity in DSK or CCKLR-17D3 mutant females. Note that we only assayed locomotor behavior in single females but not in females paired with courting males due to technical limit for analysis, and it is possible that the DSK signaling does not affect general locomotor behavior but regulates courtship-stimulated pausing behavior.

The four pairs of DSK neurons are classified into two types (DSK-MP1 and DSK-MP3) based on the location of the cell bodies, and DSK-MP1 neurons extend descending fibers to ventral nerve cord (Wu et al., 2020). In this study, we also found that activating DSK-MP1 neurons enhance female receptivity whereas inactivating DSK-MP1 neurons reduce female receptivity. Silencing adult Abd-B neurons and SAG neurons located in the abdominal ganglion inhibits female sexual receptivity (Bussell et al., 2014; Feng et al., 2014). It has been found that Abd-B neurons control female pausing behavior, and it would be interesting to further investigate whether DSK-MP1 neurons relay information from Abd-B neurons to regulate pausing and receptivity in females. We also note that DSK-MP1 neurons extend projections to suboesophageal ganglion (SOG), and the SOG is the terminus of ascending projections from a subset of female reproductive tract sensory neurons labeled by pickpocket (ppk), fruitless (fru), and doublesex (dsx) (Häsemeyer et al., 2009; Rezával et al., 2012; Yang et al., 2009). It is also possible that DSK-MP1 neurons may integrate information directly from these sensory neurons to regulate female receptivity. Another study further classified the DSK-MP1 neurons into two types (MP1a and MP1b) based on the morphology of their neuritis (Wu et al., 2019). Future studies would further build genetic tools to uncover the function of each subset of DSK neurons in regulating distinct innate behaviors, such as male courtship (Wu et al., 2019), aggression (Agrawal et al., 2020; Wu et al., 2020), and female sexual behavior.

Previous studies have revealed that pC1 neurons extend projections to lateral protocerebral complex (LPC) and this neural cluster responds to courtship song and cVA (Zhou et al., 2015; Zhou et al., 2014). Moreover, recent works have shown that DSK-MP1 neurons project to the region of LPC (Wu et al., 2020; Wu et al., 2019). We used GRASP, trans-Tango, and patch-clamp techniques and revealed that DSK-MP1 neurons are direct downstream target of R71G01-GAL4 neurons that include pC1. EM reconstruction revealed that pC1 neurons have intense synaptic input on MP1b but not MP1a neurons, suggesting a crucial role of the single pair of MP1b neurons in female receptivity. Based on these findings, we propose that: (1) pC1 neurons act as a central node for female sexual receptivity by integrating sex-related sensory cues (courtship song and cVA) and mating status; and (2) DSK-MP1 neurons may integrate internal states (Wu et al., 2019) and pC1-encoded information to modulate female sexual behavior. Thus, it is of prime importance to further investigate how a neuropeptide pathway modulate a core neural node in the sex circuitry to fine-tune the female’s willingness for sexual behavior in the future.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
AntibodyMouse anti- a-bruchpilot monoclonal (nc82)Developmental Studies Hybridoma BankCat# nc82, RRID:AB_2314866IHC (1:50)
AntibodyRat monoclonal anti-HARocheCat# 11867431001, RRID:AB_390919IHC (1:100)
AntibodyMouse monoclonal anti-GFP-20Sigma-AldrichCat# G6539, RRID:AB_259941IHC (1:100)
AntibodyChicken polyclonal anti-GFPThermo Fisher ScientificCat# A10262, RRID:AB_2534023IHC (1:1000)
AntibodyGoat anti-chicken polyclonal, Alexa Fluor 488Thermo Fisher ScientificCat# A-11039; RRID: AB_2534096IHC (1:500)
AntibodyGoat anti-rat polyclonal, Alexa Fluor 546Thermo Fisher ScientificCat# A-11081, RRID:AB_2534125IHC (1:500)
AntibodyGoat anti-rabbit polyclonal, Alexa Fluor 546Thermo Fisher ScientificCat# A-11010, RRID:AB_2534077IHC (1:500)
AntibodyGoat anti-mouse polyclonal, Alexa Fluor 633Thermo Fisher ScientificCat# A-21094, RRID:AB_2535749IHC (1:500)
AntibodyGoat anti-rabbit polyclonal, Alexa Fluor 647Thermo Fisher ScientificCat# A-21247, RRID:AB_141778IHC (1:500)
AntibodyRabbit polyclonal anti-DSK N/AIHC(1:1000)
Chemical compound, drugParaformaldehyde (PFA)Electron Microscopy SciencesCat# 157138% PFA diluted in 1× PBS at 1:4 or 1:2
Chemical compound, drugDPX MountantSigma-AldrichCat# 44581
Chemical compound, drugNormal goat serumSigma-AldrichCat# G9023
Chemical compound, drugAdenosine 5’-triphosphate disodium salt hydrate microbialSigma-AldrichCat# A6419-1G2.5 mM
Chemical compound, drugMifepristone (RU486)Sigma-AldrichCat# M8046-1G
Genetic reagent(Drosophila melanogaster)UAS-myrGFP,QUAS-mtdTomato(3*HA);trans-TangoZhong Lab, Tsinghua UniversityN/A
Genetic reagent(Drosophila melanogaster)+; sp/cyo; LexAop-P2X2, UAS-GCamP/Tm2Luo Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)UAS-mCD8::GFPBloomington Stock Center# 5137
Genetic reagent(Drosophila melanogaster)10XUAS-IVS-mCD8::RFP,13XLexAop2-mCD8::GFP; nSyb-MKII::nlsLexADBD/CyO; UAS-p65AD::CaMBloomington Stock Center# 61679
Genetic reagent(Drosophila melanogaster)TβH-GAL4Bloomington Stock Center# 45904
Genetic reagent(Drosophila melanogaster)UAS > stop > dTrpAmyrcBloomington Stock Center# 66871
Genetic reagent(Drosophila melanogaster)R71G01-GAL4Bloomington Stock Center# 39599
Genetic reagent(Drosophila melanogaster)R71G01-LexABloomington Stock Center# 54733
Genetic reagent(Drosophila melanogaster)+; UAS-syteGFP, UAS-Denmark; Sb/+Rao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)UAS > stop > Kir2.1eGFPRao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)DskFlpPan Lab, Southeast UniversityN/A
Genetic reagent(Drosophila melanogaster)elav-GSZhong Lab, Tsinghua UniversityN/A
Genetic reagent(Drosophila melanogaster)UAS-dTrpA1/cyoGarrity Lab, Brandeis UniversityN/A
Genetic reagent(Drosophila melanogaster)UAS-TNTO'Kane Lab, University of CambridgeN/A
Genetic reagent(Drosophila melanogaster)UAS-impTNTO'Kane Lab, University of CambridgeN/A
Genetic reagent(Drosophila melanogaster)UAS-Kir2.1Bloomington Stock Center#6595, #6596
Genetic reagent(Drosophila melanogaster) DskGAL4Rao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)elav-GAL4Rao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)GluRIAGAL4Rao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)CCKLR-17D3GAL4Rao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)ΔDskRao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)UAS > stop > myr::GFPGerald Rubin, Janelia Farm Research CampusN/A
Genetic reagent(Drosophila melanogaster)ΔCCKLR-17D3Rao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)ΔCCKLR-17D1Rao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)UAS-DskZhou Lab, Chinese Academy of Sciences, this paperN/A
Genetic reagent(Drosophila melanogaster)UAS-DskRNAiPan Lab, Southeast UniversityN/A
Genetic reagent(Drosophila melanogaster)elav-GAL4;UAS-dcr2Rao Lab, Peking UniversityN/A
Genetic reagent(Drosophila melanogaster)Lexo-CD4-spGFP11/CyO; UAS-CD4-spGFP1-10/TbGordon and Scott, 2009N/A
Genetic reagent(Drosophila melanogaster)pC1-ss1Kaiyu Wang’s lab, Institute of NeuroscienceN/A
Genetic reagent(Drosophila melanogaster)pC1-ss2Kaiyu Wang’s lab, Institute of NeuroscienceN/A
Genetic reagent(Drosophila melanogaster)Dilp2-GAL4Zhong Lab, Tsinghua UniversityN/A
Genetic reagent(Drosophila melanogaster)UAS-CCKLR-17D3Zhou Lab, Chinese Academy of Sciences, this paperN/A
Genetic reagent(Drosophila melanogaster)UAS-CCKLR-17D1RNAiBloomington Stock Center# 27494
Genetic reagent(Drosophila melanogaster)UAS-CCKLR-17D3RNAiBloomington Stock Center# 28333
Software, algorithmMATLABMathWorks, Natick, MAhttps://www.mathworks.com/products/matlab.html
Software, algorithmImageJNational Institutes of Healthhttps://imagej.nih.gov/ij/
Software, algorithmPrism 7GraphPadhttps://www.graphpad.com/

Fly stocks

Request a detailed protocol

Flies were reared on standard cornmeal-yeast medium under a 12 hr:12 hr dark:light cycle at 25°C and 60% humidity. Flies carrying a dTrpA1 transgene were raised at 21°C. UAS-TNTE and UAS-impTNT were kindly provided by Dr Cahir O’Kane (University of Cambridge). UAS-dTRPA1 was a gift from Dr Paul Garrity (Brandeis University). Dilp2-GAL4 line, trans-Tango line, and elav-GS line were provided by Dr Yi Zhong (Tsinghua University), DskFlp and DskRNAi lines were provided by Dr Yufeng Pan (Southeast University). UAS > stop > myr::GFP (pJFRC41 in attP5) was a gift from Gerald Rubin, UAS > stop > kireGFP was provided by Dr Yi Rao, pC1-ss1 and pC1-ss2 were provided by Dr Kaiyu Wang. The following lines were obtained from the Bloomington Drosophila Stock Center: R71G01-GAL4 (BL#39599), R71G01-LexA (BL#54733), TβH-GAL4 (BL#45904), TRIC line (BL#61679), UAS-Kir2.1 (BL#6595 and BL#6596), UAS-mCD8::GFP (BL#5137), UAS > stop > dTrpAmyrc (BL#66871). Lexo-CD4-spGFP11/CyO; UAS-CD4-spGFP1-10/Tb was previously described (Gordon and Scott, 2009).

Behavioral assays

Request a detailed protocol

Flies were reared at 25°C. Virgin females and wild-type males were collected upon eclosion, placed in groups of 12 flies each and aged 5–7 days at 25°C and 60% humidity before carrying out behavior assay except for the thermogenetic experiments.

In female sexual behavior experiment in virgin females, mating behavior assays were carried out in the courtship chamber. A virgin female of defined genotype and a wild-type male were gently cold anesthetized and respectively introduced into two layers of the round courtship chambers separated by a removable transparent film. The flies were allowed to recover for at least 1 hr before the film was removed to allow the pair of a test female and a wild-type male to contact. The mating behavior was recorded using a camera (Canon VIXIA HF R500) for 30 min at 30 fps for further analysis.

For female sexual behavior experiment in very young virgin females, we collected flies with 0–3 hr post-eclosion and measured receptivity at 12–16 hr post-eclosion using the same method as mentioned above.

For female sexual behavior experiment in mated females, we first collected virgin females upon eclosion and generated mated females by pairing females aged 5–7 days with wild-type males. Mated females were isolated for 18–24 hr and then assayed for receptivity with a new wild-type male using the same method as mentioned above.

For dTrpA1 activation experiment, flies were reared at 21°C. Flies were loaded into courtship chamber and recovered for at least 30 min, then were placed at 21°C (control group) or 29°C (experimental group) for 30 min prior to removing the film and videotaping.

For egg laying experiment, virgin females were collected upon eclosion and five flies were housed on standard medium in single vials. The flies were transferred into new food tubes every 24 hr after aged 4 days, and we counted manually the number of eggs in each food tube.

For rejection behavior, the indicated genotype of virgin female paired with male, videotaped for 10 min at higher magnification, and scored manually for ovipositor extrusions.

For locomotor behavior experiment, virgin females were collected upon eclosion and placed in groups of 12 flies each. Individual females aged 5–7 days were used to test locomotor behavior, which was analyzed via Ctrax software (Branson et al., 2009).

Immunohistochemistry

Request a detailed protocol

Whole brains of flies aged 5–7 days were dissected in 1× PBS and fixed in 2% paraformaldehyde for 55 min at room temperature. The samples were blocked in 5% normal goat serum for 1 hr at room temperature after washing the samples with PBT (1× PBS containing 0.3% Triton X-100) for four times for 15 min. Then, the samples were incubated in primary antibodies (diluted in blocking solution) for 18–24 hr at 4°C. Samples were washed four times with 0.3% PBT for 15 min, then were incubated in secondary antibodies (diluted in blocking solution) for 18–24 hr at 4°C. Samples were washed four times with 0.3% PBT for 15 min, then were fixed in 4% paraformaldehyde for 4 hr at room temperature. Finally, brains were mounted on poly-L-lysine-coated coverslip in 1× PBS. The coverslip was dipped for 5 min with ethanol of 30%→50%→70%→95%→100% sequentially at room temperature, and then dipped three times for 5 min with xylene. The brains were mounted with DPX and allowed DPX to dry for 2 days before imaging. Confocal images were obtained with Carl Zeiss (LSM710) confocal microscopes and Fiji software was used to process images. Primary antibodies used were: chicken anti-GFP (1:1000; Life Technologies), rabbit anti-DSK antibody (1:1000), mouse anti-nc82 (1:50; DSHB), rat anti-HA (1:100; Roche), mouse anti-GFP-20 (1:100; Sigma). Secondary antibodies used were: Alexa Fluor goat anti-chicken 488 (1:500; Life Technologies), Alexa Fluor goat anti-rabbit 546 (1:500; Life Technologies), Alexa Fluor goat anti-mouse 647 (1:500; Life Technologies), Alexa Fluor goat anti-rat 546 (1:500; Invitrogen) and Alexa Fluor goat anti-mouse 488 (1:500; Life Technologies).

Generation of anti-DSK antibody

Request a detailed protocol

Rabbit anti-DSK antibody was generated previously (Wu et al., 2020). In brief, the anti-DSK antibody was generated by using the synthetic peptide N’-GGDDQFDDYGHMRFG-C’ as antigen. The synthesis of antigen peptide, the production and purification of antiserum were performed by Beijing Genomics Institute (BGI).

Generation of UAS-Dsk and UAS-CCKLR-17D3

Request a detailed protocol

UAS-Dsk was generated previously (Wu et al., 2020). In brief, UAS-Dsk constructs were injected and integrated into the attP40 site on the second chromosome through phiC31-mediated gene integration. The method of generation of UAS-CCKLR-17D3 was same as described previously (Wu et al., 2020). Primer sequences for cloning the cDNA of UAS-CCKLR-17D3 are as follows:

UAS-CCKLR-17D3

  • Forward:

  • ATTCTTATCCTTTACTTCAGGCGGCCGCAAAATGTTCAACTACGAGGAGGG

  • Reverse:

  • GTTATTTTAAAAACGATTCATTCTAGATTAGAGCTGAGGACTGTTGACG

Genomic DNA extraction and RT-PCR

Request a detailed protocol

Genomic DNA was extracted from whole fly body using MightyPrep reagent for DNA (Takara). Whole head RNA was extracted from 50 fly heads using TRIzol (Ambion #15596018). cDNA was generated from total RNA using the Prime Script reagent kit (Takara).

Validation of ΔCCKLR-17D3

Request a detailed protocol

Candidates of ΔCCKLR-17D3 were characterized by the loss of DNA band in the deleted areas by PCR on the genomic DNA, as shown in Figure 4A. Primer sequences used for regions 1–4 in Figure 4B are as follows:

  • Region (1): Forward 5’- CAGTAGAGGATTCGCCTCCAAG-3’

  • Reverse 5’- GACATACAGCGAGAGTGC-3’

  • Region (2): Forward 5’- CATGAACGCCAGCTTCCG-3’

  • Reverse 5’- GCACTATTGGTGGTCACCAC-3’

  • Region (3): Forward 5’- GGAAATCATCTAACAGGCTTAC-3’

  • Reverse 5’- GCCGTGTCAAATCGCTTTC-3’

  • Region (4): Forward 5’- GCATACATACAAGCAAATTATGC-3’

  • Reverse 5’- CTCATATTCTTTTGGGCTACCAC-3’

Primer sequences used for amplifying CCKLR-17D3 or CG6891 cDNA in Figure 4C are as follows:

  • CCKLR-17D3 cDNA: Forward 5’- GCCCATAGCGGTCTTTAGTC-3’

  • Reverse 5’- GTGATGAGGATGTAGGCCAC 3

  • CG6891 cDNA: Forward 5’-GCTGTGTTCTGGATGTGGATG-3’

  • Reverse 5’- CTGGAACTGTGCTGGTTCTG-3’

Drug feeding

Request a detailed protocol

Virgin females of defined genotype were collected upon eclosion and reared on standard cornmeal-yeast medium as a group of 12 for 4 days. Then, we transferred the female flies to new standard cornmeal-yeast food tube containing 500 μM RU486 (RU486+) or control solution (RU486-) for 2 days before behavior assay. RU486 (mifepristone; Sigma) was dissolved in ethanol.

TRIC analysis

Request a detailed protocol

DskGAL4 flies were crossed with a TRIC line to detect the changes of intracellular Ca2+ levels between virgin and mated females. Brains of virgin and mated females (2 days after copulation) were dissected and fixed with 8% paraformaldehyde for 2 hr, and then mounted with DPX. All the confocal images were obtained with Carl Zeiss (LSM710) confocal microscopes with the same settings.

Fiji software was used to process images. We first generated a Z stack of the sum of fluorescence signals, and then quantified the fluorescence intensity of DSK cell bodies of virgin and mated female brain, respectively. We quantified the TRIC signal by calculating the ratio of intensities of GFP signal over the RFP signal.

Electrophysiological recordings

Request a detailed protocol

Young adult flies (1–2 days after eclosion) were anesthetized on ice and brain was dissected in saline solution. And the brain was continuously perfused with saline bubbled with 95% O2/5% CO2 (~pH 7.3) at room temperature. The saline composed of the following (in mM): 103 NaCl, 3 KCl, 4 MgCl2, 1.5 CaCl2, 26 NaHCO3, 1 NaH2PO4, 5 N-tri-(hydroxymethyl)-methyl-2-aminoethane-sulfonic acid (TES), 20 D-glucose, 17 sucrose, and 5 trehalose.

Electrophysiological recordings were performed using a Nikon microscope with a 60× water immersion objective to locate target neurons. Then, we used Nikon A1R+ confocal microscope with infrared-differential interference contrast optics to visual for patch-clamp recordings and the image was shown on monitor by IR-CCD (DAGE-MTI). The recording pipette (~10–15 MΩ) was filled with internal solution containing 150 mg/ml amphotericin B. The internal solution consists of (in mM): 140 K-gluconate, 6 NaCl, 2 MgCl2, 0.1 CaCl2, 1 EGTA, 10 HEPES (pH 7.3). Current and voltage signals were amplified with MultiClamp 700B, digitized with Digidata 1440A, recorded with Clampex 10.6 (all from Molecular Devices), filtered at 2 kHz, and sampled at 5 kHz. The recorded neuron was voltage clamped at –70 mV. Measured voltages were corrected for a liquid junction potential.

Chemogenetic stimulation

Request a detailed protocol

ATP-gated ion channel P2X2 was driven by 71G01-GAL4. ATP-Na (Sigma-Aldrich) of 2.5 mM was delivered through a three-barrel tube (with the tip positioned ~50 μm away from the brain), controlled by stepper (SF77B, Warner Instruments) driven by Axon Digidata 1440A analog voltage output, allowing for fast solution change between perfusion saline and ATP stimulation.

Brain image registration

Request a detailed protocol

A standard brain was generated using CMTK software as described previously (Rohlfing and Maurer, 2003; Zhou et al., 2014). Confocal stacks were then registered into the common standard brain with a Fiji graphical user interface as described previously (Jefferis et al., 2007).

Connectomics analysis

Request a detailed protocol

The recently generated FAFB EM image set was used to identify the synaptic connections between pC1 neurons and DSK neurons (Scheffer et al., 2020). We got the number of synaptic connections and the unique identifier (Cell ID) from the following website: https://neuprint.janelia.org.

Quantification and statistical analysis of female mating behavior

Request a detailed protocol

Two parameters including copulation rate and latency were used to characterize receptivity and we got the data sets of two parameters from same flies. The time from removing the film to copulation was measured for each female. The number of females that had engaged in copulation by the end of each 1 min interval were summed within 30 min and plotted as a percentage of total females for each time point. The time from removing the film to successful copulation for each female was used to characterize latency to copulation. And all the time points that female successfully copulated were analyzed by manual method and unhealthy flies were discarded. Three scorers with blinding to the genotypes and condition of the experiment were assigned for independent scoring.

Statistical analysis

Request a detailed protocol

Statistical analyses were carried about using R software version 3.4.3 or GraphPad software. For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal-Wallis ANOVA test followed by post hoc Mann-Whitney U test was used for comparison among multiple groups. The Mann-Whitney U test was applied for analyzing the significance of two columns.

Data availability

All data generated or analysed during this study are included in the manuscript and supporting file; source data files have been provided for all figures and figure supplements.

References

    1. Baines RA
    2. Uhler JP
    3. Thompson A
    4. Sweeney ST
    5. Bate M
    (2001)
    Altered electrical properties in Drosophila neurons developing without synaptic transmission
    The Journal of Neuroscience 21:1523–1531.
    1. Nichols R
    2. Schneuwly SA
    3. Dixon JE
    (1988)
    Identification and characterization of a Drosophila homologue to the vertebrate neuropeptide cholecystokinin
    The Journal of Biological Chemistry 263:12167–12170.
    1. Rohlfing T
    2. Maurer CR
    (2003) Nonrigid image registration in shared-memory multiprocessor environments with application to brains, breasts, and bees
    IEEE Transactions on Information Technology in Biomedicine : A Publication of the IEEE Engineering in Medicine and Biology Society 7:16–25.
    https://doi.org/10.1109/titb.2003.808506

Decision letter

  1. Sonia Sen
    Reviewing Editor; Tata Institute for Genetics and Society, India
  2. K VijayRaghavan
    Senior Editor; National Centre for Biological Sciences, Tata Institute of Fundamental Research, India
  3. Sonia Sen
    Reviewer; Tata Institute for Genetics and Society, India

Our editorial process produces two outputs: i) public reviews designed to be posted alongside the preprint for the benefit of readers; ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Drosulfakinin signaling modulates female sexual receptivity in Drosophila" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Sonia Sen as the Reviewing Editor and Reviewer #1, and the evaluation has been overseen by K VijayRaghavan as the Senior Editor.

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1. Related to the writing:

- Introduction: We would like the authors to cover the appropriate literature (and references) related to (1) Dsk, (2) courtship ritual and its relevance to mate selection, and (3) female receptivity and a description of behaviours that constitute it.

- Results: We're recommending that the authors motivate each result section with (1) a rationale for the experiments done in that section, (2) a description of the experimental set-up, and (3) elaborate on the description and interpretation of the results for that section.

2. Statistics: We're concerned about the statistics used. For example, a non-parametric test (Χ2) has been used to analyze latency to copulation (measured in minutes). We're requesting that the authors elaborate on the statistics used in each of the results, and mention them in the legends. Specific points related to the statistics are in the detailed reviews below, but are also listed here:

- Copulation rate and latency to copulation should be presented as different data sets and statistically analyzed independently.

- The y scale of the same type of graphs should be the same across figures. The scale is truncated in many graphs showing latency to copulation. This should be fixed.

- The authors should state which experimental groups are compared in each figure. When more than two genotypes are plotted, multiple comparison tests should be applied (e.g., see Figure 2D, latency to copulation; Figure 5D 5F, latency to copulation; Figure 6E, latency to copulation). All comparisons should be reported, either in each graph or in a supp. table.

- In some figure legends the authors state 'Kruskal-Wallis and post-hoc Mann-Whitney U tests or post-hoc Student's T-test'. For example, in Figure 1-suppl 3. The authors should clearly indicate which test is used to analyze each data set.

- What's the rationale for using a post-hoc Student's T-test in Figure 1-suppl 2? A Conover post hoc test might be more appropriate.

3. Related to the Dsk and receptor tools used.

- We would like the authors to show the expression pattern of the Dsk lines used:

- Expression pattern of the whole Gal4 in the VNC and to comment on its expression in non-neuronal tissues.

- Expression pattern of the split lines for the Dsk-m and Dsk-l clusters.

- Verify the RNAi lines used.

- Expression pattern of the receptor-line used (CCKLR-17D3GAL4).

4. In some places, it's ambiguous what tools were generated in this study vs their older paper. Can the authors please state this unambiguously for all tools and reagents used in this manuscript?

5. We're recommending that the authors comment on what aspects of the female sexual behaviour is altered in these manipulations? We presume they have videos that they can examine for this.

6. Could the authors clarify which tracking tools were used for locomotor assessment? We have concerns that Ctrax cannot maintain the identity of two or more flies in an arena and recommend using another tracking tool for two fly assays.

While these are the revisions we recommend as essential, we were wondering if the authors might already have tried an alternative Dsk-Gal4 that targets the IPC cluster? If they have, it would be nice to include it here. If not, could they please discuss the possibility that this cluster might also be involved sexual receptivity.

Similarly, if the authors have already investigated the requirement of the CCKLR-17D3GAL4 neurons in sexual receptivity behaviour it would be nice to include in this manuscript.

However, if these experiments have not already been done, or difficult to do, given the current situation, we are not listing them as essential.

Reviewer #1 (Recommendations for the authors):

I have a few suggestions to the authors that might make this data more accessible to the reader.

- Introduction: As it's currently written, the introduction doesn't equip the reader to interpret the results in the context of what's known in the field. Could the authors please revisit this section and elaborate (to the extent relevant to this manuscript) on the Dsk literature, male courtship and sexual receptivity in females?

- Writing in the Results section:

- As the authors present their data, it is sometimes unclear what the motivation behind the experiment was. For example, why did they look at egg-laying behaviour (line 96), or TRIC (line 97) (do please also elaborate on what TRIC is). Could the authors please pay attention to this?

- I'd urge the authors to briefly explain the set up of each experiment where the relevant data is being presented. This helps the reader tune into the experiment and its interpretation without having to go to the methods section.

- The circuit related experiments: The authors show evidence for 71G01-neurons > Dsk-m-neurons > CCKLR-17D3 receptor expressing neurons (not identified). I would have liked to have seen a more refined analysis of circuity within these domains. So, I had a few comments/questions regarding this section:

- 71G01-neurons: This line has been used extensively in literature – including by the authors – to access the P1 neurons in males. I believe it also labels the pC1 neurons in females. Are the authors suggesting that the pC1 neurons are the upstream neurons to Dsk-m? This would be interesting.

- The CCKLR-17D3-neurons: I believe the authors have a knock-in Gal4 of this receptor that is not too busy. I would be keen to know if any one of these neurons are downstream of the Dsk neurons.

Reviewer #2 (Recommendations for the authors):

Experimental procedures should include details about the methods and genetic tools used in the manuscript e.g., origin of Dsk-GAL4 and Dsk antibodies.

Please provide the expression pattern on the Dsk-Gal4 used in CNS. Does it cover the π region? If not, the experiments involving dissection of Dsk function should be repeated using an additional Dsk-GAL4 driver that includes the Dsk neurons from IPC (Figure 1, & 2), this would be required to strengthen the manuscript about involvement of Dsk neurons (not a subset) in female receptivity.

Please mention in the main text that Dsk antibodies used in Figure 1D do not label the full set of Dsk neurons. Please also cite earlier literature that shows these neurons are covered by Dsk antibodies.

What are various UAS-Dsk and Dsk deletion lines mentioned in Figure 1 E-J?

For experiments involving dTRPA1, higher temperature might affect female behavior. Authors may consider using various optogenetic tools to dissect these behaviors in future. A detailed video analysis of various genotypes should be done to show that locomotion is normal, and describe other sexual behaviors beside copulation rate and latency, please also include this source data.

Genetic background has a significant impact on behavior and it's not clear if outcrossing was performed in the same genetic background for various fly stocks used in the manuscript? If not, outcrossing should be performed for at least 5-7 generations for behavioral experiments in Figure 1-2, to rule out effects of genotype.

Figure 1 Supplement 1, provide details for the Dsk-RNAi used and what is the effect without using dicer 2 as it can lead to off targets? What is the phenotype when the RNAi is driven by an appropriate Dsk-GAL4?

Was the locomotion analysis done in the presence of males (Figure 1, Supplement 2 & Figure 6, Supplement 3)? While the discussion mentions use of Ctrax for locomotion tracking, it is not mentioned anywhere in the main text of experimental procedures. Also, Ctrax lacks the ability to faithfully maintain the identity of two or more flies in an arena. It would be better to use another tracking tool for two fly assays and Drosophila activity monitors for single fly locomotion assays.

Figure 1, Supplement 4, please include source data for TRIC experiments.

GRASP data (Figure3, Supplement 2) is weak and does not show much overlap between Dsk and R70G01GAL4 when compared to trans Tango experiments. These experiments should be either repeated or the caveat should be mentioned in the manuscript.

Figure 5E- the curve is really skewed towards the bottom as compared to other genotypes, are these controls healthy? It might be better to repeat this experiment/ provide video analysis.

There are several grammatical errors and awkward sentence constructions throughout the manuscript, please correct this. Some examples are below-

Introduction section needs substantial re-writing and the study needs to be properly placed in the broader context of the field, see my comments above for appropriate citations, below are a few suggestions but this is not an exhaustive list.

Line 48-50, Spinster mutants actively reject males, and it is not a case of 'lower mating success rate' as females are rejecting males.

Line 71-72, [missing citation] including satiety/food ingestion- cite Soderberg et al., 2012.

Line 72-73, [missing citation] aggression- cite Williams et al., Genetics 2014 and Agrawal et al., JEB 2020.

Wu et al., Nature Communications 2019 have extensively characterized role of Dsk in male courtship and sexual drive and this work is not cited properly.

Line 104, correct Figure 2I to Figure 1I and line 108, instead of Figure 2J correct to 1J.

Line 132 introduces R71G01-GAL4 neurons awkwardly and it seems to come out of nowhere. What was the role of that driver? Why did the authors choose to investigate this GAL4 driver?

Line 175 mentions GluRIA-GAL4 but the reference is missing, please also include the role of this driver.

Line 191-192, states- 'we constructed knockout lines for these two receptors (figure 6A-C)' but in the figure only one receptor is shown. Are these the same lines as in the earlier study (Wu et al., 2020)?

Line 194-196, RNAi knockdown of CCKLR-17D3 was performed, what is the phenotype from CCKLR-17D1 knock-down?

Line 239, After Dsk- insert 'gene'.

Line 267, classification of Dsk neurons, given that Wu et al., Nat. Comm., 2019 study precedes these studies, classification of Dsk neurons and any differences should be mentioned in the main text itself rather than in the Discussion section.

Line 270, for male aggression please also cite Agrawal et al., JEB 2020.

line 488, by RCR do you mean PCR?

Figure supplements (e.g., Figure 1 figure supplement 6,) repeatedly show the behavioral arena used for courtship assay. This is redundant and should be shown only once and referred to throughout the manuscript as required.

Reviewer #3 (Recommendations for the authors):

I believe the science and its presentation could be strengthened by addressing the points below:

Science.

1. It is not clear whether the authors have used proper statistical tests. The same flies are monitored over time for copulation rate, which should be considered in the statistical analysis.

2. Why have the authors applied a non-parametric test (Χ2) for analyzing latency to copulation (measured in minutes)?

3. Copulation rate and latency to copulation should be presented as different data sets and statistically analyzed independently.

4. The y scale of the same type of graphs should be the same across figures.

5. The scale is truncated in many graphs showing latency to copulation. This should be fixed.

6. The authors should state which experimental groups are compared in each figure. When more than two genotypes are plotted, multiple comparison tests should be applied (e.g., see Figure 2D, latency to copulation; Figure 5D 5F, latency to copulation; Figure 6E, latency to copulation). All comparisons should be reported, either in each graph or in a supp. table.

7. In some figure legends the authors state 'Kruskal-Wallis and post-hoc Mann-Whitney U tests or post-hoc Student's T-test'. For example, in Figure 1-suppl 3. The authors should clearly indicate which test is used to analyze each data set.

8. What's the rationale for using a post-hoc Student's T-test in Figure 1-suppl 2? A Conover post hoc test might be more appropriate.

9. The data strongly support a role for DSK and DSK neurons control female sexual receptivity. However, it is unclear whether DSK neurons in the VNC contribute to the observed phenotypes. An experiment addressing this point would further support the findings of the study.

10. Figure 1 A—figure supplement 4. None of the control virgin females have laid any unfertilized eggs across 3 days, which is unexpected.

11. Figure 1B-suppl 4. More details should be added in the graph and legend to understand the TRIC data.

12. Do the authors have data showing which aspects of female sexual behavior are regulated by the DSK signaling? For example, does activation of DSK neurons induce any female acceptance behaviors (e.g., partial ovipositor extrusion)? Perhaps DSK neurons trigger motor outputs associated with sexual receptivity? If DSK neurons acted downstream of pC1 neurons, we would expect them to induce vaginal plate opening. These possibilities should be experimentally addressed or discussed in the manuscript.

13. I believe more information about the expression pattern of Dsk in neuronal and non-neuronal tissues would help better understand the findings. Details of the number of DSK neurons, different brain clusters, as well as projection patterns, would help the authors to put their findings in context. The authors should add confocal images showing the expression pattern of Dsk neurons in VNC.

A better description of the expression pattern of Dsk would improve the narrative and help the authors better explain (1) the anatomical and functional experiments linking DSK neurons with 71G01-Gal4 neurons (2) the identification of subsets of DSK clusters key for sexual receptivity (3) the importance of manipulating DSK and Dsk-expressing cells solely in the nervous system.

14. Dsx-expressing neurons have a prominent role in controlling female sexual receptivity. Is there any indication that DSK neurons and Dsx neurons fully/partially overlap?

15. I believe Table 1 is missing in the manuscript.

16. Some genetic controls are missing in several figures. For instance, in Figure 2, elav-GAL4/+ is missing.

17. The authors should clarify that the GRASP experiments don't provide information about the direction of connectivity.

18. The authors should add images showing the pattern of DSK neurons targeted with genetic intersections using GluRIA-Gal4 and TbH-Gal4 with DSK-FLP in the VNC.

Presentation:

I believe a substantial improvement in the writing style would help readers fully judge and appreciate the findings of this interesting study.

1. In my opinion, the opening paragraph of Introduction is not engaging. Overall, I think the authors could strengthen the Introduction by adding information about the courtship ritual in flies and explaining its relevance for mate selection. Moreover, they could describe how female flies signal sexual receptivity and accept a male for copulation. This would help them highlight the importance of their work and make it more attractive for non-specialist readers.

2. My impression is that the Results section reads like a long list of results, which are not connected to tell an interesting story. The rationale of many of the experiments are either presented in the Discussion section or not discussed at all. The authors could speculate how DSK neurons/ DSK might work to regulate sexual receptivity to introduce subsequent experiments in the main text. A better description of the results and their potential implications would help the narrative of the study (more details below).

3. One of the strengths of this study is the arsenal of modern tools used to support the findings. However, many of the methods are not described in the main text. More information would help readers to fully grasp the approaches and findings of this study.

4. The Discussion section superficially discusses the findings of the study. It rather reads like a recapitulation of the results. The authors could enrich the discussion by speculating how DSK neurons might control female sexual receptivity. Could pC1 neurons (targeted by 71G01-Gal4?) act as a central node for female sexual receptivity, conveying female mating decisions to Dsk neurons? Alternatively, could DSK neurons also integrate sensory information relevant to sexual behavior? Are there any sensory pathways relevant to female sexual receptivity feeding into DSK neurons? What are the potential downstream targets of DSK? What aspects of female sexual behavior are regulated by the DSK pathway? Do females show increased vaginal plate/ partial ovipositor extrusion? How do DSK neurons differ between males and females, and how do these differences may result in different sex-specific behaviors?

5. The schematic in Figure 4 A is not clear.

6. Figure 4. A bigger schematic of the brain depicting the different DSK clusters would help understand which neurons are assessed.

7. The authors should make the figures accessible to readers with color-blindness.

8. I suggest the authors proofread the manuscript, as there are typos, grammatical mistakes and unclear sentences throughout the manuscript. Some examples:

Line 46 – 'is' should be changed to 'are'.

Line 87 – This sentence contains grammatical mistakes.

Line 93 – RNAi-mediated females: this should be better defined.

Line 109 – 'Indicated' should be changed to 'indicate'.

Line 104 – Figure is wrongly cited. It should be Figure 1I.

Line 112 – 'were' should be changed to 'are'.

Line 132 – 'expressed' should be changed to 'are present'.

Line 134 -Fix this sentence 'Given that, we hypothesized whether DSK'.

Line 139 – Change 'recombinant' to 'reconstituted'.

Line 157 -The sentence does not make sense.

Line 169 – Unclear sentence.

Line 188 – It should be-'wanted' not 'want'.

Line 270 – The sentence should be rewritten: In this study, DSK neurons also modulate female sexual behavior.

Line 488 – Fix this sentence 'RCR analysis from genomic DNA samples'

Line 502 – Fix this sentence: 'And there are same numbers in two parameters'.

'Latency' should be described as' latency to copulation'.

Figure 1.Suppl 5 – fix the typo in the title.

The authors should better articulate the rationale of the experiments and explain the techniques so readers can better appreciate the findings. For example:

Line 86 – 'behavior, we first constructed knock out line for Dsk'. Describe how the knock out line for DsK was made.

Line 94 – Explain the rationale for looking at male courtship behavior.

Line 96 – Explain the rationale for looking at egg laying.

Line 97 – Explain the rationale of looking at TRIC signal changes. The authors should also explain how this technique works and provide more details on the findings.

The authors should clearly define if any of the tools used in this study were previously generated.

Line 102 – Define the DsK Gal4 used in Figure 1I. Is it the same line used in subsequent Figures?

Line 109 – The conclusion should also state that the evidence points to a role of DSK neurons in female sexual receptivity.

Line 119 – Explain what's the rationale for looking at very young females. State their age and differences with previous virgin females tested in other experiments.

Line 133 – More information about 71G01-Gal4, and the fact that it might intersect pC1 neurons, would help explain the rationale behind testing these neurons.

Line 157 – Here it is important to explain how many DSK neurons are present in the brain, and how they are distributed in different clusters (by including images of the nervous system).

Line 175 – The authors identify two Gal4 lines (GluRIAGAL4 and TβHGAL4) that help them intersect different DSK neurons but these lines are not described. The authors should explain what neurons are targeted by these drivers (e.g., glutamatergic, octopaminergic, etc). This information could be useful to interpret and discuss their findings (e.g., relevant DSK neurons might be excitatory).

Line 164 – Explain how the P2X2 optogenetic approach works.

Line 191 – 'We constructed knock out lines for these two receptors (Figure 6A-C) (Wu et al., 2020)'. Clearly state if these are novel tools created for this study.

https://doi.org/10.7554/eLife.76025.sa1

Author response

Essential revisions:

1. Related to the writing:

- Introduction: We would like the authors to cover the appropriate literature (and references) related to (1) Dsk, (2) courtship ritual and its relevance to mate selection, and (3) female receptivity and a description of behaviours that constitute it.

We thank the reviewer for this comment, and thoroughly rewrote the introduction and added appropriate references as suggested.

- Results: We're recommending that the authors motivate each result section with (1) a rationale for the experiments done in that section, (2) a description of the experimental set-up, and (3) elaborate on the description and interpretation of the results for that section.

Thanks for the suggestions. In the revised manuscript, we have explained the rationale of experiments (such as egg-laying; TRIC; courtship behavior; female sexual behavior in very young virgin female and mated female) and described the experiment and results more accurately.

2. Statistics: We're concerned about the statistics used. For example, a non-parametric test (Χ2) has been used to analyze latency to copulation (measured in minutes). We're requesting that the authors elaborate on the statistics used in each of the results, and mention them in the legends. Specific points related to the statistics are in the detailed reviews below, but are also listed here:

Thanks for pointing this out. We have carefully checked statistics and described statistics in detail in each figure legend.

- Copulation rate and latency to copulation should be presented as different data sets and statistically analyzed independently.

In the revised manuscript, the data sets including copulation rate and latency to copulation are now presented independently. In addition, we have re-analyzed the latency to copulation using proper statistical test (For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal-Wallis and post-hoc Mann-Whitney U tests are applied).

- The y scale of the same type of graphs should be the same across figures. The scale is truncated in many graphs showing latency to copulation. This should be fixed.

We have corrected this issue throughout.

- The authors should state which experimental groups are compared in each figure. When more than two genotypes are plotted, multiple comparison tests should be applied (e.g., see Figure 2D, latency to copulation; Figure 5D 5F, latency to copulation; Figure 6E, latency to copulation). All comparisons should be reported, either in each graph or in a supp. table.

Thanks for pointing this out. In the revised manuscript, we have re-analyzed the latency to copulation using proper statistical test as mentioned above and revised the description in the figure legend.

- In some figure legends the authors state 'Kruskal-Wallis and post-hoc Mann-Whitney U tests or post-hoc Student's T-test'. For example, in Figure 1-suppl 3. The authors should clearly indicate which test is used to analyze each data set.

In the revised manuscript, we have carefully examined all figure legends about statistical test and clarified the statistical tests used for each data set.

- What's the rationale for using a post-hoc Student's T-test in Figure 1-suppl 2? A Conover post hoc test might be more appropriate.

We have corrected the statistics in the revised manuscript throughout.

3. Related to the Dsk and receptor tools used.

- We would like the authors to show the expression pattern of the Dsk lines used:

In the revised manuscript, we have added the expression pattern of the DskGAL4 in the brain and the ventral nerve cord (please see Figure 1—figure supplement 3D).

- Expression pattern of the whole Gal4 in the VNC and to comment on its expression in non-neuronal tissues.

In the revised manuscript, we have added the expression pattern of the GAL4 lines in the VNC (e.g., DskGAL4; please see Figure R1); and GAL4 lines labelling DSK-MP1 and DSK-MP3 neurons respectively (please see Figure 3—figure supplement 1). In addition, we also added the expression pattern of the DskGAL4 in the gut and no expression patterns were observed in the glia or gut (please see Figure 1—figure supplement 3D-E).

- Expression pattern of the split lines for the Dsk-m and Dsk-l clusters.

To be in accordance with previous studies, we now used the term DSK-MP1 for the middle DSK-M neurons and DSK-MP3 for the lateral DSK-L neurons in the revised manuscript. We show the expression pattern of the split lines for DSK-MP1 and DSK-MP3 clusters in Figure 3A-B (brain) and Figure 3—figure supplement 1 (VNC),.

- Verify the RNAi lines used.

The Dsk-RNAi line used in this study is a gift from Yufeng Pan’s lab (Wu et al. 2019, Nat. Comm.). We verify the efficiency of this RNAi by anti-DSK staining in females and found that anti-DSK signals are significantly decreased after knocking down the expression of Dsk gene (please see Figure 1—figure supplement 3A-B). Furthermore, we further performed RNAi interference experiment by using DskGAL4 drive the expression of Dsk-RNAi to test the change in female sexual behavior (please see Figure 1—figure supplement 3F).

- Expression pattern of the receptor-line used (CCKLR-17D3GAL4).

In the revised manuscript, we have added the expression pattern of CCKLR-17D3GAL4 in the brain and the ventral nerve cord (please see Figure 4—figure supplement 4A).

4. In some places, it's ambiguous what tools were generated in this study vs their older paper. Can the authors please state this unambiguously for all tools and reagents used in this manuscript?

Thanks for pointing this out. Indeed, a few reagents were generated in our previous eLife paper (Wu et al., 2020). In the revised manuscript, we clearly indicated whether the genetic reagent was generated in this study or a previous study.

5. We're recommending that the authors comment on what aspects of the female sexual behaviour is altered in these manipulations? We presume they have videos that they can examine for this.

Thanks for the suggestion. We re-recorded high resolution videos. We asked whether the phenotype of decreased female receptivity in Dsk mutant flies is due to potentially elevated ovipositor extrusion (a rejection behavior). However, we found that manipulating Dsk gene did not affect ovipositor extrusion (please see Figure 1—figure supplement 2). Similarly, we also analyzed whether activating DSK neurons would affect ovipositor extrusion in females with courting males. We found that manipulation of DSK neurons did not affect ovipositor extrusion (please see Figure 2—figure supplement 1). Finally, we further discussed the potential effect of Dsk signaling on female sexual behavior (e.g., potential role of pausing behavior to male courtship) in the Discussion section.

6. Could the authors clarify which tracking tools were used for locomotor assessment? We have concerns that Ctrax cannot maintain the identity of two or more flies in an arena and recommend using another tracking tool for two fly assays.

Thanks for the suggestion. Indeed, we used single female in the absence of a courting male for the locomotor test and used Ctrax software for data analysis. We could not faithfully analyze locomotor behaviors in a pair of courting flies, and we believe locomotor in single flies could faithfully reflect their general locomotor activity.

While these are the revisions we recommend as essential, we were wondering if the authors might already have tried an alternative Dsk-Gal4 that targets the IPC cluster? If they have, it would be nice to include it here. If not, could they please discuss the possibility that this cluster might also be involved sexual receptivity.

We thank the reviewer for this comment. Indeed, our DskGAL4 does not label the IPCs, and it has been found that DSK is also expressed in the IPCs. Although we could not obtain another Dsk-Gal4 that may target the IPCs, we used the Dilp2-GAL4 that specifically labels at least some Dsk-expressing IPCs. We found that restricting the expression of DskRNAi in IPC neurons using the Dilp2-GAL4 does not affect female sexual behavior (please see Figure 1—figure supplement 3G). These results indicate that Dsk peptide released from IPCs is not involved in regulating female sexual behavior.

Similarly, if the authors have already investigated the requirement of the CCKLR-17D3GAL4 neurons in sexual receptivity behaviour it would be nice to include in this manuscript.

Thanks for the suggestion. In the revised manuscript, we have examined the role of CCKLR-17D3 neurons in regulating female sexual behavior (please see Figure 4H-J) and modified the text accordingly.

However, if these experiments have not already been done, or difficult to do, given the current situation, we are not listing them as essential.

Reviewer #1 (Recommendations for the authors):

I have a few suggestions to the authors that might make this data more accessible to the reader.

- Introduction: As it's currently written, the introduction doesn't equip the reader to interpret the results in the context of what's known in the field. Could the authors please revisit this section and elaborate (to the extent relevant to this manuscript) on the Dsk literature, male courtship and sexual receptivity in females?

We thank the reviewer for this suggestion. In this new version, we carefully rewrote the introduction by adding relevant information to make it more concisely.

- Writing in the Results section:

- As the authors present their data, it is sometimes unclear what the motivation behind the experiment was. For example, why did they look at egg-laying behaviour (line 96), or TRIC (line 97) (do please also elaborate on what TRIC is). Could the authors please pay attention to this?

We thank the reviewer for pointing out this issue. We have carefully fixed the description by adding the motivation behind every experiment.

- I'd urge the authors to briefly explain the set up of each experiment where the relevant data is being presented. This helps the reader tune into the experiment and its interpretation without having to go to the methods section.

We have briefly explained the set-up of each experiment in the figure legends. For example, for the set-up in Figure 6A: “(A) Left: ATP stimulation and recording arrangement. The chemical stimulation is implemented using a three-barrel tube (with the tip positioned ~50μm away from the brain), controlled by a stepper for rapid solution change. Right: schematic illustrating the activation of R71G01GAL4 neurons by ATP and patch-camp recording of DSK neurons.”

- The circuit related experiments: The authors show evidence for 71G01-neurons > Dsk-m-neurons > CCKLR-17D3 receptor expressing neurons (not identified). I would have liked to have seen a more refined analysis of circuity within these domains. So, I had a few comments/questions regarding this section:

- 71G01-neurons: This line has been used extensively in literature – including by the authors – to access the P1 neurons in males. I believe it also labels the pC1 neurons in females. Are the authors suggesting that the pC1 neurons are the upstream neurons to Dsk-m? This would be interesting.

We thank the reviewer for this suggestion. We have revised the text more clearly. In the revised manuscript, we stated that R71G01-GAL4 labels the pC1 neurons as well as many other neurons in females, and speculate that there is a functional connection between pC1 neurons and DSK-MP1 neurons. In order to further confirm this speculation, we now requested two splitGAL4 driver lines that specifically label pC1 neurons, pC1-ss1 and pC1-ss2 (Wang et al., 2021, Nature) from Dr. Kaiyu Wang who recently set up a lab in Shanghai. Indeed, we found that pC1 neuron axons overlapped with DSK neuron dendrites by anatomical registration (please see Figure 5—figure supplement 4). Furthermore, we utilized the recently generated full adult female brain (FAFB) electron microscopic (EM) image set and found that pC1 neurons have intense synaptic input on DSK-MP1 neurons, especially the single pair of DSK-MP1b neurons (Table S2). We revised our text accordingly and further discussed this possibility in the discussion session of the revised manuscript.

- The CCKLR-17D3-neurons: I believe the authors have a knock-in Gal4 of this receptor that is not too busy. I would be keen to know if any one of these neurons are downstream of the Dsk neurons.

Yes, we have a knock-in GAL4 of CCKLR-17D3 and we also showed the expression pattern (please see Figure4—figure supplement4A). It is well known that dsx broadly expresses in female brain and plays a key role in regulating female sexual behavior. Thus, we asked whether CCKLR-17D3GAL4 drives expression in dsx neurons to regulate female receptivity. However, intersection between CCKLR-17D3GAL4 and dsxLexA only labeled projections from peripheral sensory neurons that innervate the SOG region (please see Figure 4—figure supplement 4B). Furthermore, either overexpressing or knocking down CCKLR-17D3 in all dsx neurons did not alter virgin female receptivity (please see Figure 4—figure supplement 4C-D). These results indicate that CCKLR-17D3 did not function in dsx neurons to regulate female sexual behavior. In the future, we need to generate CCKLR-17D3-Flp line to further subdivide CCKLR-17D3 neurons using intersectional technology and investigate which neuron clusters are responsible for female sexual behavior.

Reviewer #2 (Recommendations for the authors):

Experimental procedures should include details about the methods and genetic tools used in the manuscript e.g., origin of Dsk-GAL4 and Dsk antibodies.

Indeed, most lines used in this study were the same with those used in our previous eLife paper (Wu et al., 2020). We have modified the text and also briefly explained the generation of these genetic tools in main text or method section.

Please provide the expression pattern on the Dsk-Gal4 used in CNS. Does it cover the π region? If not, the experiments involving dissection of Dsk function should be repeated using an additional Dsk-GAL4 driver that includes the Dsk neurons from IPC (Figure 1, & 2), this would be required to strengthen the manuscript about involvement of Dsk neurons (not a subset) in female receptivity.

We thank the reviewer for pointing out this issue and we have added the expression pattern of the DskGAL4 in the brain and ventral nerve cord (please see Figure 1—figure supplement 3D). Indeed, our DskGAL4 does not label the IPCs, and it has been found that DSK is also expressed in the IPCs. We do not test the role of DSK neurons driven by another Dsk-Gal4 driver, as we cannot obtain this Dsk-Gal4 that may target the IPCs. However, we examined the effects of knocking down the expression of Dsk only in insulin-producing cells (IPCs) in π region on female sexual behavior as shown above.

Please mention in the main text that Dsk antibodies used in Figure 1D do not label the full set of Dsk neurons. Please also cite earlier literature that shows these neurons are covered by Dsk antibodies.

We thank the reviewer for pointing out this and have modified the text as suggested as following: “…immunostaining with anti-DSK antibody, which does not label the full set of DSK neurons as previously found (Nichols and Lim, 1996).”.

What are various UAS-Dsk and Dsk deletion lines mentioned in Figure 1 E-J?

We thank the reviewer for pointing this out and we have changed the descriptions of these lines. We now stated clearly that these lines were generated in our previous study and also briefly described how they were generated in the main text and method section.

For experiments involving dTRPA1, higher temperature might affect female behavior. Authors may consider using various optogenetic tools to dissect these behaviors in future. A detailed video analysis of various genotypes should be done to show that locomotion is normal, and describe other sexual behaviors beside copulation rate and latency, please also include this source data.

As suggested by the reviewer, we have analyzed the general locomotion activity of dTrpA1 experiment. We found that females with activating of DSK neurons (DskGAL4>UAS-dTrpA1) did not affect locomotion behavior compared with genetic control (DskGAL4/+ or UAS-dTrpA1/+) in high or low temperature condition (please see Figure 2—figure supplement 2A). Our results demonstrated that higher temperature did not affect female sexual behavior (Figure 2B-C), although higher temperature might induce higher locomotion velocity. In addition, we also tested the general locomotion activity after inactivating DSK neurons and found that locomotion did not significant change compared with controls (please see Figure 2—figure supplement 2B).

As suggested by the reviewer, we have re-recorded high resolution videos to analyze whether activation of DSK neurons affect ovipositor extrusion of female with courting males. We found that manipulation of DSK neurons did not affect the phenotype of ovipositor extrusion (please see Figure 2—figure supplement 1).

Genetic background has a significant impact on behavior and it's not clear if outcrossing was performed in the same genetic background for various fly stocks used in the manuscript? If not, outcrossing should be performed for at least 5-7 generations for behavioral experiments in Figure 1-2, to rule out effects of genotype.

We understand that reviewer’s concern regarding the genetic background. Indeed, the flies used in this study were backcrossed to isogenized Canton S flies for at least five generations prior to behavior studies to eliminate the effect of genotype.

Figure 1 Supplement 1, provide details for the Dsk-RNAi used and what is the effect without using dicer 2 as it can lead to off targets? What is the phenotype when the RNAi is driven by an appropriate Dsk-GAL4?

The Dsk-RNAi line used in this study is a gift from Yufeng Pan’s lab (Wu et al. 2019, Nat. Comm.). We verify the efficiency of this RNAi by anti-DSK staining in females and found that anti-DSK signals are significantly decreased after knocking down the expression of Dsk gene (please see Figure 1—figure supplement 3A-B). We have performed RNAi interference experiment by using elav-GAL4 to drive the expression of Dsk-RNAi and found that knocking down the expression of Dsk significantly decreased copulation rate and prolonged the latency to copulation. In addition, we also found that knocking down the expression of Dsk by using DskGAL4 to drive UAS-DskRNAi significantly decreased copulation rate and prolonged the latency to copulation (please see Figure 1—figure supplement 3F).

Was the locomotion analysis done in the presence of males (Figure 1, Supplement 2 & Figure 6, Supplement 3)? While the discussion mentions use of Ctrax for locomotion tracking, it is not mentioned anywhere in the main text of experimental procedures. Also, Ctrax lacks the ability to faithfully maintain the identity of two or more flies in an arena. It would be better to use another tracking tool for two fly assays and Drosophila activity monitors for single fly locomotion assays.

Thanks for the suggestion. Indeed, we used single female in the absence of a courting male for the locomotor test and used Ctrax software for data analysis. We could not faithfully analyze locomotor behaviors in a pair of courting flies, and we believe locomotor in single flies could faithfully reflect their general locomotor activity.

Figure 1, Supplement 4, please include source data for TRIC experiments.

We have re-drawn this figure including source data as reviewer suggested (please see Figure 1—figure supplement 6B-D). We re-quantified the TRIC signal by calculating the ratio of intensities of GFP signal over the RFP signal.

GRASP data (Figure3, Supplement 2) is weak and does not show much overlap between Dsk and R70G01GAL4 when compared to trans Tango experiments. These experiments should be either repeated or the caveat should be mentioned in the manuscript.

As suggested by the reviewer, we have repeated the GRASP experiment (please see Figure 5-supplement 2).

Figure 5E- the curve is really skewed towards the bottom as compared to other genotypes, are these controls healthy? It might be better to repeat this experiment/ provide video analysis.

We understand reviewer’s concern regarding Figure 5E. All flies tested for behavior have no obvious developmental deficit. We now repeated this experiment and found similar results. These control females showed slightly reduced copulation rate compared with some other control females. which could be due to the complex genetic manipulations. Thus, we tested up to a hundred pairs of flies (in many cases, n > 100) for most experiments and provided as many control experiments as we could in this study.

There are several grammatical errors and awkward sentence constructions throughout the manuscript, please correct this. Some examples are below-

Introduction section needs substantial re-writing and the study needs to be properly placed in the broader context of the field, see my comments above for appropriate citations, below are a few suggestions but this is not an exhaustive list.

We carefully rewrote the introduction part by adding the information related to this manuscript to make it more concise and we also have correctly cited these references as mentioned above in the revised manuscript.

Line 48-50, Spinster mutants actively reject males, and it is not a case of 'lower mating success rate' as females are rejecting males.

We thank the reviewer for pointing out this issue and we have changed the description of spinster gene in revised manuscript as following: “…mutant females of spinster show enhanced rejection behavior”.

Line 71-72, [missing citation] including satiety/food ingestion- cite Soderberg et al., 2012.

We thank the reviewer for pointing out this issue we have added this reference in the revised manuscript.

Line 72-73, [missing citation] aggression- cite Williams et al., Genetics 2014 and Agrawal et al., JEB 2020.

We thank the reviewer for pointing out this issue and we have added these references in the revised manuscript.

Wu et al., Nature Communications 2019 have extensively characterized role of Dsk in male courtship and sexual drive and this work is not cited properly.

We thank the reviewer for pointing out this issue and we have properly cited this reference in the revised manuscript (e.g., in term of the classification of DSK neurons).

Line 104, correct Figure 2I to Figure 1I and line 108, instead of Figure 2J correct to 1J.

We thank the reviewer for pointing out this issue and we have corrected these mistakes.

Line 132 introduces R71G01-GAL4 neurons awkwardly and it seems to come out of nowhere. What was the role of that driver? Why did the authors choose to investigate this GAL4 driver?

We thank the reviewer for pointing out this issue and we have rewritten this part “In males, R71G01-GAL4 drives the expression of P1 neurons that interact with DSK neurons to regulate male courtship (Wu et al., 2019) and aggression (Wu et al., 2020). Previous studies employed the intersection of R71G01-LexA with dsxGAL4 to specifically label and manipulate pC1 neurons, which integrate male courtship and pheromone cues to promote virgin female receptivity (Zhou et al., 2014). We found that activation of R71G01-GAL4 neurons consisting of pC1 and a few other neurons promoted female receptivity (Figure 5—figure supplement 1), similarly as previously activating pC1 neurons using the intersectional strategy (Zhou et al., 2014). Thus, we asked whether DSK neurons would interact with R71G01-GAL4 neurons to control female sexual behavior.”

Line 175 mentions GluRIA-GAL4 but the reference is missing, please also include the role of this driver.

Indeed, the GAL4 lines including GluRIA-GAL4 used in screening are from Yi Rao’s lab. We have cited the relevant reference in line 172 in the previous manuscript.

As suggested by reviewer, we have rewritten this part as following: “Interestingly, we found that intersection of GluRIAGAL4, which targets Glutamate receptor IA (GluRIA) cells, with DskFlp specifically labeled DSK-MP1 neurons (Figure 3A), while intersection of TβHGAL4, which targets octopaminergic neurons, with DskFlp specifically labeled DSK-MP3 neurons (Figure 3B).”

Line 191-192, states- 'we constructed knockout lines for these two receptors (figure 6A-C)' but in the figure only one receptor is shown. Are these the same lines as in the earlier study (Wu et al., 2020)?

Yes, the knockout lines used in this study are the same lines as in the earlier study (Wu et al., 2020) and we have changed the description of these lines used in this study.

Line 194-196, RNAi knockdown of CCKLR-17D3 was performed, what is the phenotype from CCKLR-17D1 knock-down?

We have examined the effect on female sexual behavior in females with knocking down the expression of CCKLR-17D1 and found that knockdown of CCKLR-17D1 did not affect female receptivity (please see Figure 4—figure supplement 1B).

Line 239, After Dsk- insert 'gene'.

This sentence was removed in the revised manuscript.

Line 267, classification of Dsk neurons, given that Wu et al., Nat. Comm., 2019 study precedes these studies, classification of Dsk neurons and any differences should be mentioned in the main text itself rather than in the Discussion section.

We thank the reviewer for this comment and have described the classification of Dsk neurons in the result section as well as Discussion section in the revised manuscript.

Line 270, for male aggression please also cite Agrawal et al., JEB 2020.

We thank the reviewer’s suggestion and we have added these references in the revised manuscript.

line 488, by RCR do you mean PCR?

Yes, we confirmed the deletion of Dsk by PCR analysis at the deletion locus on genomic DNA samples, and the typo has been corrected.

Figure supplements (e.g., Figure 1 figure supplement 6,) repeatedly show the behavioral arena used for courtship assay. This is redundant and should be shown only once and referred to throughout the manuscript as required.

We thank the reviewer’s suggestion and we have made textual changes as suggested.

Reviewer #3 (Recommendations for the authors):

I believe the science and its presentation could be strengthened by addressing the points below:

Science.

1. It is not clear whether the authors have used proper statistical tests. The same flies are monitored over time for copulation rate, which should be considered in the statistical analysis.

We thank the reviewer for this comment and have thoroughly checked all statistical analysis in the revised manuscript.

2. Why have the authors applied a non-parametric test (Χ2) for analyzing latency to copulation (measured in minutes)?

We thank the reviewer for pointing this out and we have re-analyzed these data about latency to copulation and detail statistical test was displayed in the figure legend. (Kruskal-Wallis ANOVA test followed by post-hoc Mann-Whitney U test was used for comparison among multiple groups. The Mann-Whitney U test was applied for analyzing the significance of two columns).

3. Copulation rate and latency to copulation should be presented as different data sets and statistically analyzed independently.

We thank the reviewer for pointing this out and the data sets including copulation rate and latency to copulation have presented independently. In addition, we have been re-analyzed the latency to copulation using proper statistical tests.

4. The y scale of the same type of graphs should be the same across figures.

We have corrected this issue throughout.

5. The scale is truncated in many graphs showing latency to copulation. This should be fixed.

We thank the reviewer for pointing this out and we have corrected this problem in all new figures.

6. The authors should state which experimental groups are compared in each figure. When more than two genotypes are plotted, multiple comparison tests should be applied (e.g., see Figure 2D, latency to copulation; Figure 5D 5F, latency to copulation; Figure 6E, latency to copulation). All comparisons should be reported, either in each graph or in a supp. table.

We thank the reviewer for pointing out this problem. We have been re-analyzed the latency to copulation using proper statistical tests as mentioned above and revised the description in the figure legends.

7. In some figure legends the authors state 'Kruskal-Wallis and post-hoc Mann-Whitney U tests or post-hoc Student's T-test'. For example, in Figure 1-suppl 3. The authors should clearly indicate which test is used to analyze each data set.

We thank the reviewer for pointing this out. We have carefully examined all figure legends about statistical test and clarified the statistical tests used for each data set.

8. What's the rationale for using a post-hoc Student's T-test in Figure 1-suppl 2? A Conover post hoc test might be more appropriate.

We have corrected the statistics in the revised manuscript throughout.

9. The data strongly support a role for DSK and DSK neurons control female sexual receptivity. However, it is unclear whether DSK neurons in the VNC contribute to the observed phenotypes. An experiment addressing this point would further support the findings of the study.

Indeed, by using DskGAL4 to drive the expression of UAS-GFP, we found that there no DSK neurons in the VNC and only have projections from brain by using DskGAL4 to drive the expression of UAS-GFP (please see Figure 1—figure supplement 3D). Thus, we think that DSK neurons in the brain play a role in controlling female receptivity.

10. Figure 1 A—figure supplement 4. None of the control virgin females have laid any unfertilized eggs across 3 days, which is unexpected.

We indeed observed that the virgin females did not lay any unfertilized eggs within 3 days and it may be because that the females used to test the egg laying behavior were too young. To ensure that the age of females is the same between egg laying experiment and mating behavior, we re-tested egg laying behavior within 3 days after the indicated genotype of virgin females aging 4 days and found that mutating of Dsk or knocking down the expression of Dsk did not affect egg laying behavior of virgin females (please see Figure 1—figure supplement 6).

11. Figure 1B-suppl 4. More details should be added in the graph and legend to understand the TRIC data.

We thank the reviewer for this suggestion. We have added more details in the graph and legend.

12. Do the authors have data showing which aspects of female sexual behavior are regulated by the DSK signaling? For example, does activation of DSK neurons induce any female acceptance behaviors (e.g., partial ovipositor extrusion)? Perhaps DSK neurons trigger motor outputs associated with sexual receptivity? If DSK neurons acted downstream of pC1 neurons, we would expect them to induce vaginal plate opening. These possibilities should be experimentally addressed or discussed in the manuscript.

We thank the reviewer for this suggestion. We re-recorded high resolution videos. We asked whether the phenotype of decreased female receptivity in Dsk mutant flies is due to potentially elevated ovipositor extrusion (a rejection behavior). However, we found that manipulating Dsk gene did not affect ovipositor extrusion (please see Figure 1—figure supplement 2). Similarly, we also analyzed whether activating DSK neurons would affect ovipositor extrusion in females with courting males. We found that manipulation of DSK neurons did not affect ovipositor extrusion (please see Figure 2—figure supplement 1). Finally, we further discussed the potential effect of Dsk signaling on female sexual behavior (e.g., potential role of pausing behavior to male courtship) in the Discussion section.

13. I believe more information about the expression pattern of Dsk in neuronal and non-neuronal tissues would help better understand the findings. Details of the number of DSK neurons, different brain clusters, as well as projection patterns, would help the authors to put their findings in context. The authors should add confocal images showing the expression pattern of Dsk neurons in VNC.

A better description of the expression pattern of Dsk would improve the narrative and help the authors better explain (1) the anatomical and functional experiments linking DSK neurons with 71G01-Gal4 neurons (2) the identification of subsets of DSK clusters key for sexual receptivity (3) the importance of manipulating DSK and Dsk-expressing cells solely in the nervous system.

We thank the reviewer for this helpful suggestion. Following the reviewer’s suggestion, we have provided detail descriptions of the DSK neurons in the revised manuscript. In addition, we also have added the expression pattern of DSK neurons in the VNC in the revised manuscript (please see Figure 1—figure supplement 3D). Indeed, this DskGAL4 line did not label neurons in the ventral nerve cord or the gut.

14. Dsx-expressing neurons have a prominent role in controlling female sexual receptivity. Is there any indication that DSK neurons and Dsx neurons fully/partially overlap?

We have examined whether DSK neurons are dsx+ neurons by using intersectional technology and found that DSK neurons (magenta) did not overlap with dsx neurons (green).

15. I believe Table 1 is missing in the manuscript.

We have added Table 1 in the revised manuscript. We are sorry for this mistake.

16. Some genetic controls are missing in several figures. For instance, in Figure 2, elav-GAL4/+ is missing.

We thank the reviewer for this suggestion and have added the control line (elav-GAL4/+) in Figure 1J (please see Figure 1J).

17. The authors should clarify that the GRASP experiments don't provide information about the direction of connectivity.

We thank the reviewer for pointing out this and we have rewritten the sentence to only suggest such possibility.

18. The authors should add images showing the pattern of DSK neurons targeted with genetic intersections using GluRIA-Gal4 and TbH-Gal4 with DSK-FLP in the VNC.

We thank the reviewer for this suggestion and have mapped DSK neurons in the VNC as suggested. We found that there was no cell body in the VNC and only some projection from the brain (please see Figure 3—figure supplement 1).

Presentation:

I believe a substantial improvement in the writing style would help readers fully judge and appreciate the findings of this interesting study.

1. In my opinion, the opening paragraph of Introduction is not engaging. Overall, I think the authors could strengthen the Introduction by adding information about the courtship ritual in flies and explaining its relevance for mate selection. Moreover, they could describe how female flies signal sexual receptivity and accept a male for copulation. This would help them highlight the importance of their work and make it more attractive for non-specialist readers.

We thank the reviewer for these valuable suggestions. We have now expanded our introduction as suggested.

2. My impression is that the Results section reads like a long list of results, which are not connected to tell an interesting story. The rationale of many of the experiments are either presented in the Discussion section or not discussed at all. The authors could speculate how DSK neurons/ DSK might work to regulate sexual receptivity to introduce subsequent experiments in the main text. A better description of the results and their potential implications would help the narrative of the study (more details below).

Thanks for the suggestions. In the revised manuscript, we have explained the rationale of each experiment and more accurately described the results.

3. One of the strengths of this study is the arsenal of modern tools used to support the findings. However, many of the methods are not described in the main text. More information would help readers to fully grasp the approaches and findings of this study.

We thank the reviewer for these suggestions. We have made textual change as suggestion.

4. The Discussion section superficially discusses the findings of the study. It rather reads like a recapitulation of the results. The authors could enrich the discussion by speculating how DSK neurons might control female sexual receptivity. Could pC1 neurons (targeted by 71G01-Gal4?) act as a central node for female sexual receptivity, conveying female mating decisions to Dsk neurons? Alternatively, could DSK neurons also integrate sensory information relevant to sexual behavior? Are there any sensory pathways relevant to female sexual receptivity feeding into DSK neurons? What are the potential downstream targets of DSK? What aspects of female sexual behavior are regulated by the DSK pathway? Do females show increased vaginal plate/ partial ovipositor extrusion? How do DSK neurons differ between males and females, and how do these differences may result in different sex-specific behaviors?

We thank the reviewer for these valuable suggestions. We have now expanded our discussion part as suggested.

5. The schematic in Figure 4 A is not clear.

We are sorry that the schematics in Figure 4A which did not clearly present our aim in our electrophysiological experiments, and we have re-organized these schematics and made explained in greater detail in the figure legend (please see Figure 6A).

6. Figure 4. A bigger schematic of the brain depicting the different DSK clusters would help understand which neurons are assessed.

We thank the reviewer for this suggestion and have enlarged the brain.

7. The authors should make the figures accessible to readers with color-blindness.

We thank the reviewer for pointing out this issue and we have adjusted the color in the revised manuscript.

8. I suggest the authors proofread the manuscript, as there are typos, grammatical mistakes and unclear sentences throughout the manuscript. Some examples:

Line 46 – 'is' should be changed to 'are'.

Corrected.

Line 87 – This sentence contains grammatical mistakes.

We have rewritten the sentence “Two parameters including copulation rate and latency were used to characterize receptivity”.

Line 93 – RNAi-mediated females: this should be better defined.

We have changed “RNAi-mediated females” to “we knocked down the expression of Dsk using RNA interference (RNAi)…”.

Line 109 – 'Indicated' should be changed to 'indicate'.

Corrected.

Line 104 – Figure is wrongly cited. It should be Figure 1I.

Corrected.

Line 112 – 'were' should be changed to 'are'.

Corrected.

Line 132 – 'expressed' should be changed to 'are present'.

Corrected.

Line 134 -Fix this sentence 'Given that, we hypothesized whether DSK'.

We have rewritten the sentence “Thus, we asked whether DSK neurons would interact with R71G01-GAL4 neurons to control female sexual behavior.”

Line 139 – Change 'recombinant' to 'reconstituted'.

Corrected.

Line 157 -The sentence does not make sense.

Removed.

Line 169 – Unclear sentence.

We have rewritten the sentence “To investigate whether one or both of the types are involved in regulating female sexual behavior…”.

Line 188 – It should be-'wanted' not 'want'.

Corrected.

Line 270 – The sentence should be rewritten: In this study, DSK neurons also modulate female sexual behavior.

We have removed this sentence.

Line 488 – Fix this sentence 'RCR analysis from genomic DNA samples'.

We have rewritten the sentence “…PCR analysis at the deletion locus on genomic DNA samples of ΔDsk/ΔDsk, +/ΔDsk, +/+”.

Line 502 – Fix this sentence: 'And there are same numbers in two parameters'.

This sentence has been removed and the number of female flies paired with wide-type males is shown in figures.

'Latency' should be described as' latency to copulation'.

We have replaced ‘Latency’ with ‘latency to copulation’ in the revised manuscript throughout.

Figure 1.Suppl 5 – fix the typo in the title.

The authors should better articulate the rationale of the experiments and explain the techniques so readers can better appreciate the findings. For example:

Line 86 – 'behavior, we first constructed knock out line for Dsk'. Describe how the knock out line for DsK was made.

We thank the reviewer for suggestion and we have changed the description of this line used in this study and also briefly explained their generation as following: “.. Dsk mutant (∆Dsk), which was generated previously (Wu et al., 2020). In brief, the 5’-UTR and coding region were deleted by the CRISPR-Cas9 system”.

Line 94 – Explain the rationale for looking at male courtship behavior.

We have rewritten this part as following: “To investigate whether reduced copulation rate in ∆Dsk females is due to potential abatement of female sexual appeal, we examined courtship levels in wild-type males paired with ∆Dsk or control females and observed similarly high levels of courtship in all cases …”.

Line 96 – Explain the rationale for looking at egg laying.

We have rewritten this part as following: “As recently mated females may reduce receptivity and increase egg-laying, we asked whether the decreased receptivity could be a post-mating response and correlate with elevated egg-laying. To address this, we examined the number of eggs laid by virgin females with Dsk mutant or knockdown….”.

Line 97 – Explain the rationale of looking at TRIC signal changes. The authors should also explain how this technique works and provide more details on the findings.

We have rewritten this part as following: “To investigate whether DSK neurons respond to mating status, we measured the activity of these neurons using the transcriptional reporter of intracellular Ca2+ (TRIC) in virgin and mated females. TRIC is designed to quantitatively monitor the change of neural activity by the reconstituted of a functional transcription factor in the presence of Ca2+ (Gao et al., 2015). As above mentioned, four pairs of neurons were labeled by DskGAL4 driving the expression of UAS-mCD8::GFP (Figure 1—figure supplement 3B). However, we only observed TRIC signals in four neurons in the middle area of female brains (Figure 1—figure supplement 6B,C). Quantification of these TRIC signals showed no significant difference in virgin and mated females (Figure 1—figure supplement 6D). These results further indicate that DSK neurons do not respond to mating status.”. we also provided more details in the corresponding figures and figure legends.

The authors should clearly define if any of the tools used in this study were previously generated.

We thank the reviewer for this suggestion. Indeed, a few reagents were generated in our previous eLife paper (Wu et al., 2020). In the revised manuscript, we clearly indicated whether the genetic reagent was generated in this study or a previous study.

Line 102 – Define the DsK Gal4 used in Figure 1I. Is it the same line used in subsequent Figures?

Yes, the Dsk-GAL4 line used in Figure 1I is the same as the line used in the subsequent Figures. And we changed the text in the revised manuscript.

Line 109 – The conclusion should also state that the evidence points to a role of DSK neurons in female sexual receptivity.

We thank the reviewer for this suggestion and have rewritten the sentence “Taken together, these results indicated the function of Dsk is crucial for female sexual receptivity, which also suggested DSK neurons play a role in female sexual receptivity”.

Line 119 – Explain what's the rationale for looking at very young females. State their age and differences with previous virgin females tested in other experiments.

We have rewritten this part as following: “Female receptivity depends on the female’s sexual maturity and mating status. Very young virgins display low receptivity level to courting males and mated females become temporarily unreceptive to courting males (Dickson, 2008; Rezaval et al., 2012). We tested whether activation of DSK neurons could also promote female sexual receptivity in very young virgins or mated females…”.

Line 133 – More information about 71G01-Gal4, and the fact that it might intersect pC1 neurons, would help explain the rationale behind testing these neurons.

We thank the reviewer for this suggestion and have re-stated this part as suggested. “In males, R71G01-GAL4 drives the expression of P1 neurons that interact with DSK neurons to regulate male courtship (Wu et al., 2019) and aggression (Wu et al., 2020). Previous studies employed the intersection of R71G01-LexA with dsxGAL4 to specifically label and manipulate pC1 neurons, which integrate male courtship and pheromone cues to promote virgin female receptivity (Zhou et al., 2014). We found that activation of R71G01-GAL4 neurons consisting of pC1 and a few other neurons promoted female receptivity (Figure 5—figure supplement 1), similarly as previously activating pC1 neurons using the intersectional strategy (Zhou et al., 2014)…”.

Line 157 – Here it is important to explain how many DSK neurons are present in the brain, and how they are distributed in different clusters (by including images of the nervous system).

We thank the reviewer for this suggestion and we have added this information as suggested in the revised manuscript as following: “Analyses of the expression pattern of DskGAL4 revealed that four pairs of neurons were specifically labeled in the brain, which were classified into two types (two pairs of MP1 and two pairs of MP3) based on the location of cell bodies (Nichols and Lim, 1996) (Figure 1—figure supplement 3D), and the two pairs of MP1 neurons were further classified into MP1a and MP1b based on the single cell morphology of these neurons (Wu et al., 2019)”.

Line 175 – The authors identify two Gal4 lines (GluRIAGAL4 and TβHGAL4) that help them intersect different DSK neurons but these lines are not described. The authors should explain what neurons are targeted by these drivers (e.g., glutamatergic, octopaminergic, etc). This information could be useful to interpret and discuss their findings (e.g., relevant DSK neurons might be excitatory).

We thank the reviewer for this suggestion and have made textual changes as following: “Interestingly, we found that intersection of GluRIAGAL4, which targets Glutamate receptor IA (GluRIA) cells, with DskFlp specifically labeled DSK-MP1 neurons (Figure 3A), while intersection of TβHGAL4, which targets octopaminergic neurons, with DskFlp specifically labeled DSK-MP3 neurons (Figure 3B)”.

Line 164 – Explain how the P2X2 optogenetic approach works.

We think that this is a misunderstanding for our electrophysiological recording experiments and may be due to unclear schematics. Indeed, we activated R71G01-GAL4 neurons through ATP activation of ATP-gated P2X2 channel and recorded the electrical responses in DSK-MP1 neurons and DSK-MP3 neurons. In addition, we have re-organized our schematics and added explanation in the figure legend in the revised manuscript.

Line 191 – 'We constructed knock out lines for these two receptors (Figure 6A-C) (Wu et al., 2020)'. Clearly state if these are novel tools created for this study.

We thank the reviewer for suggestion and have changed the description of these lines used in this study and explained their generation as following: “…CCKLR-17D3 mutant female, which was also generated previously (Wu et al., 2020). In brief, the last four exons were deleted by the CRISPR-Cas9 system ….”.

https://doi.org/10.7554/eLife.76025.sa2

Article and author information

Author details

  1. Tao Wang

    1. School of Life Sciences, University of Science and Technology of China, Hefei, China
    2. State Key Laboratory of Integrated Management of Pest Insects and Rodents Institute of Zoology, Chinese Academy of Sciences, Beijing, China
    3. University of Chinese Academy of Sciences, Beijing, China
    Contribution
    Data curation, Formal analysis, Methodology, Resources, Writing – original draft
    Contributed equally with
    Biyang Jing
    Competing interests
    No competing interests declared

  2. Biyang Jing

    State Key Laboratory of Membrane Biology, College of Life Sciences, IDG/McGovern Institute for Brain Research, Peking-Tsinghua Center for Life Sciences, Academy for Advanced Interdisciplinary Studies, Center for Quantitative Biology, Academy for Advanced Interdisciplinary Studies, Peking University, Beijing, China
    Contribution
    Formal analysis, Methodology, Software
    Contributed equally with
    Tao Wang
    Competing interests
    No competing interests declared

  3. Bowen Deng

    Chinese Institute for Brain Research, Peking-Tsinghua Center for Life Sciences, Zhongguangcun Life Sciences Park, Beijing, China
    Contribution
    Formal analysis, Investigation, Methodology
    Competing interests
    No competing interests declared

  4. Kai Shi

    State Key Laboratory of Integrated Management of Pest Insects and Rodents Institute of Zoology, Chinese Academy of Sciences, Beijing, China
    Contribution
    Software
    Competing interests
    No competing interests declared

  5. Jing Li

    Institute of Molecular Physiology, Shenzhen Bay Laboratory, Shenzhen, China
    Contribution
    Data curation, Software
    Competing interests
    No competing interests declared

  6. Baoxu Ma

    State Key Laboratory of Integrated Management of Pest Insects and Rodents Institute of Zoology, Chinese Academy of Sciences, Beijing, China
    Contribution
    Data curation
    Competing interests
    No competing interests declared

  7. Fengming Wu

    State Key Laboratory of Integrated Management of Pest Insects and Rodents Institute of Zoology, Chinese Academy of Sciences, Beijing, China
    Contribution
    Formal analysis, Methodology, Writing – review and editing
    For correspondence
    wufengming@ioz.ac.cn
    Competing interests
    No competing interests declared

  8. Chuan Zhou

    1. State Key Laboratory of Integrated Management of Pest Insects and Rodents Institute of Zoology, Chinese Academy of Sciences, Beijing, China
    2. University of Chinese Academy of Sciences, Beijing, China
    3. Institute of Molecular Physiology, Shenzhen Bay Laboratory, Shenzhen, China
    Contribution
    Conceptualization, Funding acquisition, Project administration, Supervision, Writing – review and editing
    For correspondence
    zhouchuan@ioz.ac.cn
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-7952-7048

Funding

National Natural Science Foundation of China (Y711241133)

  • Chuan Zhou

Chinese Academy of Sciences (Y929731103)

  • Chuan Zhou

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank Yi Rao (Peking University), Yi Zhong (Tsinghua University), Cahir O’Kane (University of Cambridge), and Paul Garrity (Brandeis University) for providing fly lines. We thank Pengxiang Wu (Chinese Academy of Sciences), Yufeng Pan (Southeast University), Yinxue Wang (Max Planck Florida Institute for Neuroscience), and Yu Mu (Institute of neuroscience) for comments on the manuscript. This work is supported by grants to Chuan Zhou from National Natural Science Foundation of China (NO.Y711241133) and Strategic Priority Research Program of the Chinese Academy of Science (NO.Y929731103) and State Key Laboratory of Integrated Management of Pest Insects and Rodents, IOZ, CAS (NO.Y652751E03).

Senior Editor

  1. K VijayRaghavan, National Centre for Biological Sciences, Tata Institute of Fundamental Research, India

Reviewing Editor

  1. Sonia Sen, Tata Institute for Genetics and Society, India

Reviewer

  1. Sonia Sen, Tata Institute for Genetics and Society, India

Version history

  1. Received: December 1, 2021
  2. Preprint posted: December 9, 2021 (view preprint)
  3. Accepted: April 12, 2022
  4. Version of Record published: April 27, 2022 (version 1)

Copyright

© 2022, Wang et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 1,201
    Page views
  • 206
    Downloads
  • 2
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Tao Wang
  2. Biyang Jing
  3. Bowen Deng
  4. Kai Shi
  5. Jing Li
  6. Baoxu Ma
  7. Fengming Wu
  8. Chuan Zhou
(2022)
Drosulfakinin signaling modulates female sexual receptivity in Drosophila
eLife 11:e76025.
https://doi.org/10.7554/eLife.76025

Categories and tags

Research organism

Further reading

    1. Neuroscience

    ACC neural ensemble dynamics are structured by strategy prevalence

    Mikhail Proskurin, Maxim Manakov, Alla Karpova
    Research Article Updated

    Medial frontal cortical areas are thought to play a critical role in the brain’s ability to flexibly deploy strategies that are effective in complex settings, yet the underlying circuit computations remain unclear. Here, by examining neural ensemble activity in male rats that sample different strategies in a self-guided search for latent task structure, we observe robust tracking during strategy execution of a summary statistic for that strategy in recent behavioral history by the anterior cingulate cortex (ACC), especially by an area homologous to primate area 32D. Using the simplest summary statistic – strategy prevalence in the last 20 choices – we find that its encoding in the ACC during strategy execution is wide-scale, independent of reward delivery, and persists through a substantial ensemble reorganization that accompanies changes in global context. We further demonstrate that the tracking of reward by the ACC ensemble is also strategy-specific, but that reward prevalence is insufficient to explain the observed activity modulation during strategy execution. Our findings argue that ACC ensemble dynamics is structured by a summary statistic of recent behavioral choices, raising the possibility that ACC plays a role in estimating – through statistical learning – which actions promote the occurrence of events in the environment.

    1. Neuroscience

    Postsynaptic mitochondria are positioned to support functional diversity of dendritic spines

    Connon I Thomas, Melissa A Ryan ... Benjamin Scholl
    Research Article

    Postsynaptic mitochondria are critical for the development, plasticity, and maintenance of synaptic inputs. However, their relationship to synaptic structure and functional activity is unknown. We examined a correlative dataset from ferret visual cortex with in vivo two-photon calcium imaging of dendritic spines during visual stimulation and electron microscopy reconstructions of spine ultrastructure, investigating mitochondrial abundance near functionally and structurally characterized spines. Surprisingly, we found no correlation to structural measures of synaptic strength. Instead, we found that mitochondria are positioned near spines with orientation preferences that are dissimilar to the somatic preference. Additionally, we found that mitochondria are positioned near groups of spines with heterogeneous orientation preferences. For a subset of spines with a mitochondrion in the head or neck, synapses were larger and exhibited greater selectivity to visual stimuli than those without a mitochondrion. Our data suggest mitochondria are not necessarily positioned to support the energy needs of strong spines, but rather support the structurally and functionally diverse inputs innervating the basal dendrites of cortical neurons.

    1. Neuroscience

    Multiple NTS neuron populations cumulatively suppress food intake

    Weiwei Qui, Chelsea R Hutch ... Darleen Sandoval
    Research Article

    Several discrete groups of feeding-regulated neurons in the nucleus of the solitary tract (nucleus tractus solitarius; NTS) suppress food intake, including avoidance-promoting neurons that express Cck (NTSCck cells) and distinct Lepr- and Calcr-expressing neurons (NTSLepr and NTSCalcr cells, respectively) that suppress food intake without promoting avoidance. To test potential synergies among these cell groups we manipulated multiple NTS cell populations simultaneously. We found that activating multiple sets of NTS neurons (e.g., NTSLepr plus NTSCalcr (NTSLC), or NTSLC plus NTSCck (NTSLCK)) suppressed feeding more robustly than activating single populations. While activating groups of cells that include NTSCck neurons promoted conditioned taste avoidance (CTA), NTSLC activation produced no CTA despite abrogating feeding. Thus, the ability to promote CTA formation represents a dominant effect but activating multiple non-aversive populations augments the suppression of food intake without provoking avoidance. Furthermore, silencing multiple NTS neuron groups augmented food intake and body weight to a greater extent than silencing single populations, consistent with the notion that each of these NTS neuron populations plays crucial and cumulative roles in the control of energy balance. We found that silencing NTSLCK neurons failed to blunt the weight-loss response to vertical sleeve gastrectomy (VSG) and that feeding activated many non-NTSLCK neurons, however, suggesting that as-yet undefined NTS cell types must make additional contributions to the restraint of feeding.