Molecular dissection of condensin II-mediated chromosome assembly using in vitro assays
- Chromosome Dynamics Laboratory, RIKEN, Japan
Figures
Figure 1 with 1 supplement
Recombinant condensin II holocomplex can functionally replace endogenous condensin II in Xenopus egg extracts.
(A) A schematic diagram of the condensin II holocomplex that is composed of two structural maintenance of chromosomes (SMC) subunits (SMC2 and SMC4), two HEAT subunits (CAP-D3 and CAP-G2), and a …
-
Figure 1—source data 1
Microsoft excel of non-normalized data corresponding to Figure 1E.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Recombinant condensin II complexes used in the study.
(A) Recombinant condensin II holocomplex (holo[WT]), ΔG2(WT), ΔD3(WT), and ΔD3ΔG2(WT) were purified and subjected to SDS-PAGE. The gel was stained with Coomassie Brilliant Blue (CBB). (B) …
-
Figure 1—figure supplement 1—source data 1
Raw data uncropped gels and blot corresponding to Figure 1—figure supplement 1.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig1-figsupp1-data1-v2.zip
-
Figure 1—figure supplement 1—source data 2
Microsoft excel of DNA constructs used in the study.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig1-figsupp1-data2-v2.zip
Figure 2 with 1 supplement
Chromosome association of condensin II is decreased by CAP-D3 deletion but is increased by CAP-G2 deletion.
(A) (Left) Mouse sperm nuclei were incubated with Δcond I/II extracts that had been supplemented with control buffer (buffer), recombinant condensin II holocomplex (holo[WT]) or its subcomplexes …
-
Figure 2—source data 1
Microsoft excel of non-normalized data corresponding to Figure 2B.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig2-data1-v2.zip
-
Figure 2—source data 2
Microsoft excel of non-normalized data corresponding to Figure 2D.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig2-data2-v2.zip
Figure 2—figure supplement 1
Immunodepletion of endogenous condensin complexes and basic characterization of recombinant condensin II complexes in Xenopus egg extracts.
(A) Xenopus egg extracts were immunodepleted with control IgG (Δmock), antibodies against endogenous condensin I subunit (Δcond I extract), or antibodies against both endogenous condensin I and II …
-
Figure 2—figure supplement 1—source data 1
Raw data uncropped blots corresponding to Figure 2—figure supplement 1A.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig2-figsupp1-data1-v2.zip
Figure 3
The structural maintenance of chromosome (SMC) ATPase cycle is essential for condensin II function.
(A) Mouse sperm nuclei were incubated with Δcond I/II extracts that had been supplemented with condensin II holo(WT) and holo(SMC-TR) at 200 nM, or ΔG2(WT) and ΔG2(SMC-TR) at either 200 nM or 25 nM. …
-
Figure 3—source data 1
Microsoft excel of non-normalized data corresponding to Figure 3B.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig3-data1-v2.zip
-
Figure 3—source data 2
Microsoft excel of data corresponding to Figure 3C and Figure 4—figure supplement 1C.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig3-data2-v2.zip
Figure 4 with 3 supplements
The CAP-D3 C-tail negatively regulates condensin II-mediated chromosome assembly.
(A) A schematic diagram of the full-length hCAP-D3 (D3–FL) and hCAP-D3 lacking the C-terminal tail (D3–dC). (B) Mouse sperm nuclei were incubated in Δcond I/II extracts that had been supplemented …
-
Figure 4—source data 1
Microsoft excel of non-normalized data of all conditions corresponding to Figure 4 and Figure 4—figure supplement 2.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig4-data1-v2.zip
Figure 4—figure supplement 1
Additional characterization of deletion of the CAP-D3 C-tail.
(A) Sequence alignment of the C-tail of the CAP-D3 orthologs from Danio rerio (DrCAP-D3), Xenopus laevis (XCAP-D3), Gallus (GgCAP-D3), Mus musculus (mCAP-D3) and human (hCAP-D3). Note that …
-
Figure 4—figure supplement 1—source data 1
Raw data uncropped blots corresponding to Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig4-figsupp1-data1-v2.zip
Figure 4—figure supplement 2
Additional profiles of chromosomes assembled by holo(WT), holo(D3-dC), ΔG2(WT), and ΔG2(D3-dC) from the experiment described in Figure 4.
(A) Chromosomes assembled by holo(WT), holo(D3-dC), and holo(D3-dC) added at the concentrations indicated. Shown here are blowups of part of the images presented in Figure 4B. Scale bar, 5 µm. (B) …
Figure 4—figure supplement 3
Deletion of the CAP-D2 C-tail in condensin I has little impact on chromosome assembly in Xenopus egg extracts.
(A) A schematic diagram of the full-length hCAP-D2 (D2–FL) and hCAP-D2 lacking the C-terminal tail (D2–dC). (B) Recombinant condensin I holocomplexes containing either wild-type (WT) or C-tail …
-
Figure 4—figure supplement 3—source data 1
Raw data uncropped gel corresponding to Figure 4—figure supplement 3B.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig4-figsupp3-data1-v2.zip
-
Figure 4—figure supplement 3—source data 2
Microsoft excel of non-normalized data corresponding to Figure 4—figure supplement 3D.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig4-figsupp3-data2-v2.zip
Figure 5 with 1 supplement
The basic amino acid clusters of CAP-H2 synergistically contribute to condensin II functions.
(A) A schematic diagram of domain organization of hCAP-H2. CAP-H2 has five motifs that are well conserved among vertebrate species (motifs I to V). Shown here is a sequence alignment of the CAP-H2 …
-
Figure 5—source data 1
Microsoft excel of non-normalized data corresponding to Figure 5C.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig5-data1-v2.zip
Figure 5—figure supplement 1
Deletion of CAP-G2 partially rescues mutations in the basic amino acid clusters of CAP-H2.
(A) Recombinant mammalian condensin II holocomplex (holo) and ΔG2 subcomplex harboring either wild-type (WT) or mutations in the H2 basic amino acid cluster (H2-BC1D, H2-BC2D, and H2-BC1/2D) were …
-
Figure 5—figure supplement 1—source data 1
Raw data uncropped gel corresponding to Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig5-figsupp1-data1-v2.zip
Figure 6 with 1 supplement
ATP-stimulated chromatin binding of condensin II can be recapitulated in an extract-free assay.
(A) Xenopus sperm nuclei were pre-incubated with a buffer containing recombinant nucleoplasmin (Npm2) in the absence or presence of ATP for 30 min, and then holo(WT), ΔG2(WT), ΔD3(WT), ΔD3ΔG2(WT), …
-
Figure 6—source data 1
Microsoft excel of non-normalized data corresponding to Figure 6B.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig6-data1-v2.zip
Figure 6—figure supplement 1
Characterization of holo(D3-dC) in an extract-free chromatin binding assay.
(A) Xenopus sperm nuclei were pre-incubated with a buffer containing recombinant nucleoplasmin (Npm2) in the absence or presence of ATP for 30 min, and then holo(WT) or holo(D3-dC) was added at 50 …
-
Figure 6—figure supplement 1—source data 1
Microsoft excel of non-normalized data corresponding to Figure 6—figure supplement 1B.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig6-figsupp1-data1-v2.zip
-
Figure 6—figure supplement 1—source data 2
Microsoft excel of non-normalized data corresponding to Figure 6—figure supplement 1D.
- https://cdn.elifesciences.org/articles/78984/elife-78984-fig6-figsupp1-data2-v2.zip
Figure 7
Model of condensin II regulation.
(A) Comparison between condensin I and condensin II. In condensin I, the two HEAT subunits, CAP-D2 and CAP-G, contribute to axis assembly and bulk loading, respectively, and their balancing acts …
Author response image 1
Evidence that the faint immunofluorescence signal detected as XCAP-H2 on chenille-like chromosomes formed in the Δcond I/II +holo(WT) extract is an artifact.
(A) Double labeling of chromatin/chromosomes with antibodies against XCAP-H2 (AfR201) and hCAP-H2. This panel was presented in Figure 1B in the original manuscript. (B) From the double-labeling …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Spodoptera frugiperda) | Sf9 insect cells | ThermoFisher | 11496015 | |
| Cell line (Spodoptera frugiperda) | High five insect cells | ThermoFisher | B85502 | |
| Strain, strain background (Escherichia coli) | Max efficiency DH10Bac competent cells | ThermoFisher | 10361012 | |
| Strain, strain background (Escherichia coli) | BL21(DE3) competent cells | with lab cultured cells | N/A | Electrocompetent cells |
| Biological sample (Xenopus laevis) | Xenopus laevis egg | Hamamatsu Seibutsu-Kyozai | RRID: NXR 0.031 | Female, adult frogs |
| Biological sample (Xenopus laevis) | Xenopus laevis sperm nuclei | Hamamatsu Seibutsu-Kyozai | RRID: NXR 0.031 | Male, adult frogs |
| Biological sample (Mus musculus) | Mus musculus sperm nuclei | Shintomi et al., 2017; isolated from Mus musculus cauda epididymis (BALB/c×C57BL/6 J)F1 | N/A | Male, adult mouse |
| Antibody | anti-Xenopus topoisomerase IIα (rabbit polyclonal serum) | Hirano and Mitchison, 1994 | in house: αC1-6 | WB (1/2000) |
| Antibody | anti-XCAP-D2 (rabbit polyclonal) | Hirano et al., 1997 | in house: AfR16L | WB (1.0 μg/mL) |
| Antibody | anti-XCAP-G (rabbit polyclonal) | Hirano et al., 1997 | in house: AfR11-3L | WB (1.0 μg/mL) |
| Antibody | anti-XCAP-H (rabbit polyclonal) | Hirano et al., 1997 | in house: AfR18 | WB (0.7 μg/mL) |
| Antibody | anti-XSMC2/XCAP-E (rabbit polyclonal) | Hirano et al., 1997 | in house: AfR9-6 | WB (1.0 μg/mL) |
| Antibody | anti-XSMC4/XCAP-C (rabbit polyclonal) | Hirano et al., 1997 | in house: AfR8L | WB (2.0 μg/mL) |
| Antibody | anti-mSMC4 (rabbit polyclonal) | Lee et al., 2011 | in house: AfR326-3L | IF (1.0 μg/mL) |
| Antibody | anti-hCAP-H2 (rabbit polyclonal) | Ono et al., 2003 | in house: AfR205-4L | WB (0.8 μg/mL); IF (3.0 μg/mL) |
| Antibody | anti-XCAP-D3 (rabbit polyclonal) | Ono et al., 2003 | in house: AfR196-2L | WB (2.0 μg/mL) |
| Antibody | anti-XCAP-H2 (rabbit polyclonal) | Ono et al., 2003 | in house: AfR201-4 | WB (2.0 μg/mL) |
| Antibody | anti-XCAP-H2 (rabbit polyclonal) | Ono et al., 2003 | in house: AfR202-2 | From the same antigen for AfR201; WB (2.0 μg/mL); IF (3.0 μg/mL) |
| Antibody | anti-hCAP-D3 (rabbit polyclonal) | ProteinTech Group | 16828–1-AP; RRID: AB_2282528 | WB (1.0 μg/mL) |
| Antibody | Alexa Fluor 568-conjugated anti-rabbit IgG (goat polyclonal) | ThermoFisher | A11036; RRID: AB_10563566 | IF (1/500) |
| Antibody | anti-hCAP-D3 pS1474 (rabbit polyclonal) | This paper; custom ordered from SIGMA Genosys | in house: AfR358-3P2 | WB (1.0 μg/mL); refer to “Antibodies” subsection |
| Antibody | anti-hCAP-D3 pT1415 (rabbit polyclonal) | This paper; custom ordered from SIGMA Genosys | in house: AfR364-3P2 | WB (1.0 μg/mL); refer to “Antibodies” subsection |
| Antibody | horseradish peroxidase-conjugated anti-rabbit IgG (goat polyclonal) | Vector Laboratories | PI-1000; RRID: AB_2336198 | WB (1/20000) |
| Recombinant DNA reagent | λ DNA | TaKara | 3010 | Used in ATPase assay |
| Sequence-based reagent | hCAP-D3 STOP-to-Glycine forward primer | This paper | N/A | ggccgcgactagttccgttggcagtcttgag |
| Sequence-based reagent | hCAP-D3 STOP-to-Glycine reverse primer | This paper | N/A | ctcaagactgccaacggaactagtcgcggcc |
| Sequence-based reagent | (3 C)-StrepII SpeI/NotI forward oligo | This paper | N/A | ctagtggactggaagttctgttccaggggcccggatcttggagccatccgcaatttgaaaaaggt ggcggttccggcggaggtagcggcggaggttcttggtctcaccctcagttcgagaagtaagc |
| Sequence-based reagent | (3 C)-StrepII SpeI/NotI reverse oligo | This paper | N/A | ggccgcttacttctcgaactgagggtgagaccaagaacctccgccgctacctccgccggaacc gccacctttttcaaattgcggatggctccaagatccgggcccctggaacagaacttccagtcca |
| Sequence-based reagent | StrepII-(3 C) BamHI/EcoRI forward oligo | This paper | N/A | gatccatgtggagccatccgcaatttgaaaaaggtggaggctccggcggaggtagcggcggaggttcttgg tctcaccctcagttcgagaagggaggcggatcactggaagttctgttccaggggcccgggg |
| Sequence-based reagent | StrepII-(3 C) BamHI/EcoRI reverse oligo | This paper | N/A | aattccccgggcccctggaacagaacttccagtgatccgcctcccttctcgaactgagggtgagaccaag aacctccgccgctacctccgccggagcctccacctttttcaaattgcggatggctccacatg |
| Peptide, recombinant protein | Precission Protease | Cytiva | 27-0843-01 | Used in purification of condensins |
| Peptide, recombinant protein | λ protein phosphatase | NEB | P0753 | |
| Peptide, recombinant protein | Benzonase | Novagen | 71205-3CN | Used in purification of condensins |
| Peptide, recombinant protein | BamHI restriction enzyme | TaKaRa | 1010 | |
| Peptide, recombinant protein | EcoRI restriction enzyme | TaKaRa | 1040 | |
| Peptide, recombinant protein | NotI restriction enzyme | TaKaRa | 1166 | |
| Peptide, recombinant protein | SpeI restriction enzyme | TaKaRa | 1086 | |
| Peptide, recombinant protein | T4 polynucleotide kinase | TaKaRa | 2021 | |
| Commercial assay or kit | QuikChange II XL Site-Directed Mutagenesis Kit | Agilent Technologies | 200522 | |
| Commercial assay or kit | DNA Ligation Kit | TaKaRa | 6022 | |
| Commercial assay or kit | EnzChek Phosphate Assay Kit | ThermoFisher | E6646 | |
| Software, algorithm | UNICORN 7 | Cytiva | N/A | |
| Software, algorithm | Prism 8 | GraphPad | N/A | |
| Software, algorithm | Excel | Microsoft | N/A | |
| Software, algorithm | Olympus cellSens Dimensions | Olympus | N/A | |
| Software, algorithm | Photoshop | Adobe | N/A | |
| Software, algorithm | ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ | |
| Software, algorithm | SparkControl | Tecan Life Sciences | N/A | |
| Other | Coomassie Brilliant Blue R-250 staining solution | Bio-Rad | 1610436 | For polyacrylamide gels |
| Other | Amersham Protran Premium 0.45 nitrocellulose membrane | Cytiva | 10600047 | For Western blots |
| Other | Glutathione Sepharose 4B | Cytiva | 17075601 | Used for purification of condensin I |
| Other | HiTrap Q HP 1 mL | Cytiva | 17115301 | Used for purification of condensins |
| Other | StrepTactin Sepharose HP | Cytiva | 28-9355-99 | Used for purification of condensin II |
| Other | DAPI | Roche | 10236276001 | (2 μg/mL) |
| Other | ATP | Sigma-Aldrich | A2383 | Used in ATPase assay and Npm2-treated chromatin binding assay |
| Other | Dynabeads Protein A | ThermoFisher | 10002D | For immunodepletion with Xenopus egg extract |
| Other | Alexa Flour 488-conjugated streptavidin | ThermoFisher | S32354 | IF (1/2000) |
-
SMC: structural maintenance of chromosomes.
