Process- and product-related impurities in the ChAdOx1 nCov-19 vaccine
- Department of Gene Therapy, University of Ulm, Germany
- Core Unit Mass Spectrometry and Proteomics, University of Ulm, Germany
Figures
Figure 1
Protein staining of HAdV-C5-EGFP and three ChAdOx1 nCoV-19 vaccine lots.
3 × 109 adenoviral vector particles were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) under denaturing and reducing conditions. Proteins were visualized by …
-
Figure 1—source data 1
Original file of the full raw unedited gel: Protein staining of HAdV-C5-EGFP and three ChAdOx1 nCov-19 vaccine lots.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig1-data1-v2.pdf
-
Figure 1—source data 2
Uncropped gel with the relevant bands labeled: Protein staining of HAdV-C5-EGFP and three ChAdOx1 nCov-19 vaccine lots.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig1-data2-v2.pdf
Figure 2 with 2 supplements
Distribution of proteins in three ChAdOx1 nCov-19 vaccine lots.
The protein composition of three lots of ChAdOx1 (ABV4678, ABV5811, and ABV7764) was analyzed by mass spectrometry following in-solution protein digest. Spectral data were aligned via search engine …
-
Figure 2—source data 1
List of proteins detected in three ChAdOx1 nCov-19 vaccine lots by mass spectrometry.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
Distribution of proteins of the ChAdOx1 nCov-19 vaccine following PAGE and in-gel digests.
The protein composition of lot ABV5811 was analyzed by mass spectrometry following in-gel protein digests. Spectral data were aligned via search engine with human and viral databases. Percentage of …
Figure 2—figure supplement 2
Intensity distribution of the top 20 proteins in ChAdOx1 nCov-19 vaccine lots.
The protein composition of ChAdOx1 nCov-19 vaccine lots was analyzed by mass spectrometry following in-solution protein digest. Spectral data were aligned via search engine with human and viral …
Figure 3 with 2 supplements
Comparison of Ad26.COV2.S and ChAdOx1 nCov-19 vaccines by biochemical and proteomic analysis.
(A) Proteins corresponding to each 3 × 109 vector particles of three lots of Ad26.COV2.S (21C10-01, XD955, and XE395), one lot of ChAdOx1 (ABV9317) and CsCl-purified HAdV-C5-EGFP (control), as …
-
Figure 3—source data 1
List of proteins detected by mass spectrometry in three Ad26.COV2.S vaccine lots, ChAdOx1 nCov-19 vaccine lot ABV9317, and HAdV-C5-EGFP.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Original file of the full raw unedited gel: Comparison of Ad26.COV2.S and ChAdOx1 nCov-19 vaccines.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig3-data2-v2.pdf
-
Figure 3—source data 3
Uncropped gel with the relevant bands labeled: Protein staining of HAdV-C5-EGFP, three Johnson&Johnson Ad25-COV2.S vaccine lots and one AstraZeneca ChAdOx1 nCov-19 vaccine lot.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig3-data3-v2.pdf
Figure 3—figure supplement 1
Distribution of proteins of the HAdV-C5-EGFP vector following in-solution protein digest.
HAdV-C5-EGFP was analyzed by mass spectrometry following in-solution protein digest. Spectral data were aligned via search engine with human and viral databases. Percentage of total intensities …
Figure 3—figure supplement 2
Distribution of proteins of the Johnson & Johnson Ad26.COV2.S vaccine lots 21C10-01 and lot XE395 following in-solution protein digest.
Ad26.COV2.S (lot 21C10-01 and lot XE395) were analyzed by mass spectrometry following in-solution protein digest. Spectral data were aligned via search engine with human and viral databases. …
Figure 4 with 1 supplement
Analysis of effects of impurities in the ChAdOx1 nCoV-19 vaccine on anti-Spike immune responses in vivo.
BALB/c mice were injected intramuscularly with phosphate-buffered saline (PBS) or 1 × 109 vector particles of AstraZeneca ChAdOx1 nCoV-19 vaccine (ABV9317) or UUlm ChAdOx1 nCov-19 dissolved in PBS. …
-
Figure 4—source data 1
List of proteins detected by mass spectrometry in UUlm ChAdOx1 nCov-19.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig4-data1-v2.xlsx
-
Figure 4—source data 2
Original file of the full raw unedited gel: Protein staining of ChAdOx1 nCov-19 vaccine lot and UUlm ChAdOx1.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig4-data2-v2.pdf
-
Figure 4—source data 3
Uncropped gel with the relevant bands labeled: Protein staining of ChAdOx1 nCoV-19 vaccine lot and UUlm ChAdOx1.
- https://cdn.elifesciences.org/articles/78513/elife-78513-fig4-data3-v2.pdf
Figure 4—figure supplement 1
Distribution of proteins of the UUlm ChAdOx1 nCov-19 vector following in-solution protein digest.
UUlm ChAdOx1 nCov-19 was analyzed by mass spectrometry following in-solution protein digest. Spectral data were aligned via search engine with human and viral databases. Percentage of total …
Figure 5
Analysis of ATPase activity in the ChAdOx1 nCoV-19 vaccine.
Conversion of ATP into ADP by ATPase activity of ChAdOx1 nCoV-19 vaccine lot ABV9317 was analyzed using a fluorescence-based commercially available ADP2 FI Assay kit, showing increasing fluorescence …
Tables
Table 1
Amount of protein impurities per vaccine dose in the ChAdOx1 nCoV-19 vaccine.
European Medicines Agency (EMA) quality specifications of accepted host cell protein (HCP) amounts in the ChAdOx1 nCoV-19 vaccine and batch-release data by the manufacturer, obtained through the …
| ChAdOx1 nCov-19lot # | EMA specification[µg HCP/dose] | Batch-release data manufacturer[µg HCP/dose] | NanoDrop absorbance 280 nm[µg HCP/dose] | Bradford assay[µg HCP/dose] | ImageJ analysis[µg HCP/dose] |
|---|---|---|---|---|---|
| ABV4678 | ≤0.4 | 0.05 | 39.03 | 12.36 | 9.85 |
| ABV5811 | ≤0.4 | 0.3 | 114.53 | 24.78 | 24.9 |
| ABV7764 | ≤0.4 | 0.0489 | 74.37 | 29.66 | 12.81 |
| ABV9317 | ≤0.4 | n.a. | 154.53 | 42.48 | 73.16 |
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Other | Covid-19 vaccine ChAdOx1 nCov-19 | AstraZeneca, distributed by the Pharmacy of the University Hospital Ulm, Germany | Lot: ABV4678 ABV5811 ABV7764 ABV9317 | Commercial vaccine |
| Other | Covid-19 vaccine Ad26-COV2.S | Johnson & Johnson, distributed by the Pharmacy of the University Hospital Ulm, Germany | Lot: XD955 21C10-01 XE395 | Commercial vaccine |
| Biological sample (Human Adenovirus type 5) | HAdV-C5-EGFP (ΔE1; CMV-eGFP) | GenBank: AY339865.1 (Δ nt 441–3522) | +CMV promoter-controlled eGFP expression cassette | |
| Cell line (Homo sapiens) | N52.E6 | Schiedner et al., 2000, Human Gene Therapy 11, 2105–2116, 2000 | ||
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-3216 | |
| Cell line (Homo sapiens) | CAP-T | Fischer et al., 2012, Biotechnology and bioengineering 109, 2250–2261, 2012 | ||
| Cell line (Rattus norvegicus, Mus musculus) | 2.4G2 | ATCC | HB-197 | Hybridoma cell line, Rattus norvegicus (B-cell), Mus muculus (myeloma) |
| Other | BALB/c mouse | Charles River | Mouse; Mus musculus; Strain code: 028 | 10–12 weeks old; n = 6/group (4× female, 2× male) |
| Peptide, recombinant protein | SARS-CoV-2 spike peptide-loaded dimer | JPT Peptide Technologies GmbH | CoVKd-268 GYLQPRTFL | |
| Recombinant DNA reagent | pBSK-CMV-Spike | This paper | Based on GenBank sequence YP_009724390.1 | CMV promoter-driven SARS-CoV-2 spike protein with some modifications |
| Antibody | Rat anti- murine-INFγ-PE, monoclonal | Invitrogen | 12-7311-82 | IF 1:200 |
| Antibody | Rat anti-murine-CD8-APC, monoclonal | eBioScience | 17-0081-83 | IF 1:200 |
| Antibody | Rabbit anti-mouse IgG, HRP-labeled, polyclonal | Sigma | A9044 | ELISA: 1:10,000 |
| Antibody | Rat/mouse anti-Fc gamma Receptor (FcRII, CD32), monoclonal | Derived from hybridoma 2.4G2 cell line (ATCC HB-197) | Four-day-old cell culture medium, undiluted | |
| Chemical compound, drug | Brefeldin A | eBioScience | 00-4506-51 | |
| Chemical compound, drug | Ni-NTA agarose beads | Qiagen | 30,210 | |
| Sequence-based reagent | Adenoviral E4 forward | GeneArt Sequences | PCR primer | TAGACGATCCCTACTGTACG |
| Sequence-based reagent | Adenoviral E4 reverse | GeneArt Sequences | PCR primer | GGAAATATGACTACGTCCGG |
| Sequence-based reagent | Adenoviral human actin forward | GeneArt Sequences | PCR primer | GCTCCTCCTGAGCGCAAG |
| Sequence-based reagent | Adenoviral human actin reverse | GeneArt Sequences | PCR primer | CATCTGCTGGAAGGTGGACA |
| Sequence-based reagent | Adenoviral human ribosomal protein L4 forward | GeneArt Sequences | PCR primer | ACGATACGCCATCTGTTCTGCC |
| Sequence-based reagent | Adenoviral human ribosomal protein L4 reverse | GeneArt Sequences | PCR primer | GGAGCAAAACAGCTTCCTTGGTC |
| Chemical compound, drug | SYBR Green | Kapa Biosystems | KK4502 | |
| Commercial assay or kit | ADP FI Assay | Bos et al., 2020, Bellbrooks Labs | 3013A | |
| Commercial assay or kit | GenElute Mammalian Genomic DNA Miniprep Kit | Sigma | G1N350 | |
| Commercial assay or kit | VenorGeM Classic | Minerva Biolabs | 11-1025 | |
| Software, algorithm | RStudio | RStudio | Version 4.0.0 | Statistics |
| Software, algorithm | MaxQuant (with Andromeda search engine; UniProt human reference proteome) | Cox and Mann, 2008; Cox et al., 2011, MaxQuant, Andromeda,UniProt | Version 1.6.3.4 | Protein identification Mass Spectrometry |
