HIF-1α induces glycolytic reprograming in tissue-resident alveolar macrophages to promote cell survival during acute lung injury
- Department of Medicine, Section of Pulmonary and Critical Care Medicine, The University of Chicago, United States
- Department of Medicine, Section of Emergency Medicine, The University of Chicago, United States
Figures
Figure 1 with 2 supplements
Tissue-resident alveolar macrophages (TR-AMs) exhibit hypoxia-inducible factor 1-alpha (HIF-1α) stabilization and develop a glycolytic phenotype in response to hypoxia, while bone marrow-derived macrophages (BMDMs) have limited metabolic adaptation to hypoxia.
TR-AMs (A–E) and BMDMs (F–J) were incubated overnight (16 hr) at varying O2 concentrations. (A) Using Seahorse XF24 analyzer, glycolysis was measured as extracellular acidification rate (ECAR). …
-
Figure 1—source data 1
The effect of different O2 concentrations on hypoxia-inducible factor 1-alpha HIF-1α expression in tissue-resident alveolar macrophages (TR-AMs).
Uncropped Western blot images of HIF-1α protein expression in TR-AMs under different concentrations of oxygen.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-data1-v2.zip
-
Figure 1—source data 2
The effect of echinomycin on glycolytic enzyme protein expression in tissue-resident alveolar macrophages (TR-AMs).
Uncropped Western blot images of HK2, LDHA, and α-tubulin in TR-AMs treated with echinomycin under normoxia or hypoxia.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-data2-v2.zip
-
Figure 1—source data 3
The effect of different O2 concentrations on hypoxia-inducible factor 1-alpha (HIF-1α) expression in bone marrow-derived macrophages (BMDMs).
Uncropped Western blot images of HIF-1α protein expression in BMDMs under different concentrations of oxygen.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-data3-v2.zip
-
Figure 1—source data 4
The effect of echinomycin on glycolytic enzyme protein expression in bone marrow-derived macrophages (BMDMs).
Uncropped Western blot images of HK2, LDHA, and α-tubulin in BMDMs treated with echinomycin under normoxia or hypoxia.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-data4-v2.zip
Figure 1—figure supplement 1
Knockdown of Hif1a diminishes hypoxia-induced glycolytic phenotype in tissue-resident alveolar macrophages (TR-AMs).
TR-AMs (A–C) and bone marrow-derived macrophages (BMDMs) (D–F) were transfected with Hif1a or control siRNA and subsequently incubated overnight (16 hr) at 21 or 1.5% O2.
Western blot analysis of nuclear extracts to assess successful Hif1a knockdown in (A) TR-AMs and (D) BMDMs under 1.5% O2. Western blot analysis of whole-cell extracts from (B) TR-AMs and (E) BMDMs. Extracellular lactate levels in (C) TR-AMs and (F) BMDMs incubated overnight (16 hr) at 21 or 1.5% O2. Significance was determined by two-way ANOVA with Bonferroni correction. All error bars denote mean ± SD. *p<0.05.
-
Figure 1—figure supplement 1—source data 1
Validation of Hif1a siRNA knockdown in tissue-resident alveolar macrophages (TR-AMs).
Uncropped Western blot images of hypoxia-inducible factor 1-alpha (HIF-1α) protein expression in TR-AMs treated with either control siRNA or two different Hif1a siRNAs.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-figsupp1-data1-v2.zip
-
Figure 1—figure supplement 1—source data 2
The effect of Hif1a siRNA knockdown on glycolytic enzyme protein expression in tissue-resident alveolar macrophages (TR-AMs) under normoxia and hypoxia.
Uncropped Western blot images of HK2, LDHA, and α-tubulin expression in TR-AMs treated with either control siRNA or two different Hif1a siRNAs under normoxia or hypoxia.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-figsupp1-data2-v2.zip
-
Figure 1—figure supplement 1—source data 3
Validation of Hif1a siRNA knockdown in bone marrow-derived macrophages (BMDMs).
Uncropped Western blot images of hypoxia-inducible factor 1-alpha (HIF-1α) protein expression in BMDMs treated with either control siRNA or two different Hif1a siRNAs.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-figsupp1-data3-v2.zip
-
Figure 1—figure supplement 1—source data 4
The effect of Hif1a siRNA knockdown on glycolytic enzyme protein expression in bone marrow-derived macrophages (BMDMs) under normoxia and hypoxia.
Uncropped Western blot images of HK2, LDHA, and α-tubulin expression in BMDMs treated with either control siRNA or two different Hif1a siRNAs under normoxia or hypoxia.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-figsupp1-data4-v2.zip
Figure 1—figure supplement 2
Prolonged but not short-term hypoxia induces glycolysis in tissue-resident alveolar macrophages (TR-AMs).
TR-AMs (A–C) or bone marrow-derived macrophages (BMDMs) (D–F) were incubated for 2 hr or overnight (16 hr) at 1.5% O2. (A) Western blot analysis of TR-AM (A) and BMDM (D) nuclear extracts to assess …
-
Figure 1—figure supplement 2—source data 1
Expression of hypoxia-inducible factor 1-alpha (HIF-1α) protein in tissue-resident alveolar macrophages (TR-AMs) at different time points following exposure to hypoxia.
Uncropped Western blot images of HIF-1α protein expression in TR-AMs treated with hypoxia for 0, 2, or 16 hr or with DMOG.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-figsupp2-data1-v2.zip
-
Figure 1—figure supplement 2—source data 2
Expression of hypoxia-inducible factor 1-alpha (HIF-1α) protein in bone marrow-derived macrophages (BMDMs) at different time points following exposure to hypoxia.
Uncropped Western blot images of HIF-1α protein expression in BMDMs treated with hypoxia for 0, 2, or 16 hr or with DMOG.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig1-figsupp2-data2-v2.zip
Figure 2
The hypoxia-induced transcriptomic response differs substantially between tissue-resident alveolar macrophages (TR-AMs) and bone marrow-derived macrophages (BMDMs).
TR-AMs and BMDMs were incubated overnight (16 hr) under normoxia (21.0% O2) or hypoxia (1.5% O2). (A) Venn diagrams show differentially expressed genes (DEGs) altered by hypoxia in TR-AMs (741 total …
-
Figure 2—source data 1
Read count data for hypoxia-regulated genes in tissue-resident alveolar macrophages (TR-AMs) and bone marrow-derived macrophages (BMDMs).
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig2-data1-v2.xlsx
-
Figure 2—source data 2
Differences in hypoxia-inducible factor 1-alpha (HIF-1α) expression between tissue-resident alveolar macrophages (TR-AMs) and bone marrow-derived macrophages (BMDMs) under normoxia and hypoxia.
Uncropped Western blot images of HIF-1α expression in TR-AMs and BMDMs treated with normoxia or hypoxia.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig2-data2-v2.zip
-
Figure 2—source data 3
Differences in glycolytic enzyme and prolyl hydroxylase protein expression between tissue-resident alveolar macrophages (TR-AMs) and bone marrow-derived macrophages (BMDMs) under normoxia and hypoxia.
Uncropped Western blot images of HK2, LDHA, PHD2, PHD3, and α-tubulin expression in TR-AMs and BMDMs treated with normoxia or hypoxia.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig2-data3-v2.zip
Figure 3 with 2 supplements
Hypoxia modulates tissue-resident alveolar macrophage (TR-AM) cytokine production and metabolic response to lipopolysaccharide (LPS).
TR-AMs were incubated overnight (16 hr) under 21 or 1.5% O2, then stimulated with 20 ng/ml LPS for 6 hr while maintaining pretreatment conditions. For IL-1β measurements, 5 mM ATP was added to …
-
Figure 3—source data 1
Changes in lipopolysaccharide (LPS)-induced expression of proIL-1β protein in tissue-resident alveolar macrophages (TR-AMs) under normoxia and hypoxia.
Uncropped Western blot images of proIL-1β protein in TR-AMs treated with LPS for 6 or 24 hr under normoxia or hypoxia.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig3-data1-v2.zip
Figure 3—figure supplement 1
Hypoxia alters cytokine production in bone marrow-derived macrophages (BMDMs).
BMDMs were incubated overnight (16 hr) under normoxia or 1.5% O2, then stimulated with lipopolysaccharide (LPS) (20 ng/ml) for 6 hr while maintaining pretreatment conditions. For IL-1β, 5 mM ATP was …
Figure 3—figure supplement 2
Lipopolysaccharide (LPS) induces an immediate increase in glycolysis in bone marrow-derived macrophages (BMDMs).
Extracellular acidification rate (ECAR) was measured in normoxic BMDMs following acute LPS injection (final concentration: 20 ng/ml).
Figure 4 with 1 supplement
Hypoxia rescues ETC inhibitor-induced cell death and impaired cytokine production in tissue-resident alveolar macrophages (TR-AMs).
(A) Mitochondrial stress test to measure oxygen consumption rate (OCR) using Seahorse XF24 in TR-AMs, which were treated sequentially with oligomycin (ATP synthase inhibitor), FCCP (uncoupler), and …
Figure 4—figure supplement 1
The effect of hypoxia on bone marrow-derived macrophage (BMDM) mitochondrial function, cytokine production, and cell viability under ETC inhibition.
(A) Mitochondrial stress test to measure oxygen consumption rate (OCR) using Seahorse XF24 in BMDMs. (B) Interleaved scatter plots quantifying mitochondrial respiration parameters. Data represents …
Figure 5
Tissue-resident alveolar macrophage (TR-AM) survival correlates with a shift to glycolytic metabolism during influenza-induced acute lung injury.
(A) FACS plots of bronchoalveolar lavage fluid (BALF) samples collected from C57BL/6 mice infected with PR8 (100 PFU) at baseline (D0), 3 days (D3), and 6 days (D6) post infection. First, debris, …
-
Figure 5—source data 1
Read counts data for genes of oxidative phosphorylation in tissue-resident alveolar macrophages (TR-AMs) and monocyte-derived alveolar macrophages (Mo-AMs).
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig5-data1-v2.csv
-
Figure 5—source data 2
Read counts data for genes of glycolysis in tissue-resident alveolar macrophages (TR-AMs) and monocyte-derived alveolar macrophages (Mo-AMs).
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig5-data2-v2.csv
Figure 6
Non-hypoxic stabilization of hypoxia-inducible factor 1-alpha (HIF-1α) induces glycolysis and rescues ETC inhibitor-induced reduction in cytokine production and cell death in tissue-resident alveolar macrophages (TR-AMs).
TR-AMs were treated (16 hr) overnight ±FG-4592 (25.0 μM when not stated otherwise). (A) Glycolysis was measured as extracellular acidification rate (ECAR). (B) Quantification of glycolytic …
-
Figure 6—source data 1
The effect of FG-4592 on hypoxia-inducible factor 1-alpha (HIF-1α) expression in tissue-resident alveolar macrophages (TR-AMs).
Uncropped Western blot images of HIF-1α in TR-AMs treated with FG-4592 or control vehicle.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig6-data1-v2.zip
-
Figure 6—source data 2
The effect of FG-4592 on glycolytic enzyme and prolyl hydroxylase protein expression in tissue-resident alveolar macrophages (TR-AMs).
Uncropped Western blot images of HK2, LDHA, PHD2, PHD3, and α-tubulin in TR-AMs treated with FG-4592 or control vehicle.
- https://cdn.elifesciences.org/articles/77457/elife-77457-fig6-data2-v2.zip
Figure 7
Non-hypoxic stabilization of hypoxia-inducible factor 1-alpha (HIF-1α) increases tissue-resident alveolar macrophage (TR-AM) survival and improves outcomes in influenza-induced acute lung injury.
We intratracheally infected C57BL/6 mice with PR8 (100 PFU) and collected bronchoalveolar lavage fluid (BALF) on day 0 (D0) (uninfected) and day 6 (D6) post infection. Mice also received either the …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Mus musculus) | C57BL/6J | Jackson Laboratory | Stock no. 000664 | 6–8 weeks |
| Strain, strain background (influenza A virus) | A/PR8/34 (H1N1) | BEI Resources, NIAID, NIH | NR-348 | |
| Antibody | Anti-HK2 (rabbit monoclonal) | Cell Signaling Technology | Cat# C64G5 | WB (1:1000) |
| Antibody | Anti-LDHA (rabbit polyclonal) | Cell Signaling Technology | Cat# 2012S | WB (1:1000) |
| Antibody | Anti-PHD2/EGLN1 (rabbit monoclonal) | Cell Signaling Technology | Cat# 4835 | WB (1:1000) |
| Antibody | Anti- PHD3/EGLN3 (rabbit polyclonal) | Novus Biologicals | Cat# NB100-303 | WB (1:1000) |
| Antibody | Anti-IL-1β (mouse monoclonal) | Cell Signaling Technology | Cat# 12242 | WB (1:1000) |
| Antibody | Anti-Lamin B1 (rabbit polyclonal) | ProteinTech | Cat# 12987-1-AP | WB (1:1000) |
| Antibody | Anti-HIF-1α (rabbit polyclonal) | Cayman Chemical | Cat# 10006421 | WB (1:500) |
| Antibody | Anti-α-Tubulin (mouse monoclonal) | Sigma | Cat# T6074 | WB (1:20,000) |
| Antibody | Anti-rabbit IgG, HRP-linked Antibody (goat polyclonal) | Cell Signaling Technology | Cat# 7074 | WB (1:2500) |
| Antibody | Anti-mouse IgG, HRP-linked Antibody (horse polyclonal) | Cell Signaling Technology | Cat# 7076 | WB (1:2500) |
| Antibody | CD16/CD32 (FcBlock) (rat monoclonal) | BD Biosciences | Clone 2.4G2; Cat# 553141 | Flow cytometry (1:50) |
| Antibody | Alexa Fluor 700 anti-mouse Ly-6G (rat monoclonal) | BioLegend | Clone 1A8; Cat# 553141 | Flow cytometry (1:250) |
| Chemical compound, drug | FG-4592 (roxadustat) | Cayman Chemical | Cat# 15294 | |
| Chemical compound, drug | Recombinant mouse M-CSF | BioLegend | 576406 | |
| Chemical compound, drug | Oligomycin | Fisher Scientific | 49-545-510MG | |
| Chemical compound, drug | FCCP | MilliporeSigma | C2920 | |
| Chemical compound, drug | Antimycin A | MilliporeSigma | A8674 | |
| Chemical compound, drug | Rotenone | MilliporeSigma | R8875 | |
| Chemical compound, drug | Lipopolysaccharide | Santa Cruz | sc-3535 | |
| Commercial assay or kit | Mouse IL-6 DuoSet ELISA | R&D Systems | DY406 | |
| Commercial assay or kit | Mouse TNF-α DuoSet ELISA | R&D Systems | DY410 | |
| Commercial assay or kit | Mouse KC DuoSet ELISA | R&D Systems | DY453 | |
| Commercial assay or kit | Mouse CCL2 DuoSet ELISA | R&D Systems | DY479 | |
| Commercial assay or kit | Mouse IL-1β alpha DuoSet ELISA | R&D Systems | DY401 | |
| Commercial assay or kit | Lactate Assay Kit | MilliporeSigma | MAK064-1KT | |
| Commercial assay or kit | Mouse Macrophage Nucleofector Kit | Lonza | VPA-1009 | |
| Commercial assay or kit | Seahorse XFe24 FluxPak | Agilent | 102340-100 | |
| Commercial assay or kit | NE-PER Nuclear and Cytoplasmic Extraction Reagents | Thermo Fisher | Cat# 78833 | |
| Other | PKH26 Cell Linker Dye for Phagocytic Cell Labeling | MilliporeSigma | Cat# PKH26PCL-1KT | Dye to distinguish between TR-AMs and Mo-AMs |
| Other | SYTOX Green Nucleic Acid Stain | Thermo Fisher | Cat# S7020 | Stain to distinguish between live and dead cells. |
| Sequence-based reagent | Rpl19_F | This paper | PCR primers | CCGACGAAAGGGTATGCTCA |
| Sequence-based reagent | Rpl19_R | This paper | PCR primers | GACCTTCTTTTTCCCGCAGC |
| Sequence-based reagent | Il6_F | This paper | PCR primers | TTCCATCCAGTT GCCTTCTTGG |
| Sequence-based reagent | Il6_R | This paper | PCR primers | TTCCTATTTCCA CGATTTCCCAG |
| Sequence-based reagent | Tnfa_F | This paper | PCR primers | AGGGGATTAT GGCTCAGGGT |
| Sequence-based reagent | Tnfa_R | This paper | PCR primers | CCACAGTCCAGGTCACTGTC |
| Sequence-based reagent | Il1b_F | This paper | PCR primers | GCCACCTTTT GACAGTGATGAG |
| Sequence-based reagent | Il1b_R | This paper | PCR primers | GACAGCCCA GGTCAAAGGTT |
| Sequence-based reagent | Kc_F | This paper | PCR primers | AGACCATGGC TGGGATTCAC |
| Sequence-based reagent | Kc_R | This paper | PCR primers | ATGGTGGCTATGACTTCGGT |
| Sequence-based reagent | Ccl2_F | This paper | PCR primers | CTGTAGTTTTT GTCACCAAGCTCA |
| Sequence-based reagent | Ccl2_R | This paper | PCR primers | GTGCTGAAGA CCTTAGCCCA |
| Sequence-based reagent | Non-targeting (control) siRNA | Dharmacon | D-001810-01 | |
| Sequence-based reagent | Hif1a #1; J-040638-06 | Dharmacon | J-040638-06 | |
| Sequence-based reagent | Hif1a #2; J-040638-07 | Dharmacon | J-040638-07 | |
| Software, algorithm | FastQC | Babraham Institute | RRID:SCR_014583 | |
| Software, algorithm | STAR | PMID:23104886 | RRID:SCR_015899 | |
| Software, algorithm | DESeq2 | Bioconductor | RRID:SCR_015687 | |
| Software, algorithm | Reactome Cytoscape Plugin | PMID:14597658 | RRID:SCR_003032 | |
| Software, algorithm | Prism 9 | GraphPad | RRID:SCR_002798 |
