Molecular dissection of condensin II-mediated chromosome assembly using in vitro assays

Abstract

In vertebrates, condensin I and condensin II cooperate to assemble rod-shaped chromosomes during mitosis. Although the mechanism of action and regulation of condensin I have been studied extensively, our corresponding knowledge of condensin II remains very limited. By introducing recombinant condensin II complexes into Xenopus egg extracts, we dissect the roles of its individual subunits in chromosome assembly. We find that one of two HEAT subunits, CAP-D3, plays a crucial role in condensin II-mediated assembly of chromosome axes, whereas the other HEAT subunit, CAP-G2, has a very strong negative impact on this process. The structural maintenance of chromosomes ATPase and the basic amino acid clusters of the kleisin subunit CAP-H2 are essential for this process. Deletion of the C-terminal tail of CAP-D3 increases the ability of condensin II to assemble chromosomes and further exposes a hidden function of CAP-G2 in the lateral compaction of chromosomes. Taken together, our results uncover a multilayered regulatory mechanism unique to condensin II, and provide profound implications for the evolution of condensin II.

Editor's evaluation

This paper examines the specific roles of the condensin II complex subunits in mitotic chromosome condensation in the absence of condensin I in frog egg extracts. The authors found that condensin II subunits influence condensation in a manner that is distinct from condensin I. Since condensin II has additional roles in genome architecture and centromere function, this study will be of high interest to researchers from diverse fields.

https://doi.org/10.7554/eLife.78984.sa0

Introduction

Formation of mitotic chromosomes is an indispensable cellular process that ensures the faithful segregation of genomic information to newly forming daughter cells during cell division. During this process, genome DNAs undergo drastic conformational changes and are converted into a set of rod-shaped structures in which sister chromatids are juxtaposed with each other (Batty and Gerlich, 2019; Paulson et al., 2021). Mis-regulation in these processes often leads to genomic instability and aneuploidy, potentially leading to cancer and birth defects. Deciphering the molecular mechanism of mitotic chromosome assembly is therefore important to understand not only the basic biology of cell proliferation but also the etiology of human diseases that accompany genome instability or chromosome anomalies.

In vertebrates, a pair of large protein complexes, condensin I and condensin II, play critical roles in mitotic chromosome assembly (Hirano, 2016; Uhlmann, 2016). While both complexes share the same pair of SMC (structural maintenance of chromosomes) ATPase subunits, SMC2 and SMC4, they differ by their kleisin subunit (CAP-H/Brn1 for condensin I and CAP-H2 for condensin II) and two HEAT-repeat subunits (CAP-D2/Ycs4 and CAP-G/Ycg1 for condensin I; CAP-D3 and CAP-G2 for condensin II). The difference in the subunit composition of the two complexes specifies their spatiotemporal dynamics and functional contributions to mitotic chromosome assembly. Before the onset of mitosis, condensin I is localized to the cytoplasm, whereas condensin II is primarily nuclear (Hirota et al., 2004; Ono et al., 2004). This spatial separation allows condensin II to initiate structural changes of chromosomes within the prophase nucleus. After nuclear envelope breakdown, condensin I gains access to the chromosomes and completes the formation of rod-shaped structures. Evidence has been provided that condensin II contributes to axial shortening, which is followed by lateral compaction mediated by condensin I (Green et al., 2012; Shintomi and Hirano, 2011). As judged by an in situ reorganization assay (Ono et al., 2017) and a mechanical stretching assay (Sun et al., 2018), condensin II plays a more important role in chromosome mechanics than condensin I. An emerging model from high-throughput chromosome conformation capture (Hi-C) and quantitative imaging suggests that condensin II forms large DNA loops, which are in turn subdivided by condensin I into smaller, nested DNA loops (Gibcus et al., 2018; Walther et al., 2018).

Despite the well-characterized behaviors of condensin I and condensin II in animal tissue culture cells, the relative contribution of condensin I and condensin II to mitotic chromosome assembly is variable among different species and different cell types (Hirano, 2012). Condensin I is essential for mitotic chromosome assembly and segregation in all eukaryotic species examined to date. In contrast, condensin II is absent in some species (e.g. fungi including Saccharomyces cerevisiae) or non-essential for mitosis in others (e.g. Drosophila melanogaster and Arabidopsis thaliana). In Xenopus egg extracts, condensin I plays a dominant role in mitotic chromosome assembly and condensin II makes a significant, yet rather minor contribution to this process (Choppakatla et al., 2021; Ono et al., 2003; Shintomi and Hirano, 2011). Moreover, a specialized role of condensin II in centromere assembly has been reported in Xenopus egg extracts and in human cells (Barnhart-Dailey et al., 2017; Bernad et al., 2011).

The question of how condensin complexes might mechanistically operate is currently under active investigation. A recent breakthrough in the field was the demonstration that budding yeast condensin (classified as condensin I based on the primary structures of its subunits) has the ability to translocate along a double-stranded DNA (dsDNA) (Terakawa et al., 2017) and to ‘extrude’ a DNA loop (Ganji et al., 2018) in an ATP hydrolysis-dependent manner. Structural studies of yeast condensin shed light on the dynamic conformational changes of this highly sophisticated protein machine (Hassler et al., 2019; Kschonsak et al., 2017; Lee et al., 2020). Moreover, a powerful functional assay using Xenopus egg extracts revealed intricate functional crosstalk among the individual subunits of mammalian condensin I (Kinoshita et al., 2015; Kinoshita et al., 2022). In contrast to the rapid accumulation of mechanistic information about condensin I, however, very little progress has been made so far in our understanding of condensin II. Although it has been shown that human condensin I and condensin II display loop extrusion activities with slightly different properties in vitro (Kong et al., 2020), it remains unknown how such differences might be related to the different dynamics and functions of the two condensin complexes observed in vivo. Key questions to be addressed are how the individual subunits of condensin II function in chromosome assembly and to what extent the mechanism of action of condensin II is similar to and different from that of condensin I.

In the current study, we have used Xenopus egg extracts as a functional assay to address the roles of the individual subunits of the condensin II complex in the initial step of mitotic chromosome assembly. We find that a recombinant condensin II holocomplex can functionally replace endogenous condensin II in the extract lacking condensin I and enables the assembly of ‘chenille-like’ chromosomes with inner axes. Analyses using subunit-deletion mutant complexes demonstrate that CAP-D3 has a positive role in assembling the axes, whereas CAP-G2 has a very strong negative impact on this process. As opposed to the essential requirements for SMC ATPase and basic amino acid clusters conserved in CAP-H2, the C-terminal tail of CAP-D3 negatively regulates condensin II-mediated chromosome assembly. Interestingly, deletion of the CAP-D3 C-tail can expose a hidden function of CAP-G2 in compacting DNA laterally around the axes. We also show that ATP-stimulated chromatin binding of condensin II can be recapitulated in a simple, extract-free assay. These results not only clarify the mechanistic similarities and differences between condensin I and condensin II but also provide important implications for the evolution of condensin II.

Results

Recombinant condensin II can functionally replace endogenous condensin II in Xenopus egg extracts

To dissect the functional contributions of the individual subunits of condensin II for mitotic chromosome assembly, we expressed mammalian subunits using a baculovirus expression system in insect cells. A recombinant condensin II holocomplex (holo[WT]) composed of five subunits (Figure 1A) was purified according to the procedures described previously (Kinoshita et al., 2015; Kinoshita et al., 2022) with some modifications (Figure 1—figure supplement 1A).

Figure 1 with 1 supplement see all
Recombinant condensin II holocomplex can functionally replace endogenous condensin II in Xenopus egg extracts.

(A) A schematic diagram of the condensin II holocomplex that is composed of two structural maintenance of chromosomes (SMC) subunits (SMC2 and SMC4), two HEAT subunits (CAP-D3 and CAP-G2), and a kleisin subunit (CAP-H2). (B) Mouse sperm nuclei were incubated with Δmock, Δcond I, or Δcond I/II extracts that had been supplemented with a control buffer (buffer) or recombinant (rec) condensin II holocomplex, holo(WT), at a final concentration of 200 nM. After 150 min, reaction mixtures were fixed, split, and labeled with an antibody against either Xenopus CAP-H2 (XCAP-H2) or human CAP-H2 (hCAP-H2). DNA was counterstained with DAPI (4′,6-diamidino-2-phenylindole). Shown here is a representative image from over 15 chromosome clusters examined per condition. Scale bar, 10 µm. (C) A schematic representation of the chromosome structures observed in Δmock, Δcond I, or Δcond I/II extracts. Rod-shaped chromosomes and chenille-like chromosomes are assembled in Δmock extract and Δcond I extract, respectively. Δcond I/II extract produces an amorphous mass of chromatin (‘clouds’). The addition of recombinant condensin II (rec cond II) to the same extract restores its ability to assemble chenille-like chromosomes. (D) A single chromosome assembled in Δcond I extract with buffer and Δcond I/II extract with 200 nM holo(WT) from samples from experiment (B) in comparison to a chenille stem. Scale bars for chromosomes, 2 µm. (E) DAPI intensities from the experiment described in (B) were measured along lines drawn perpendicular to chromosome axes to create line scan profiles for the width of chromosomes assembled in the Δcond I extract with buffer and Δcond I/II extract with 200 nM holo(WT) (n=20 chromosomes). The mean and SD were normalized individually to the DAPI intensity (arbitrary unit [a.u.]) at the center of chromosome axes (distance = 0 μm) within each set. A dataset from a single representative experiment out of three repeats is shown.

Figure 1—source data 1

Microsoft excel of non-normalized data corresponding to Figure 1E.

https://cdn.elifesciences.org/articles/78984/elife-78984-fig1-data1-v2.xlsx

We then tested the ability of condensin II holo(WT) to assemble mitotic chromosomes in Xenopus egg extracts. Conventional assays of mitotic chromosome assembly using Xenopus egg extracts had used Xenopus sperm nuclei as a substrate (Hirano et al., 1997; Ono et al., 2003; Shintomi and Hirano, 2011). More recently, we modified these assays by introducing mouse sperm nuclei into the same extracts, which allowed us to gain additional insights into the mechanism of mitotic chromosome assembly (Kinoshita et al., 2022; Shintomi et al., 2017). It was noticed that the functional contribution of condensin II was observed more prominently when mouse sperm nuclei were used as a substrate than when Xenopus sperm nuclei were used (Shintomi et al., 2017). We suspected that the slow kinetics of nucleosome assembly on the mouse sperm substrate creates an environment in favor of condensin II’s action. For this reason, mouse sperm nuclei were used as a substrate in the current study. We prepared metaphase extracts depleted of condensin I only (Δcond I) and of condensins I and II together (Δcond I/II) (Figure 2—figure supplement 1A). As reported in a previous study (Shintomi et al., 2017), control extract (Δmock) produced a cluster of rod-shaped chromosomes whereas condensin I-depleted extract (Δcond I) produced a cluster of thick chromosomes with fuzzy surfaces in which condensin II localized to DAPI-dense axes (Figure 1B and C). Immunodepletion of both condensins I and II (Δcond I/II) resulted in the formation of an amorphous mass of chromatin (called ‘cloud’) in which twenty chromosomal DNAs are entangled with each other. We found that recombinant condensin II holocomplex, when added back into the Δcond I/II extract, effectively restored the ability to support condensin II-mediated chromosome assembly in a dose-dependent manner (Figure 1B and Figure 2—figure supplement 1B). The addition of holo(WT) at 200 nM caused the formation of chromosomal structures similar to those formed by endogenous condensin II (Figure 1D and E). We noticed that this concentration (200 nM) was higher than the concentration of endogenous condensin II (~25 nM) in Xenopus egg extracts that had been estimated by proteomic analysis (Wühr et al., 2014). Potential explanations for this apparent discrepancy could include the species difference in the primary structures of the subunits or the different states of post-translational modifications. Despite the caveat, these experiments demonstrate that the recombinant mammalian condensin II holocomplex can functionally replace endogenous condensin II in Xenopus egg extracts under the current condition. As described here, condensin II, without condensin I, forms a unique chromosome structure with a fuzzy surface and an internal axis. In the current study, we refer to the chromosome structure as a ‘chenille-like’ chromosome, due to its resemblance to a chenille stem (Figure 1D, bottom).

Chromosome association of condensin II Is decreased by CAP-D3 deletion but is increased by CAP-G2 deletion

Having established that the recombinant condensin II holocomplex works in Xenopus egg extracts, we then wished to understand the functional contributions of its HEAT subunits, CAP-D3, and CAP-G2, in the assembly of chenille-like chromosomes. To this end, condensin II subcomplexes lacking CAP-G2 (ΔG2[WT]), CAP-D3 (ΔD3[WT]), or both (ΔD3ΔG2[WT]) (Figure 1—figure supplement 1A) were individually added back into extracts depleted of both condensins I and II. Unlike holo(WT), ΔD3(WT) displayed a weak association with chromatin and failed to form DAPI-dense internal axes (Figure 2A and B). In contrast, ΔG2(WT) retained the ability to assemble structures reminiscent of chenille-like chromosomes formed by holo(WT) (Figure 2A and B). Strikingly, we noticed that an extremely high level of hCAP-H2 signals accumulated on DAPI-dense axes. A time-course of the formation of these chromosomes demonstrated that ΔG2(WT) became detectable on chromatin and initiated the formation of axes at much earlier time points than holo(WT) (Figure 2—figure supplement 1C). Unlike ΔG2(WT), ΔD3ΔG2(WT) displayed very little if any activity to associate with chromatin (Figure 2A and B).

Figure 2 with 1 supplement see all
Chromosome association of condensin II is decreased by CAP-D3 deletion but is increased by CAP-G2 deletion.

(A) (Left) Mouse sperm nuclei were incubated with Δcond I/II extracts that had been supplemented with control buffer (buffer), recombinant condensin II holocomplex (holo[WT]) or its subcomplexes (ΔG2[WT], ΔD3[WT], and ΔD3ΔG2[WT]) at 200 nM. After 150 min, reaction mixtures were fixed, and labeled with anti-hCAP-H2 antibody. DNA was counterstained with DAPI. The images of the hCAP-H2 signal were captured at different relative exposure times (1 × and 1/4 ×) to show non-saturated signal intensities of chromosome structures produced by ΔG2(WT). Shown here is a representative image from over 15 chromosome clusters examined per condition. Scale bar, 10 µm. (Right) Schematic diagrams of the holocomplex and subcomplexes. (B) Signal intensities of hCAP-H2 from the experiment described in (A) were divided by DAPI signal intensities and the mean values were normalized relative to the value by holo(WT). The mean ± SD is shown (n=15 chromosome clusters). The p-values listed were assessed by two-tailed Welch’s t-test. (C) Mouse sperm nuclei were incubated with Δcond I/II extracts that had been supplemented with holo(WT) or ΔG2(WT) at concentrations indicated. After 150 min, reaction mixtures were fixed and processed for immunofluorescence as in (A). Shown here is a representative image from over 15 chromosome clusters examined per condition. The right panels show cropped images of the orange sections of the left panels. Scale bar, 10 µm (left) and 5 µm (right). (D) DAPI and hCAP-H2 intensities from the experiment described in (C) were measured along lines drawn perpendicular to the chromosome to create line scan profiles for the width of chromosomes assembled in Δcond I/II extract with 200 nM holo(WT) or either 25 nM or 200 nM ΔG2(WT) (n=20 chromosomes). The mean and standard deviation were normalized individually to the DAPI intensities (arbitrary unit [a.u.]) at the center of chromosome axes (distance = 0 μm) within each set. Intensities of hCAP-H2 were normalized relative to the central value by 200 nM holo(WT) addition. A dataset from a single representative experiment out of three repeats is shown. WT: wild-type.

Figure 2—source data 1

Microsoft excel of non-normalized data corresponding to Figure 2B.

https://cdn.elifesciences.org/articles/78984/elife-78984-fig2-data1-v2.zip
Figure 2—source data 2

Microsoft excel of non-normalized data corresponding to Figure 2D.

https://cdn.elifesciences.org/articles/78984/elife-78984-fig2-data2-v2.zip

Having observed progressive accumulation of ΔG2(WT) on chromosome axes over time, the concentration of ΔG2(WT) was titrated down. We found that the addition of as low as 25 nM ΔG2(WT) was sufficient to produce chenille-like chromosomes similar to those formed by the addition of 200 nM holo(WT) (Figure 2C). Comparable levels of hCAP-H2 signals were detectable on the axes between the two conditions (Figure 2D). Taken together, these results suggest that CAP-D3 and CAP-G2 have a positive and negative role, respectively, in chromosome association of condensin II that leads to chromosome axis formation. A minor concern is that an unidentified residual level of Xenopus CAP-G2 remaining in the depleted egg extract may incorporate into the recombinant ΔG2(WT) subcomplex and influence the resultant chromosomal phenotype. However, we consider that this is unlikely because clear functional differences between holo(WT) and ΔG2(WT) are also observed in an extract-free assay, as described below (Figure 6A and B).

The SMC ATPase cycle is essential for condensin II function

A previous study from our laboratory demonstrated that mutations impairing the SMC ATPase cycle cause very severe defects in condensin I-mediated chromosome assembly in Xenopus egg extracts (Kinoshita et al., 2015). To test whether the same is true in condensin II-mediated chromosome assembly, we introduced the transition state (TR) mutations, which are predicted to slow down the step of ATP hydrolysis, into the SMC subunits of condensin II (mSMC2 E1114Q and mSMC4 E1218Q), and prepared holo(SMC-TR) and ΔG2(SMC-TR) (Figure 1—figure supplement 1B). We found that holo(SMC-TR), when added at 200 nM, bound only weakly to chromatin, leaving an amorphous cloud-like structure (Figure 3A and B). At the same concentration, chromosome association of ΔG2(SMC-TR) was greatly reduced compared to that of ΔG2(WT), but was seen at a much higher level than that of holo(WT). Despite the high level of chromosome association, ΔG2(SMC-TR) failed to show any sign of chromosome assembly much like holo(SMC-TR). When ΔG2(WT) and ΔG2(SMC-TR) were reduced to 25 nM, the levels of chromosome association and the resulting chromosome morphology were comparable with those of holo(WT) and holo(SMC-TR), respectively, at 200 nM (Figure 3A), a result consistent with that shown in Figure 2. These results suggest that ATP hydrolysis facilitates the accumulation of condensin II at the chromosome axes in Xenopus egg extracts.

The structural maintenance of chromosome (SMC) ATPase cycle is essential for condensin II function.

(A) Mouse sperm nuclei were incubated with Δcond I/II extracts that had been supplemented with condensin II holo(WT) and holo(SMC-TR) at 200 nM, or ΔG2(WT) and ΔG2(SMC-TR) at either 200 nM or 25 nM. After 150 min, reaction mixtures were fixed and labeled with anti-hCAP-H2 antibody. DNA was counterstained with DAPI. Shown here is a representative image from over 15 chromosome clusters examined per condition. The images of hCAP-H2 signal were first captured at a single exposure time (1/3 ×) and then increased digitally (1 ×) to visualize signals from chromosomes of complexes apart from ΔG2(WT) at 200 nM. Scale bar, 10 µm. (B) Signal intensities of hCAP-H2 from the experiment described in (A) were divided by DAPI intensities and the mean values were normalized relative to the value by holo(WT). The mean ± SD is shown (n=15 chromosome clusters). The p-values listed were assessed by two-tailed Welch’s t-test. A dataset from a single representative experiment out of two repeats is shown. (C) ATPase rates of recombinant condensin II holo(WT), ΔG2(WT), holo(SMC-TR), and ΔG2(SMC-TR) in the presence or absence of double-stranded DNA (dsDNA). The error bar represents the SD from three performed repeats. P values listed were assessed by two-tailed t-test. WT: wild-type.

To determine whether CAP-G2 regulates ATP hydrolysis by condensin II, we measured the ATPase activity of these wild-type and mutant complexes. Holo(WT) contained a modest level of ATPase activity in the absence of DNA but was stimulated more than twofold when dsDNA was added (Figure 3C). On the other hand, deletion of CAP-G2 resulted in more than threefold increase in ATP hydrolysis compared to holo(WT) in the absence of dsDNA. Intriguingly, the ATPase activity of ΔG2(WT) was barely stimulated by adding dsDNA. The introduction of SMC-TR mutations greatly reduced the ATPase activities of both the holocomplex and ΔG2 subcomplex. Taken together, these results demonstrated that CAP-G2 negatively regulates the ATPase activity of condensin II as well as its ability to associate with chromosomes.

The CAP-D3 C-tail negatively regulates condensin II-mediated chromosome assembly

Human CAP-D3 is a polypeptide with 1498 amino acids, in which a HEAT-repeat-rich section is followed by a C-terminal intrinsically disordered region (IDR) of around 200 amino-acid long (Figure 4A; Ono et al., 2003; Yoshimura and Hirano, 2016). Notably, the C-terminal IDR domain, which we refer to as the C-tail in the current study, contains as many as 11 Cdk1 consensus (S/TP) sites (Figure 4—figure supplement 1A). Previous studies reported that mitosis-specific phosphorylation in the CAP-D3 C-tail regulates condensin II functions (Abe et al., 2011; Bakhrebah et al., 2015).

Figure 4 with 3 supplements see all
The CAP-D3 C-tail negatively regulates condensin II-mediated chromosome assembly.

(A) A schematic diagram of the full-length hCAP-D3 (D3–FL) and hCAP-D3 lacking the C-terminal tail (D3–dC). (B) Mouse sperm nuclei were incubated in Δcond I/II extracts that had been supplemented with condensin II holo(WT) or holo(D3-dC) at either 25, 50, or 200 nM. After 150 min, reaction mixtures were fixed and labeled with anti-hCAP-H2 antibody. DNA was counterstained with DAPI. Shown here is a representative image from over 15 chromosome clusters examined per condition. Scale bar, 10 µm. (C) DAPI and hCAP-H2 intensities from the experiment described in (B) were measured along lines drawn perpendicular to chromosome axes to create line scan profiles for the width of chromosomes assembled in Δcond I/II extract with 200 nM holo(WT) or either 50 nM or 200 nM holo(D3-dC) (n=20 chromosomes). The mean and SD were normalized individually to the DAPI intensities (arbitrary unit [a.u.]) at the center of chromosome axes (distance = 0 μm) within each set. Intensities of hCAP-H2 were normalized relative to the central value by 200 nM holo(WT) addition. A dataset from a single representative experiment out of three repeats is shown. (D) Mouse sperm nuclei were incubated in Δcond I/II extracts that had been supplemented with condensin II ΔG2(WT) or ΔG2(D3-dC) at either 25, 50, or 200 nM in the same experiment as (B). After 150 min, reaction mixtures were fixed and labeled with anti-hCAP-H2 antibody. DNA was counterstained with DAPI. Shown here is a representative image from over 15 chromosome clusters examined per condition. Scale bar, 10 µm. WT: wild-type.

Figure 4—source data 1

Microsoft excel of non-normalized data of all conditions corresponding to Figure 4 and Figure 4—figure supplement 2.

https://cdn.elifesciences.org/articles/78984/elife-78984-fig4-data1-v2.zip

To address the role of the CAP-D3 C-tail in our functional assay, we prepared holo(D3-dC), a condensin II holocomplex lacking the C-tail (Figure 1—figure supplement 1C). When holo(WT) and holo(D3-dC) were incubated in metaphase extracts, the full-length CAP-D3 (D3-FL), but not the C-terminally truncated version of CAP-D3 (D3-dC), underwent progressive, electrophoretic mobility shifts (Figure 4—figure supplement 1B). A pair of phosphospecific antibodies against pT1415 and pS1474 recognized shifted D3-FL, but not D3-dC, suggesting that the deletion of the CAP-D3 C-tail removed most, if not all, of the mitosis-specific phosphorylation sites.

We examined the differences between holo(WT) and holo(D3-dC) in two functional assays. In the ATPase assay, we found that the ATPase activity of holo(D3-dC) was significantly higher than that of holo(WT) either in the presence or absence of dsDNA (Figure 4—figure supplement 1C). In the add-back assay, higher levels of chromosome association were observed with holo(D3-dC) than with holo(WT) at all concentrations tested (25, 50, and 200 nM; Figure 4B). Remarkably, we noticed that the chromosome structure formed by holo(D3-dC) at 200 nM was no longer chenille-like: DAPI signals were more confined toward the axis positive for hCAP-H2 (Figure 4C, left, and Figure 4—figure supplement 2A), being compacted laterally into structures reminiscent of rod-shaped chromosomes produced by condensin I (Kinoshita et al., 2022). However, when the concentration of holo(D3-dC) was lowered to 50 nM, its chromosome association was reduced to a level similar to that of holo(WT) at 200 nM addition and formed similar chenille-like chromosomes (Figure 4C, right). These results demonstrated that the CAP-D3 C-tail negatively regulates condensin II-mediated chromosome assembly, and further implicated that a high level of chromosome association of holo(D3-dC) supports the conversion from chenille-like to laterally compacted rod-like structures.

We also questioned what would happen when the deletions of CAP-G2 and the CAP-D3 C-tail were combined. To this end, ΔG2(D3-dC), a ΔG2 subcomplex harboring the deletion of the CAP-D3 C-tail, was prepared and subjected to the add-back assay (Figure 1—figure supplement 1C). We found that slightly higher levels of chromosome association were observed with ΔG2(D3-dC) than with ΔG2(WT) (Figure 4D and Figure 4—figure supplement 2A). Importantly, however, the chromosomes formed by ΔG2(D3-dC), unlike those formed by holo(D3-dC), were chenille-like rather than rod-like, even at the highest concentration of 200 nM (Figure 4—figure supplement 2B and C). These results showed that CAP-G2 has a rather cryptic role in chromosome shaping, which can only be uncovered when the holocomplex is overloaded on chromosomes by deleting the CAP-D3 C-tail.

The basic amino acid clusters of CAP-H2 synergistically contribute to condensin II functions

The kleisin subunits act as the hub of SMC protein complexes including condensin II (Figure 1A; Kong et al., 2020; Onn et al., 2007). A previous study using budding yeast condensin had reported that two basic amino acid clusters (BC1 and BC2) conserved in the central region of Brn1/CAP-H form part of a unique DNA-binding subdomain (‘safety belt’; Kschonsak et al., 2017). It had also been shown that BC1/2 mutations (substitutions of all basic residues with aspartic acids) in human CAP-H caused hypomorphic defects in condensin I-mediated chromosome assembly in Xenopus egg extract (Kinoshita et al., 2022).

We wished to test how the corresponding mutations in human CAP-H2 have an impact on condensin II-mediated chromosome assembly in our add-back assay. To this end, we prepared mutant holocomplexes harboring charge-reversal mutations of BC1D, BC2D, or a combination of BC1D and BC2D (BC1/2D) (Figure 5A and Figure 1—figure supplement 1D). We found that the BC1D or BC2D mutations caused partial defects in chromosome association of condensin II, resulting in the formation of discontinuous axes (Figure 5B and C). In contrast, holo(H2-BC1/2D), a holocomplex harboring both BC1D and BC2D mutations, failed to associate with chromatin, leaving a cloud-like morphology. Thus, the two sets of mutations caused synergistic defects in condensin II-mediated chromosome assembly. Interestingly, deletion of CAP-G2 from these mutant complexes harboring BC1D, BC2D, or BC1/2D partially rescued their defects in chromosome association and axis formation (Figure 5—figure supplement 1), suggesting that the BC1/2D mutations do not cause complete loss of condensin II functions when the negative regulation by CAP-G2 is eliminated.

Figure 5 with 1 supplement see all
The basic amino acid clusters of CAP-H2 synergistically contribute to condensin II functions.

(A) A schematic diagram of domain organization of hCAP-H2. CAP-H2 has five motifs that are well conserved among vertebrate species (motifs I to V). Shown here is a sequence alignment of the CAP-H2 orthologs from Danio rerio (DrCAP-H2), Xenopus laevis (XCAP-H2), Gallus gallus (GgCAP-H2), Mus musculus (mCAP-H2) and human (hCAP-H2). Conserved residues are labeled in dark blue (Y/F/W), light blue (P) and gray (I/M/L*). Within the central region, two basic amino acid clusters (BC1 and BC2 shown in red). The BC1D and BC2D mutations were created by substituting all basic residues (K/R) conserved in BC1 and BC2, respectively, with aspartic acid residues (D). The BC1/2D mutations are a combination of the BC1D and BC2D mutations. (B) Mouse sperm nuclei were incubated with Δcond I/II extracts that had been supplemented with holo(WT), holo(H2-BC1D), holo(H2-BC2D) and holo(H2-BC1/2D) at 200 nM. After 150 min, reaction mixtures were fixed and labeled with anti-hCAP-H2 antibody. DNA was counterstained with DAPI. Shown here is a representative image from over 15 chromosome clusters examined per condition. Scale bar, 10 µm. (C) (Left) Signal intensities of hCAP-H2 from the experiment described in (B) were divided by DAPI intensities and the mean values were normalized relative to the values by holo(WT). (Right) Signal intensities of hCAP-H2 accumulated at the axes were divided by the overall hCAP-H2 intensities on the chromosomal DNA and the mean values were normalized to the value by holo(WT). The mean ± SD is shown (n=15 chromosome clusters). The p-values listed were assessed by two-tailed Welch’s t-test. A dataset from a single representative experiment out of two repeats is shown.

Figure 5—source data 1

Microsoft excel of non-normalized data corresponding to Figure 5C.

https://cdn.elifesciences.org/articles/78984/elife-78984-fig5-data1-v2.zip

ATP-stimulated chromatin binding of condensin II can be recapitulated in an extract-free assay

The experiments utilizing Xenopus egg extracts described above allowed us to dissect the positive and negative roles of the individual subunits in condensin II-mediated chromosome axis assembly. However, the egg extracts contain a number of activities that modify or potentially supplement the activities of the recombinant condensin II complex. In an attempt to fill the gap between the extract-based assay and other biochemical/biophysical assays (Kong et al., 2020), we next wished to set up a simple chromatin-binding assay that does not utilize the extracts. A previous study from our laboratory had demonstrated that mitotic chromosome-like structures can be reconstituted by mixing Xenopus sperm nuclei with six purified proteins including condensin I and topoisomerase II (Shintomi and Hirano, 2021; Shintomi et al., 2015). In this reaction, a core domain of Xenopus laevis nucleoplasmin (Npm2) removes sperm-specific proteins from the sperm nuclei to make a ‘banana-shaped’ swollen chromatin mass.

In the current study, we devised an extract-free assay in which the swollen chromatin mass was used as a simple substrate to test condensin II binding without the influence of factors present in the extracts such as mitosis-specific kinases and chromatin remodelers (Xenopus sperm nuclei were used as the substrate in this assay because no reproducible protocol for Npm2-mediated swelling of mouse sperm nuclei was available). In brief, Xenopus sperm nuclei were preincubated with Npm2 in the absence or presence of ATP, and the reaction mixtures were supplemented with buffer alone, holo(WT), ΔG2(WT), ΔD3(WT), ΔD3ΔG2(WT), or holo(SMC-TR). Because topoisomerase II was absent in this reaction, no drastic structural change including individualization was expected to occur. We found that condensin II holo(WT) displayed a weak ATP-stimulated binding and caused compaction of the banana-shaped chromatin in an ATP-dependent manner (Figure 6A and B). Neither ATP-stimulated binding nor ATP-dependent compaction was observed when the ATP-hydrolysis-deficient holo(SMC-TR) was added. ΔD3(WT) and ΔD3ΔG2(WT) were barely detectable on the chromatin in either the absence or presence of ATP. Strikingly, ΔG2(WT) displayed much greater activities of both ATP-stimulated binding and ATP-dependent compaction than holo(WT). The CAP-D3 C-tail lacking holo(D3-dC) was also tested and was found to display higher activities than holo(WT) (Figure 6—figure supplement 1). Thus, the swollen chromatin binding assay allows us to probe for ATP-stimulated chromatin binding and ATP-dependent chromatin compaction by condensin II under an extract-free condition. Importantly, this simple assay could recapitulate, at least in part, the differences in chromatin binding between the wild-type and the mutant complexes observed in Xenopus egg extracts.

Figure 6 with 1 supplement see all
ATP-stimulated chromatin binding of condensin II can be recapitulated in an extract-free assay.

(A) Xenopus sperm nuclei were pre-incubated with a buffer containing recombinant nucleoplasmin (Npm2) in the absence or presence of ATP for 30 min, and then holo(WT), ΔG2(WT), ΔD3(WT), ΔD3ΔG2(WT), or holo(TR) was added at 50 nM. After 120 min, reaction mixtures were fixed and labeled with anti-mSMC4 antibody. DNA was counterstained with DAPI. Shown here is a representative image from over 20 nuclei examined per condition. Scale bar, 10 µm. (B) (Left) Signal intensities of hCAP-H2 were divided by DAPI intensities and the mean values were normalized relative to the values by holo(WT) without ATP addition (-ATP). (Right) Areas of DAPI signals were measured and the mean values were normalized to values by holo(WT) without ATP addition (-ATP). The mean ± SD is shown (n=20 sperm nuclei). The p-values listed were assessed by two-tailed Welch’s t-test. SMC, structural maintenance of chromosomes; WT: wild-type.

Figure 6—source data 1

Microsoft excel of non-normalized data corresponding to Figure 6B.

https://cdn.elifesciences.org/articles/78984/elife-78984-fig6-data1-v2.zip

Discussion

Negative regulation of condensin II by CAP-G2 and the CAP-D3 C-tail

In vertebrate cells, condensins I and II have both overlapping and non-overlapping functions and cooperate to assemble mitotic chromosomes for faithful segregation (Nishide and Hirano, 2014). One of the primary motivations behind the current study was to clarify the functional similarities and differences between condensin I and condensin II at a mechanistic level. To this end, we have used recombinant condensin II complexes to dissect the functions of its individual subunits in Xenopus egg extracts. A previous study from our laboratory had demonstrated that a pair of HEAT subunits of condensin I, CAP-D2, and CAP-G, have antagonistic functions in the dynamic assembly of chromosome axes (Kinoshita et al., 2015). Deletion of CAP-G decreased chromosome association of condensin I and caused the formation of a chromosome structure with fuzzy surfaces and abnormally thin axes. In striking contrast, deletion of CAP-G2 greatly increased, rather than decreased, chromosome association of condensin II (Figure 2). As a consequence, a much lower concentration of ΔG2(WT) (as low as 1/8 of condensin II holo[WT]) was sufficient to assemble chromosomes with chenille-like characteristics. On the other hand, deletion of CAP-D3 decreased chromosome association of condensin II and caused failure to assemble chromosomes with discrete axes. Although the essential requirement of CAP-D3 in condensin II-mediated axis formation was parallel to the requirements of CAP-D2 in condensin I-mediated axis formation (Kinoshita et al., 2015; Kinoshita et al., 2022), we were surprised to find that CAP-G2 has a very strong negative impact on condensin II functions. Importantly, the results from the ATPase assay (Figure 3C) and the extract-free swollen chromatin binding assay (Figure 6) also supported the negative role of CAP-G2. We suggest that the balancing acts of the two HEAT subunits, originally proposed for condensin I (Kinoshita et al., 2015), also operate in condensin II, but that such actions are fine-tuned differently in each complex (Figure 7A). In the case of condensin II, for example, CAP-D3-driven axis assembly is intrinsically dominant, which is counter-balanced by the strong suppressive action of CAP-G2.

Model of condensin II regulation.

(A) Comparison between condensin I and condensin II. In condensin I, the two HEAT subunits, CAP-D2 and CAP-G, contribute to axis assembly and bulk loading, respectively, and their balancing acts regulate proper chromosome assembly. In condensin II, although CAP-D3 and CAP-G2 contribute to axis assembly and bulk loading, respectively, their balancing acts are modified differently from condensin I: CAP-D3’s role in axis assembly is dominant over CAP-G2’s role in bulk loading, whereas CAP-G2’s function to negatively regulate CAP-D3’s function is prominent (bar-headed arrow shown in red). The CAP-D3 C-tail could negatively regulate CAP-D3’s action through CAP-G2-dependent (blue arrow shown in blue) and CAP-G2-independent mechanisms (bar-headed arrow shown in blue). (B) A schematic representation of the chromosome morphologies formed by holo(WT), ΔG2(WT), and holo(D3-dC) in Xenopus egg extracts. Holo(WT) added at 200 nM localizes at the axis and forms chenille-like chromosomes with large loops. ΔG2(WT) and holo(D3-dC) form similar chenille-like chromosomes at lower doses (at 25 nM and 50 nM, respectively). At 200 nM, ΔG2(WT) greatly accumulates at the axis and elongates the axis while keeping the chenille-like morphology. In contrast, holo(D3-dC), when added at 200 nM, also associates with non-axial regions to support lateral compaction, resulting in the formation of a rod-like chromosome.

Another surprise in the current study was that, like CAP-G2, the CAP-D3 C-tail also plays a negative regulatory role in condensin II functions as judged by multiple functional assays (Figure 4, Figure 4—figure supplement 1C, and Figure 6—figure supplement 1). This mode of regulation is unique to condensin II, because deletion of the CAP-D2 C-tail from the condensin I holocomplex causes no noticeable impact on mitotic chromosome assembly in Xenopus egg extracts (Figure 4—figure supplement 3; Kinoshita et al., 2022). Then, what might be the functional relationship between CAP-G2 and the CAP-D3 C-tail in condensin II regulation? The observation that deletion of the CAP-D3 C-tail has a greater impact on the holocomplex than on the ΔG2 subcomplex (Figure 4) suggests an overlap in the negative regulatory roles of CAP-G2 and the CAP-D3 C-tail (Figure 7A). A recent study using cross-linking mass spectrometry has revealed physical contacts between an N-terminal region of CAP-G2 and a C-terminal region of CAP-D3 (Kong et al., 2020). It is therefore possible that CAP-G2 interferes with the action of CAP-D3 by directly interacting with the CAP-D3 C-tail. Future experiments should test the hypothesis that mitosis-specific phosphorylation by Cdk1 of the CAP-D3 C-tail destabilizes the suppressing interaction, thereby activating CAP-D3-mediated axis assembly.

Despite the potential functional crosstalk between CAP-G2 and the CAP-D3 C-tail, it is important to note that the chromosome structure produced in Xenopus egg extract by holo(D3-dC) is qualitatively different from that produced by ΔG2(WT) and ΔG2(D3-dC). While ΔG2(WT) and ΔG2(D3-dC) accumulate at the axis of chromosomes in a dose-dependent manner, such accumulation does not cause enrichment of DNA at the axis (Figure 4—figure supplement 2B and C). Instead, ΔG2(WT) and ΔG2(D3-dC) shift the chromosomal DNA to elongate the overall axis while keeping their chenille-like morphology under high-dose conditions (Figure 7B). In contrast, holo(D3-dC) increases the DNA level at the axial region under a high-dose condition and produces rod-like chromosomes rather than chenille-like chromosomes. These observations suggest that CAP-G2 is not a mere inhibitor but has a rather cryptic function in the compaction of non-axial bulk chromatin (Figure 7A, right). However, this function of CAP-G2 is observed only when the holocomplex is overloaded on chromosomes by deleting the CAP-D3 C-tail. Intriguingly, we find that holo(D3-dC), but not ΔG2(WT), retains DNA-stimulated ATPase activity. Additional comparisons in the future may help further characterize the mechanistic differences between the two mutant complexes.

How might condensin II work?

Our previous work demonstrated that ATP binding and hydrolysis by the SMC subunits are essential for the functions of condensin I in Xenopus egg extracts (Kinoshita et al., 2015). When ATP hydrolysis-deficient mutations were introduced into the SMC ATPase subunits, the assembly of axes supported by the condensin II holocomplex or its subcomplex lacking CAP-G2 was completely inhibited (Figure 3). Thus, the SMC ATPase cycle is essential for the functions of condensin II, too, even in the absence of its inhibitory subunit CAP-G2.

Two basic patches (BC1 and BC2) present in the central region of budding yeast Brn1/CAP-H, together with Ycg1/CAP-G, have been proposed to form a unique DNA-binding region, referred to as the ‘safety belt’ (Kschonsak et al., 2017). Our previous study demonstrated that charge-reversal mutations (BC1/2D) in the corresponding region of the CAP-H subunit of mammalian condensin I cause ‘hyper-compaction’ phenotypes in Xenopus egg extracts (Kinoshita et al., 2022). In contrast, our current results show that the BC1/2D mutations in the CAP-H2 subunit of mammalian condensin II completely abolish its ability to associate with chromatin (Figure 5). Although the phenotypic differences observed between condensins I and II are intriguing, it should be noted that there has been no direct evidence to date that mammalian condensins use a safety-belt mechanism for DNA binding as demonstrated by budding yeast condensin. Even if a similar mechanism operates in mammalian condensin II, it is possible that the functional requirement for CAP-G2 is somewhat relaxed, as has been recently shown in condensin from the filamentous fungus Chaetomium thermophilum (Shaltiel et al., 2022). Moreover, it is worthy to note that ΔG2(H2-BC1/2D), but not holo(H2-BC1/2D), retains the ability to associate with chromatin, suggesting the existence of a loading pathway that is actualized in the absence of CAP-G2 (e.g. CAP-D3-dependent pathway). Future investigation is required to clarify this issue.

It has been proposed that the formation of consecutive loops through a mechanism of loop extrusion underlies mitotic chromosome assembly (Goloborodko et al., 2016). A recent single-molecule assay has demonstrated that a human condensin II holocomplex exhibits a loop extrusion activity in vitro, whose properties are slightly different from those of condensin I-mediated loop extrusion (Kong et al., 2020). At present, we do not know to what extent the loop extrusion activities measured for the two condensin complexes might directly be coupled to their actions exhibited under physiological conditions. In fact, a recent study from our laboratory has provided evidence that condensin I is equipped with a loop extrusion-independent mechanism that contributes to mitotic chromosome assembly and shaping in Xenopus egg extracts (Kinoshita et al., 2022). The gap that currently exists between the nanoscale single-molecule assays and the mesoscale chromosome assembly assays needs to be filled (Birnie and Dekker, 2021). As an initial step, we have devised an extract-free assay in which an Npm2-mediated swollen chromatin mass is used as a binding substrate for recombinant condensin complexes. This simple assay allowed us to recapitulate ATP-stimulated chromatin binding of condensin II, which in turn results in compaction of the chromatin mass. In the future, multiple functional in vitro assays, such as loop extrusion and reconstitution assays (Kinoshita et al., 2022; Kong et al., 2020; Shintomi et al., 2015), should be set up and combined to assess how condensins work on physiological templates and how their activities are regulated by cell cycle-dependent modifications.

Evolutionary implications

The current study has important implications for the evolution of condensin complexes. In contrast to condensin I, which plays an essential role in mitotic chromosome assembly and segregation in most eukaryotes examined so far, the occurrence and use of condensin II are variable among different species (Hirano, 2012). For instance, condensin II subunits are not present in fungi including S. cerevisiae. The plant A. thaliana and the primitive alga Cyanidioschyzon merolae possess all three non-SMC subunits of condensin II, but they are non-essential for chromosome assembly and segregation in mitosis (Fujiwara et al., 2013; Sakamoto et al., 2011). Intriguingly, the cap-g2 gene is missing in the genome of the fruit fly D. melanogaster (Herzog et al., 2013), although the cap-d3 and cap-h2 genes have meiotic functions and participate in interphase chromosome territory formation (Hartl et al., 2008; Rosin et al., 2018). Moreover, a recent survey has revealed recurrent losses and rapid evolution of the condensin II complex in insect species (King et al., 2019): among the genes encoding the non-SMC subunits of condensin II, cap-g2 has been lost most frequently during insect evolution. Our current results show that the mutant complex lacking CAP-G2 is able to support chenille-like chromosome assembly even at a lower concentration than the holocomplex. Thus, condensin II can fulfill its functions largely, if not completely, even without the CAP-G2 subunit, providing a possible explanation of why the cap-g2 gene tends to be lost during evolution in some species.

A recent three-dimensional genomics approach, which applies comprehensive Hi-C analyses to a wide variety of eukaryotic species, has reported that condensin II acts as a determinant of chromosome architectures, namely, Rabl-like or territory-like configuration (Hoencamp et al., 2021). The species analyzed in this study included those that possess or lack all condensin II-specific subunits, or those that lack CAP-G2 only. In the future, it will be of interest to understand how evolution has materialized condensin II complexes with different subunit compositions and how such variations have contributed to fine-tuning of chromosome structure and dynamics in the extant species.

Materials and methods

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Cell line (Spodoptera frugiperda)Sf9 insect cellsThermoFisher11496015
Cell line (Spodoptera frugiperda)High five insect cellsThermoFisherB85502
Strain, strain background (Escherichia coli)Max efficiency DH10Bac competent cellsThermoFisher10361012
Strain, strain background (Escherichia coli)BL21(DE3) competent cellswith lab cultured cellsN/AElectrocompetent cells
Biological sample (Xenopus laevis)Xenopus laevis eggHamamatsu Seibutsu-KyozaiRRID: NXR 0.031Female, adult frogs
Biological sample (Xenopus laevis)Xenopus laevis sperm nucleiHamamatsu Seibutsu-KyozaiRRID: NXR 0.031Male, adult frogs
Biological sample (Mus musculus)Mus musculus sperm nucleiShintomi et al., 2017; isolated from Mus musculus cauda epididymis (BALB/c×C57BL/6 J)F1N/AMale, adult mouse
Antibodyanti-Xenopus topoisomerase IIα (rabbit polyclonal serum)Hirano and Mitchison, 1994in house: αC1-6WB (1/2000)
Antibodyanti-XCAP-D2 (rabbit polyclonal)Hirano et al., 1997in house: AfR16LWB (1.0 μg/mL)
Antibodyanti-XCAP-G (rabbit polyclonal)Hirano et al., 1997in house: AfR11-3LWB (1.0 μg/mL)
Antibodyanti-XCAP-H (rabbit polyclonal)Hirano et al., 1997in house: AfR18WB (0.7 μg/mL)
Antibodyanti-XSMC2/XCAP-E (rabbit polyclonal)Hirano et al., 1997in house: AfR9-6WB (1.0 μg/mL)
Antibodyanti-XSMC4/XCAP-C (rabbit polyclonal)Hirano et al., 1997in house: AfR8LWB (2.0 μg/mL)
Antibodyanti-mSMC4 (rabbit polyclonal)Lee et al., 2011in house: AfR326-3LIF (1.0 μg/mL)
Antibodyanti-hCAP-H2 (rabbit polyclonal)Ono et al., 2003in house: AfR205-4LWB (0.8 μg/mL);
IF (3.0 μg/mL)
Antibodyanti-XCAP-D3 (rabbit polyclonal)Ono et al., 2003in house: AfR196-2LWB (2.0 μg/mL)
Antibodyanti-XCAP-H2 (rabbit polyclonal)Ono et al., 2003in house: AfR201-4WB (2.0 μg/mL)
Antibodyanti-XCAP-H2 (rabbit polyclonal)Ono et al., 2003in house: AfR202-2From the same antigen for AfR201; WB (2.0 μg/mL);
IF (3.0 μg/mL)
Antibodyanti-hCAP-D3 (rabbit polyclonal)ProteinTech Group16828–1-AP; RRID: AB_2282528WB (1.0 μg/mL)
AntibodyAlexa Fluor 568-conjugated anti-rabbit IgG (goat polyclonal)ThermoFisherA11036; RRID: AB_10563566IF (1/500)
Antibodyanti-hCAP-D3 pS1474
(rabbit polyclonal)
This paper; custom ordered from SIGMA Genosysin house: AfR358-3P2WB (1.0 μg/mL); refer to “Antibodies” subsection
Antibodyanti-hCAP-D3 pT1415
(rabbit polyclonal)
This paper; custom ordered from SIGMA Genosysin house: AfR364-3P2WB (1.0 μg/mL); refer to “Antibodies” subsection
Antibodyhorseradish peroxidase-conjugated anti-rabbit IgG (goat polyclonal)Vector LaboratoriesPI-1000; RRID: AB_2336198WB (1/20000)
Recombinant DNA reagentλ DNATaKara3010Used in ATPase assay
Sequence-based reagenthCAP-D3 STOP-to-Glycine forward primerThis paperN/Aggccgcgactagttccgttggcagtcttgag
Sequence-based reagenthCAP-D3 STOP-to-Glycine reverse primerThis paperN/Actcaagactgccaacggaactagtcgcggcc
Sequence-based reagent(3 C)-StrepII SpeI/NotI forward oligoThis paperN/Actagtggactggaagttctgttccaggggcccggatcttggagccatccgcaatttgaaaaaggt
ggcggttccggcggaggtagcggcggaggttcttggtctcaccctcagttcgagaagtaagc
Sequence-based reagent(3 C)-StrepII SpeI/NotI reverse oligoThis paperN/Aggccgcttacttctcgaactgagggtgagaccaagaacctccgccgctacctccgccggaacc
gccacctttttcaaattgcggatggctccaagatccgggcccctggaacagaacttccagtcca
Sequence-based reagentStrepII-(3 C) BamHI/EcoRI forward oligoThis paperN/Agatccatgtggagccatccgcaatttgaaaaaggtggaggctccggcggaggtagcggcggaggttcttgg
tctcaccctcagttcgagaagggaggcggatcactggaagttctgttccaggggcccgggg
Sequence-based reagentStrepII-(3 C) BamHI/EcoRI reverse oligoThis paperN/Aaattccccgggcccctggaacagaacttccagtgatccgcctcccttctcgaactgagggtgagaccaag
aacctccgccgctacctccgccggagcctccacctttttcaaattgcggatggctccacatg
Peptide, recombinant proteinPrecission ProteaseCytiva27-0843-01Used in purification of condensins
Peptide, recombinant proteinλ protein phosphataseNEBP0753
Peptide, recombinant proteinBenzonaseNovagen71205-3CNUsed in purification of condensins
Peptide, recombinant proteinBamHI restriction enzymeTaKaRa1010
Peptide, recombinant proteinEcoRI restriction enzymeTaKaRa1040
Peptide, recombinant proteinNotI restriction enzymeTaKaRa1166
Peptide, recombinant proteinSpeI restriction enzymeTaKaRa1086
Peptide, recombinant proteinT4 polynucleotide kinaseTaKaRa2021
Commercial assay or kitQuikChange II XL Site-Directed Mutagenesis KitAgilent Technologies200522
Commercial assay or kitDNA Ligation KitTaKaRa6022
Commercial assay or kitEnzChek Phosphate Assay KitThermoFisherE6646
Software, algorithmUNICORN 7CytivaN/A
Software, algorithmPrism 8GraphPadN/A
Software, algorithmExcelMicrosoftN/A
Software, algorithmOlympus cellSens DimensionsOlympusN/A
Software, algorithmPhotoshopAdobeN/A
Software, algorithmImageJSchneider et al., 2012https://imagej.nih.gov/ij/
Software, algorithmSparkControlTecan Life SciencesN/A
OtherCoomassie Brilliant Blue R-250 staining solutionBio-Rad1610436For polyacrylamide gels
OtherAmersham Protran Premium 0.45 nitrocellulose membraneCytiva10600047For Western blots
OtherGlutathione Sepharose 4BCytiva17075601Used for purification of condensin I
OtherHiTrap Q HP 1 mLCytiva17115301Used for purification of condensins
OtherStrepTactin Sepharose HPCytiva28-9355-99Used for purification of condensin II
OtherDAPIRoche10236276001(2 μg/mL)
OtherATPSigma-AldrichA2383Used in ATPase assay and Npm2-treated chromatin binding assay
OtherDynabeads Protein AThermoFisher10002DFor immunodepletion with Xenopus egg extract
OtherAlexa Flour 488-conjugated streptavidinThermoFisherS32354IF (1/2000)
  1. SMC: structural maintenance of chromosomes.

Antibodies

Primary antibodies used in the current study were as follows: anti-XSMC4/XCAP-C (in-house identifier: AfR8L, affinity-purified rabbit antibody), anti-XSMC2/XCAP-E (AfR9-6, affinity-purified rabbit antibody), anti-XCAP-D2 (AfR16L, affinity-purified rabbit antibody), anti-XCAP-G (AfR11-3L, affinity-purified rabbit antibody), anti-XCAP-H (AfR18-3L, affinity-purified rabbit antibody; Hirano et al., 1997; Hirano and Mitchison, 1994), anti-XCAP-D3 (AfR196-2L, affinity-purified rabbit antibody), anti-XCAP-H2 (AfR201-4 and AfR202-2, affinity-purified rabbit antibodies; Ono et al., 2003), anti-Xenopus topoisomerase IIα (in-house identifier: αC1-6, rabbit anti-serum; Hirano and Mitchison, 1994), anti-mSMC4 (AfR326-3L, affinity-purified rabbit antibody; Lee et al., 2011), anti-hCAP-H2 (AfR205-4L, affinity-purified rabbit antibody; Ono et al., 2003), and anti-hCAP-D3 (16828–1-AP [RRID:AB_2282528], polyclonal rabbit antibody, ProteinTech Group). Custom phospho-specific antibodies against cysteine-included hCAP-D3 pT1415 peptide (C-VTKRAISpTPEK; in-house identifier: AfR364-3P2) and hCAP-D3 pS1474 peptide (C-QQWNVRpSPARNK; in-house identifier: AfR358-3P2) were generated commercially (SIGMA Genosys). Secondary antibodies used in the current study were as follows: horseradish peroxidase-conjugated anti-rabbit IgG (PI-1000 [RRID: AB_2336198], Vector Laboratories, goat antibody), Alexa Fluor 568-conjugated anti-rabbit IgG (A11036 [RRID: AB_10563566], ThermoFisher, goat antibody), and Alexa Fluor 488-conjugated streptavidin (S32354, ThermoFisher).

Experimental models

Request a detailed protocol

Female Xenopus laevis frogs (RRID: NXR 0.031, Hamamatsu Seibutsu-Kyozai) were used to lay eggs to harvest Xenopus egg extract (Hirano et al., 1997). Male X. laevis frogs (RRID: NXR 0.031, Hamamatsu Seibutsu-Kyozai) were dissected to prepare sperm nuclei from testes (Shintomi and Hirano, 2017). Frogs were used in compliance with the institutional regulations of the RIKEN Wako Campus. Mice (BALB/c×C57BL/6 J)F1) for sperm nuclei (Shintomi et al., 2017) were used in compliance with protocols approved by the Animal Care and Use Committee of the University of Tokyo (for M. Ohsugi who provided mouse sperm).

All recombinant condensin complexes were expressed using insect cell strains from the Bac-to-Bac Baculovirus Expression System (ThermoFisher) as previously described (Kinoshita et al., 2015; Kinoshita et al., 2022). Bacmid DNAs were prepared from pFastBac constructs from DH10Bac (10361012, ThermoFisher) according to the manufacturer’s instructions and baculoviruses were expressed in Sf9 insect cells (11496015, ThermoFisher) by transfection using Cellfectin II (ThermoFisher) for 7 days before being amplified twice in Sf9 cells for 7 days each. For protein expression, High Five insect cells (B85502, ThermoFisher; 1.2–2.4×108 cells) were co-transfected with the recombinant viruses of appropriate combinations and were grown at 28°C for 60–72 hr.

Recombinant X. laevis Npm2 was expressed in Escherichia coli BL21(DE3) cells as previously described (Shintomi et al., 2015).

Plasmid construction and mutagenesis

Request a detailed protocol

Constructs for expressing mSMC2, mSMC4 and their mutant forms were created as previously described (Kinoshita et al., 2015). Codon-optimized cDNAs encoding human non-SMC subunits (hCAP-D3, hCAP-G2, and hCAP-H2), based on the amino acid sequence information from Onn et al., 2007, were synthesized by ThermoFisher and subcloned into pFastBac1 between EcoRI and SpeI restriction sites. The following oligonucleotides were used to prepare StrepII-tagged hCAP-D3 and hCAP-H2 DNA constructs: hCAP-D3 STOP-to-Glycine forward primer: 5’-ggccgcgactagttccgttggcagtcttgag-3’ hCAP-D3 STOP-to-Glycine reverse primer: 5’-ctcaagactgccaacggaactagtcgcggcc-3’.

(3 C)-StrepII SpeI/NotI forward oligo: 5’-ctagtggactggaagttctgttccaggggcccggatcttggagccatccgcaatttgaaaaaggtggcggttccggcggaggtagcggcggaggttcttggtctcaccctcagttcgagaagtaagc-3’.

(3 C)-StrepII SpeI/NotI reverse oligo:

5’-ggccgcttacttctcgaactgagggtgagaccaagaacctccgccgctacctccgccggaaccgccacctttttcaaattgcggatggctccaagatccgggcccctggaacagaacttccagtcca-3’.

StrepII-(3 C) BamHI/EcoRI forward oligo:

5’-gatccatgtggagccatccgcaatttgaaaaaggtggaggctccggcggaggtagcggcggaggttcttggtctcaccctcagttcgagaagggaggcggatcactggaagttctgttccaggggcccgggg-3’.

StrepII-(3 C) BamHI/EcoRI reverse oligo: 5’-aattccccgggcccctggaacagaacttccagtgatccgcctcccttctcgaactgagggtgagaccaagaacctccgccgctacctccgccggagcctccacctttttcaaattgcggatggctccacatg-3’.

To create the hCAP-D3 construct with a C-terminal StrepII-tag (pFastBac1-hCAP-D3-StrepII), the stop codon was first mutagenized to glycine using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent Technologies) with the STOP-to-glycine primers. StrepII oligos with a 3C protease cleavage site within the N-terminal linker sequence were annealed by slow cooling from 95°C, phosphorylated by T4 polynucleotide kinase (TaKaRa) and inserted between SpeI and NotI restriction sites (pFastBac1-hCAP-D3-[3C]-StrepII) by using restriction enzymes and a DNA ligation kit (TaKaRa). To create the hCAP-H2 construct with an N-terminal StrepII-tag (pFastBac-StrepII-[3C]-hCAP-H2), StrepII oligos with a 3C protease cleavage site within the C-terminal linker sequence were annealed by slow cooling from 95°C, phosphorylated by T4 polynucleotide kinase (TaKaRa), and inserted between BamHI and EcoRI restriction sites by using restriction enzymes and a DNA ligation kit (TaKaRa). Constructs of hCAP-H2 harboring charge-reversal mutations in the BC1 and BC2 regions (H2-BC1D, BC2D, and BC1/2D) were synthesized by ThermoFisher and subcloned into pFastBac1. For the construction of hCAP-D3-dC, a cDNA was synthesized by ThermoFisher so that part of the core amino acid sequence of the 3C protease cleavage site (LFQG) was inserted between hCAP-D3 V1297 and P1298 within the hCAP-D3-StrepII construct. Constructs for recombinant condensin I complexes were prepared as previously described (Kinoshita et al., 2022). Human CAP-D2 was used for condensin I holo(WT) while a version that truncates 92 amino acids from the C-terminus (hCAP-D2-dC) was used for condensin I holo(D2-dC).

Purification of recombinant condensins

Request a detailed protocol

For the expression of recombinant condensin complexes, the Bac-to-Bac Baculovirus Expression System (ThermoFisher) was used as described above in the Experimental models subsection. Some modifications were made to the procedure described previously (Kinoshita et al., 2022). For recombinant condensin II complexes, baculoviruses used were a combination of mSMC2, GST-mSMC4, hCAP-D3, hCAP-G2, and hCAP-H2. Condensin II wild-type or ATPase TR mutant holocomplexes and ΔG2 subcomplexes, untagged hCAP-D3 was replaced with hCAP-D3-StrepII. For ΔD3 subcomplex and ΔD3ΔG2 subcomplex, untagged hCAP-H2 was replaced with StrepII-hCAP-H2. For complexes that require hCAP-D3-dC, hCAP-D3-StrepII with 3C protease cleavage site insertion between V1297 and P1298 was expressed. Cells expressing condensin II subunits were harvested into pellets, snap-frozen, and stored at −80°C until purification. Cell pellets were resuspended in 20 mL of lysis buffer (10 mM K-HEPES [pH 7.7], 150 mM KCl, 2 mM MgCl2, 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of complete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication, and clarified by centrifugation. The KCl concentration of the supernatants was adjusted to 300 mM by adding extra KCl and incubated with 2 mL of StrepTactin Sepharose HP beads (Cytiva) at 4°C for 1–2 hr. The beads were then packed into a 12 mL disposable column (Gold Biotechnology), washed with ice-cold purification buffer (10 mM K-HEPES [pH 7.7], 300 mM KCl, 2 mM MgCl2, 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, and 1 mM DTT) four times, and incubated with 5 mL of purification buffer containing 2 mM ATP and 10 mM MgCl2 at room temperature for 15 min twice. After an additional wash with purification buffer, the beads were treated with PreScission Protease (Cytiva) in purification buffer at 4°C overnight to cleave GST and StrepII tags. In the case of holo(D3-dC), PreScission Protease removes the CAP-D3 C-tail by cleaving the 3C site inserted between V1297 and P1298. Cleaved complexes were collected from the column with purification buffer. The eluted fractions were diluted threefold with Buffer A (40 mM Tris [pH 7.5]) to 100 mM KCl and loaded onto a HiTrap Q HP 1 mL column (Cytiva) for ion-exchange chromatography using ÄKTA pure 25 with UNICORN 7 software (Cytiva). Proteins were eluted using a linear gradient from 100 to 1000 mM NaCl with Buffer A and Buffer B (40 mM Tris [pH 7.5] and 1 M NaCl). Fractions containing released condensin II complexes were pooled and dialyzed in condensin II protein buffer (20 mM HEPES [pH 7.7], 150 mM KCl, and 0.5 mM DTT) twice before being concentrated with Amicon Ultra 50 K centrifugal tubes (Merck Millipore). Alternatively, pooled fractions underwent buffer exchange (40 mM Tris [pH 7.5] and 300 mM NaCl) three times using Amicon Ultra tubes before being concentrated (used in Figure 2A and Figure 2—figure supplement 1C). The stoichiometry of condensin II subunits for each preparation was checked by 5% SDS-PAGE followed by Coomassie Brilliant Blue R-250 (Bio-Rad) staining. Gels were imaged with Amersham Imager 680 (Cytiva). Phosphatase treatment of a purified sample, as described in the Dephosphorylation Assay subsection, caused one of the two bands positive for anti-hCAP-H2 to migrate faster (Figure 1—figure supplement 1E), showing that a fraction of hCAP-H2 is phosphorylated in the host insect cells. Expression and purification of recombinant condensin I complexes were performed as previously described (Kinoshita et al., 2022). Condensin I holo(WT) was expressed with full-length hCAP-D2 while holo(D2-dC) was expressed with hCAP-D2 lacking 92 amino acids at the C-terminus (hCAP-D2-dC). Condensin I was bound to Glutathione Sepharose 4B beads (Cytiva) in a 5 mL polypropylene column (Qiagen) using GST-tagged mSMC4 and eluted by PreScission Protease (Cytiva) by cleaving the GST-tag. Eluates were collected for ion exchange chromatography as described above. Pooled fractions underwent buffer exchange (40 mM Tris [pH 7.5] and 300 mM NaCl) before being concentrated using Amicon Ultra tubes. The stoichiometry of condensin I subunits for each preparation was checked by 6% SDS-PAGE (Figure 4—figure supplement 3B). Concentrations of recombinant proteins were measured by NanoDrop OneC (ThermoFisher).

Dephosphorylation assay

Request a detailed protocol

Recombinant condensin II holo(WT) at 500 nM was mixed with or without λ protein phosphatase (NEB) at a final concentration of 400 U/µL in 1 x NEBuffer for Protein MetalloPhosphatases supplemented with 1 mM MnCl2 and incubated at 30°C for 60 min. Aliquot samples were taken at 0 and 60 min. Samples were analyzed by immunoblotting. The protein samples were subjected to 7.5% SDS-PAGE and transferred onto a nitrocellulose membrane (Cytiva). The membrane was blocked with 5% skim milk in TBS-T (25 mM Tris [pH 7.5], 0.15 M NaCl, and 0.05% Tween 20) before probing with appropriate affinity-purified rabbit hCAP-H2 antibody in 1% BSA in TBS (25 mM Tris [pH 7.5] and 0.15 M NaCl) followed by horseradish peroxidase-conjugated anti-rabbit IgG (Vector Laboratories) in TBS-T. After washing, the membrane was imaged with Amersham Imager 680 (Cytiva).

ATPase assay

Request a detailed protocol

ATPase assays were performed using the EnzChek Phosphate Assay Kit (Invitrogen). 50 μL reactions contained 200 nM recombinant condensin II in reaction buffer (40 mM Tris [pH 7.5] 15 mM NaCl, 10 mM KCl, 7.5 mM MgCl2, and 2.5 mM ATP), supplemented with 1 × MESG substrate and 1 × purine nucleoside phosphorylase, with or without 1.59 nM (50 μg/μL) bacteriophage λ DNA (48,502 bp; TaKaRa). The ratio between condensin II and λ DNA was 1 condensin II: 385 bp of DNA. Reactions were placed at 37°C on a 384-well microplate (Greiner Bio-One), and analyzed by spark multimode microplate reader with SparkControl software (Tecan). The initial ATPase rate from timepoint 2.5 min to 7.5 min was determined as ATP molecules hydrolyzed per condensin II complex per min.

Preparation of Xenopus egg extracts

Request a detailed protocol

Metaphase high-speed supernatants (M-HSS) of Xenopus egg extracts were prepared as previously described (Hirano et al., 1997). In brief, X. laevis unfertilized eggs were crushed by low-speed centrifugation in XBE2 buffer (10 mM HEPES [pH 7.7], 100 mM KCl, 2 mM MgCl2, 0.1 mM CaCl2, 5 mM EGTA, and 50 mM sucrose). Low-speed supernatant was further fractionated by centrifugation at 200,000 × g for 90 min. The resulting high-speed supernatant was used as a Xenopus egg extract for experiments reported in the current study. Immunodepletion was performed using Dynabeads Protein A (ThermoFisher) and DynaMag-2 (Invitrogen) as previously described (Kinoshita et al., 2022) with some modifications. To prepare 100 µL of condensin I-depleted (Δcond I) extract, 25 µg of affinity-purified anti-XCAP-D2 were coupled to 100 µL of beads for the first round of depletion, and 25 µg of affinity-purified anti-XCAP-G was coupled to the same vol. of beads for the second round of depletion. To prepare 100 µL of condensins-depleted (Δcond I/II) extract, a mixture of antibodies containing 12.5 μg of affinity-purified anti-XCAP-D2, 6.25 μg affinity-purified anti-XSMC4, and 6.25 μg affinity-purified anti-XSMC2 was coupled to 100 μL of beads for the first round of depletion. Another mixture of antibodies containing 6.25 μg each of affinity-purified anti-XCAP-D3, anti-XSMC2, anti-XCAP-G, and anti-XCAP-H2 (AfR201) was coupled to another 100 μL of beads for the second round of depletion. An extract was incubated with the first beads on ice for 30 min followed by incubation with the second beads on ice for another 30 min. The resulting supernatant was separated from the beads and used as an immunodepleted extract (Δcond I or Δcond II). For mock depletion (Δmock), 25 µg of rabbit IgG (Sigma-Aldrich) was coupled to 100 μL of beads for both the first and second rounds of depletion. The efficiency of immunodepletion was checked by immunoblotting as described above in the Dephosphorylation assay subsection. The membrane was blocked with 5% skim milk in TBS-T before probing with appropriate affinity-purified rabbit antibodies or rabbit serum (anti-XSMC2, XSMC4, XCAP-D2, XCAP-G, XCAP-H, XCAP-D3, XCAP-H2 [AfR201 and AfR202], and XTopo IIα; Hirano et al., 1997; Hirano and Mitchison, 1994; Ono et al., 2003) in 1% BSA in TBS followed by horseradish peroxidase-conjugated anti-rabbit IgG (Vector Laboratories) in TBS-T. After washing, the membrane was imaged with Amersham Imager 680 (Cytiva).

Mitotic phosphorylation in egg extracts

Request a detailed protocol

Mock-depleted (Δmock) or condensins-depleted (Δcond I/II) extracts were supplemented with purified recombinant condensin II complexes or a control condensin II protein buffer and incubated at 22°C for 60 min. Aliquots were taken at 0, 30, and 60 min and analyzed by immunoblotting as described above in the Dephosphorylation assay subsection. Membranes were probed with rabbit XTopo IIα serum and a rabbit polyclonal anti-hCAP-D3 antibody (ProteinTech Group) in 1% BSA in TBS. When using rabbit anti-phospho-hCAP-D3 antibodies, membranes were blocked with 1% BSA (instead of 5% skim milk) in TBS-T.

Chromosome assembly in egg extracts

Request a detailed protocol

For condensin II-mediated chromosome assembly assays, condensins-depleted (Δcond I/II) extracts were supplemented with purified recombinant condensin II complexes or a control protein buffer and pre-incubated at 22°C for 30 min. Demembranated mouse sperm nuclei were purified as previously described by Shintomi et al., 2017. Mouse sperm nuclei were added at a final concentration of about 500–1000 nuclei/μL with an energy-regenerating mixture (1 mM ATP, 10 mM phosphocreatine, and 50 μg/mL creatine kinase) and incubated for another 150 min. The reaction mixtures were fixed by adding 10 × vol. of a fixation solution (10 mM HEPES [pH 7.7], 100 mM KCl, 1 mM MgCl2, and 4% formaldehyde) and incubated at 22°C for 15 min. In the time-course experiments (Figure 2—figure supplement 1C), sperm nuclei were added at 0 min and aliquots were taken at time intervals and fixed as above. The fixed samples were loaded onto a 30% glycerol cushion made in 0.5 × XBE2 buffer with a coverslip set inside each tube, and spun down at 5000 rpm at 4°C for 15 min. For condensin I-mediated chromosome assembly assay (Figure 4—figure supplement 3), condensins-depleted (Δcond I/II) extracts were supplemented with recombinant condensin I (holo[WT] or holo[D2-dC]) at a final concentration of 35 nM and preincubated at 22°C for 15 min. Mouse sperm nuclei were added and incubated for another 150 min before being treated as described above and as previously described (Kinoshita et al., 2022). The coverslips were recovered from the tubes and processed for immunofluorescence labeling as described below in the immunofluorescence labeling subsection.

Npm2-treated chromatin binding assay

Request a detailed protocol

A core domain of X. laevis nucleoplasmin (Npm2 [ΔC50]; 1–149 a.a.) was expressed and purified from BL21(DE3) cells as previously described (Shintomi et al., 2015). Xenopus sperm nuclei, prepared as previously described (Shintomi and Hirano, 2017), were incubated with 50 μM Npm2 and 2 mM ATP in KMH buffer (100 mM KCl, 2.5 mM MgCl2, and 20 mM HEPES [pH 7.7]) at 22°C for 30 min. Recombinant condensin II diluted in KMH buffer was added to the mixture at a 1:1 volume so that the final concentrations of condensin II and ATP were 50 nM and 1 mM, respectively, and incubated at 22°C for 120 min. The reaction mixtures were fixed by adding 10 volume of the fixation solution, incubated at 22°C for 15 min, and spun down onto coverslips as described above in the Chromosome assembly in egg extracts subsection. The samples on coverslips were processed for immunofluorescence labeling as described below in the immunofluorescence labeling subsection.

Immunofluorescence labeling

Request a detailed protocol

Immunofluorescence labeling of chromosomes assembled in extracts was performed as described previously (Kinoshita et al., 2022) with some modifications. Fixed chromosome samples were spun down onto coverslips, washed with TBS-Tx (25 mM Tris [pH 7.5], 0.15 M NaCl, and 0.1% Triton X-100) three times, and blocked with 1% BSA in TBS-Tx at room temperature for 30–60 min. For immunolabeling, coverslips were incubated with 1% BSA in TBS-Tx containing 3 µg/mL anti-XCAP-H2 (AfR202), anti-hCAP-H2 (AfR205; Ono et al., 2003), or biotin-labeled anti-hCAP-H2 at room temperature for 60 min. The coverslips were then washed with TBS-Tx three times and incubated with 1% BSA in TBS-Tx containing a secondary antibody (Alex Fluor 568-conjugated anti-rabbit IgG [1:500; ThermoFisher] or Alexa Fluor 488-conjugated streptavidin [1:2000; ThermoFisher]) at room temperature for 60 min. Finally, the coverslips were incubated with 2 µg/mL DAPI in TBS-Tx for 5 min, washed with TBS-Tx three times, and mounted onto microscope slides with Vectashield H-1000 mounting medium (Vector Laboratories). Immunofluorescence labeling of recombinant condensin I complex was processed as above except with 1 µg/mL rabbit anti-mSMC4 antibody (Lee et al., 2011) and Alexa Fluor 568-conjugated anti-rabbit IgG (1:500; ThermoFisher) as previously described (Kinoshita et al., 2022).

Quantification and statistical analysis

Request a detailed protocol

Fluorescence microscopy was performed using an Olympus BX63 microscope equipped with a U Plan S-Apo 100 x/1.40 oil immersion lens (Olympus) and ORCA-Flash 4.0 digital CMOS camera C11440 (Hamamatsu Photonics). Olympus cellSens Dimension software (Olympus) was used for image acquisition, and brightness of some image sets in the current study was digitally increased using the exposure setting of Photoshop (Adobe) with the same value to treat each sample within each dataset in the same way. In the case of Figure 3A, hCAP-H2 images were first taken at a single time exposure (1/3 ×), and then signals were increased digitally threefolds (1 ×; exposure setting = +2). For colored images (Figure 1D), grayscale images were placed in RGB channels using Photoshop (Adobe). ImageJ software (Schneider et al., 2012; https://imagej.nih.gov/ij/) was used for quantitative analyses of chromosome and nuclei samples from unedited images. All images used for quantification measurements were captured with identical exposure times that did not cause saturated signals per independent experiment. For quantitative measurements of the signal intensity of DNA, hCAP-H2, and mSMC4 for profiles of chromosome axes, DAPI and immunofluorescence signals were measured on a scanned line perpendicular to the axis at a chromosomal DNA region without DAPI-enriched satellite DNA using the plot profile function as previously described (Kinoshita et al., 2022). The three independent experiments mentioned in the legend of Figure 2D are separate from the three independent experiments mentioned in legends of Figure 4 and Figure 4—figure supplement 2. For signal intensity quantifications, DAPI and immunofluorescence signals (hCAP-H2) were segmented from the image using the threshold function and the signals in the threshold-selected regions were measured first. The measured immunofluorescence signal (hCAP-H2) was divided by the measured DAPI signal to achieve the hCAP-H2/DAPI signal intensity on chromosomes or swollen chromatin. To calculate the percentage of hCAP-H2 on the axis (hCAP-H2 axis/total intensity) used in Figure 5C, the immunofluorescence signal of hCAP-H2 on the axis was segmented from the image using a threshold function with a higher value that only selects the accumulated signal on the chromosome axis and the signal in threshold-selected axis regions were measured. The hCAP-H2 signal at the axis was divided by the overall hCAP-H2 signal on the chromosome to achieve the percentage of hCAP-H2 signal on the axis (hCAP-H2 axis/total intensity). The sample size (cluster of chromatids or swollen chromatin) counted for each experiment is described in the appropriate figure legends. Mean values, SD (error bars), and statistical test values are represented in each figure and described in each figure legend whenever appropriate. All data sets were handled with the Microsoft Excel software (Microsoft) and graphs were created using the GraphPad Prism software (GraphPad).

Materials availability

Request a detailed protocol

All unique/stable reagents generated in this study are available from the corresponding author.

Data availability

All data generated or analyzed during this experimental study are included in the manuscript as source data.

References

Decision letter

  1. Adèle L Marston
    Reviewing Editor; University of Edinburgh, United Kingdom
  2. Jessica K Tyler
    Senior Editor; Weill Cornell Medicine, United States
  3. Adèle L Marston
    Reviewer; University of Edinburgh, United Kingdom
  4. Alexander E Kelly
    Reviewer; National Cancer Institute, United States

Our editorial process produces two outputs: (i) public reviews designed to be posted alongside the preprint for the benefit of readers; (ii) feedback on the manuscript for the authors, including requests for revisions, shown below. We also include an acceptance summary that explains what the editors found interesting or important about the work.

Decision letter after peer review:

Thank you for submitting your article "Molecular dissection of condensin II-mediated chromosome assembly using in vitro assays" for consideration by eLife. Your article has been reviewed by 3 peer reviewers, including Adèle L Marston as Reviewing Editor and Reviewer #1, and the evaluation has been overseen by Jessica Tyler as the Senior Editor. The following individual involved in the review of your submission has agreed to reveal their identity: Alexander E Kelly (Reviewer #2).

The reviewers have discussed their reviews with one another, and the Reviewing Editor has drafted this to help you prepare a revised submission.

Essential revisions:

1) The use of mouse sperm nuclei, instead of Xenopus sperm nuclei, for the majority of the analyses is not explained by the authors, and there is a concern that this could be altering or masking phenotypes. In this work, depletion of condensin I results in changes to mouse chromatid morphology, but they are still individualized and there is axially localized condensin. However, in previous papers from the lab (Ono et al., Cell, 2003), depletion of condensin I caused the complete loss of condensation and individualization when Xenopus sperm nuclei were used, similar to the depletion of condensin I and II. It is very important that the authors address this directly, as they did in a previous paper (Kinoshita et al., JCB, 2022) where they demonstrated differential effects of certain condensin I mutants depending on the nuclei source. Specifically, the authors should justify the use of mouse sperm in the manuscript in light of their previous findings, and perform key analyses (condensin I depletion, as well as analysis of the G2, D3, and D3 tail mutants) using Xenopus sperm. Since it was previously suggested that mouse nuclei are not as dependent on topo II in this system (Shintomi et al., Science, 2017), it might be useful to see if the addition of extra topo II to condensin I-depleted extracts containing Xenopus sperm allows for a similar level of condensin-II dependent condensation that is observed with mouse nuclei.

2) More generally, the authors should explain and discuss in more detail their choice to choose to use Xenopus extract, mouse and human proteins, and mouse nuclei. How can the authors exclude that the observed effects are not due to the heterologous systems?

3) The depletion of the Xenopus CAP-H2 subunit is incomplete in the condI/II depleted extracts (Figure 2—figure supplement 1A). Furthermore, a previous paper from the lab demonstrated that Xenopus CAP-G2 is only partially depleted using a similar depletion scheme (Ono et al., Cell, 2003, Figure 5B). A main focus of the work is the role of CAP-G2. However, the depletion of xCAP-G2 from Xenopus extracts is not documented (in contrast to many or all other condensin I and condensin II subunits) (Figure 2- supplement 1).

Thus, there are likely significant amounts of CAP-H2 and CAP-G2 in the condI/II depleted extracts, which could be incorporated into the recombinant mouse/human condensin II complexes. In support of this, there is clear axial staining of Xenopus CAP-H2 in the "rec cond II holo (WT)" condition, but not the buffer only condition, in condI/II depleted extracts (Figure 1B). This is important, as residual levels of xCAP-G2 may confuse the interpretation of the role of this subunit (the self-inhibition could be explained by an excess of CAP-G2). This could be especially problematic when analyzing the effects of recombinant complexes that do not contain G2 or in which H2 was mutated, especially at lower concentrations of the complexes (see below). The authors should quantify the levels of Xenopus CAP-H2 and CAP-G2 on chromatids in all conditions in Figure 1B, as well as provide the levels of mouse SMC2 or SMC4 in the add-back conditions since mouse H2 may not properly reflect the total levels of condensin II on chromatids in the depletion/add-back system. They should also attempt a third round of depletion using anti-XCAP-G and anti-XCAP-H2 antibodies to more completely remove these subunits, and repeat Figures 2C, 4D, and 5B, which are key findings of the paper. If antibodies are not available, proteomics might be suitable to address this point. If this depletion is not technically feasible, the authors should provide clear caveats in the manuscript, and if possible clear up any misunderstandings.

4) Related to points 1 and 3, the concentration of recombinant condensin II complexes in many experiments is 200 nM, including the holo(WT) condition. However, the endogenous concentration of non-SMC condensin II subunits in Xenopus egg extracts is much lower (~20-30 nM; Wuhr et al., 2014). Given the dose-dependence effects of the holo(WT) complex on chromatid structure (Figure 2—figure supplement 1B), this would suggest that the mouse/human hybrid complex used here is somehow less active, either due to protein folding issues or evolutionary differences. Alternatively, the high concentration of holo(WT) complexes used here may be required to overcome the loss of a factor that was depleted from extracts that are not present in the purified complex. Further, condensin I complexes are present at ~5 times the concentration of condensin II in egg extracts (Shintomi and Hirano, G and D, 2011), and this difference in relative amounts has been proposed to underlie the reason why condensin II plays a relatively minor role in condensation in egg extracts compared to condensin I. The authors should provide an explanation for why this concentration was used since at 50 nM, which is more similar to endogenous levels of condensin II, holo(WT) was much less effective in promoting chromatid structure when compared to endogenous condensin II (Figure 2—figure supplement 1B vs Figure 1B).

5) Furthermore, it appears that the kinetics of condensation in the ∆cond I/II + condensin II holo(WT) condition (Figure 2—figure supplement 1C) are quite slow compared to WT extracts containing mouse sperm (see Shintomi et al., Science, 2017). The authors should compare the condensation kinetics of WT, cond I -depleted, and ∆cond I/II + condensin II holo(WT) extracts. If cond I-depleted assembly kinetics are more similar to WT than to ∆cond I/II + condensin II holo(WT), this could compromise the validity of the add-back system that forms the basis of the work.

6) It is puzzling that the basic amino acid clusters of CAP-H2, which are supposed to bind DNA and together with CAP-G2 form the safety belt, is essential for DNA binding and certain activity in chromosome condensation, while the CAP-G2 subunit appears dispensable. The authors do not provide an adequate explanation for this finding. Do the basic amino acid clusters act independently of the safety belt and of CAP-G2?

7) Moreover, the H2-BC1/2D mutant complex (lacking the basic residues) is still inhibited by the presence of CAP-G2 (as suggested in Figure 5 —figure supplement). This implies that the basic amino acid clusters are (only?) needed to overcome the inhibition by CAP-G2 but they are not needed for the inhibition itself. This should be more clearly discussed in the manuscript.

8) In the Abstract: 'play positive and negative roles, respectively' is too oversimplified. Depletion experiments globally reveal such roles, but the reality is more complicated with all subunits contributing to the mechanism (positively).

9) Many of the conclusions are backed up by a single representative image. Quantification for all the assays underlying the key conclusions in the manuscript should be presented. In addition, better reporting is required in the figure legends. How many times was each assay performed? How many nuclei were examined in each case?

Please also respond to additional points raised by individual reviewers below.

Reviewer #1 (Recommendations for the authors):

1. One of the most interesting findings in the manuscript is the potential relationship between CAP-G2 C terminal region and CAP-D2. The authors speculate that phosphorylation could regulate this relationship. Could the authors test this in their assay?

2. How do the levels of condensin on chromosomes in this assay compare to the levels in vivo? Could the effects observed be due to greatly elevated levels?

Reviewer #2 (Recommendations for the authors):

1) Figure 6 doesn't seem to add much new insight, and it is odd that the authors use Xenopus sperm in this figure only and don't explain their motivation for this. Thus, I feel it should either be removed from the paper or be moved to supplementary info.

2) The paper would be significantly enhanced with further mechanistic insights into the repressive function of the D3 tail. This could be achieved through phospho-mimetic mutations, and/or through the addition of excess D3 tail to the D3-dC condition to see if it can be inhibited in trans.

3) The cartoon in Figure 1D seems more appropriate for the Discussion and Figure 7. To my knowledge, the authors do not provide direct evidence for the loops and axis featured in 1D, which would require Hi-C experiments.

4) In Figure 1D, for the quantification of the line scans, it would be useful to have chromosomes assembled in WT extracts included so that the reader can be sure of the differences between WT chromosome morphology and "chenille" morphology shown in the representative images are borne out quantitatively.

5) In the ATP-hydrolysis assays in Figure 3, the authors show that ∆G2(WT) mutants have increased ATP activity compared to holo(WT), both with and without dsDNA as a substrate. Given prior work from the lab demonstrating that condensin I goes through continuous cycles of ATP-hydrolysis-dependent turnover in Xenopus egg extracts and that transition state mutations slow this turnover rate, it would be interesting to investigate the kinetics of ∆G2(WT) condensin II turnover. If enhanced ATP-hydrolysis were to be a causal factor in the high chromosomal accumulation of condensin II in ∆G2(WT) mutants (which the authors are careful not to claim outright), then we might expect to see an increased rate of condensin II turnover in ∆G2(WT) cond II compared to holo(WT) cond II as well. Such a result would strengthen the possibility of a mechanistic link between CAP-G2's negative regulation of ATP hydrolysis and its negative regulation of condensin II loading on chromosomes. This could be easily tested with the type of two-color assays this lab has previously performed on condensin I mutants.

6) Also in regard to the ATP-hydrolysis assay in Figure 3, it would be worthwhile to include ∆D3(WT) and ∆H2(WT) mutants for completeness. For example, maybe the enhanced ATP-hydrolysis ability of ∆G(WT) isn't specific to CAP-G function, but is instead a result related to sterics, wherein deletion of any of the condensin non-SMC subunits allows more room for ATP to bind and undergo hydrolysis. Demonstrating that ∆D3(WT) does not have increased ATP-hydrolysis activity compared to holo(WT) would eliminate this possibility and further support the notion of CAP-D3 playing a positive role in the chromosomal accumulation of condensin II and axis formation.

7) The authors write that at 200nM, the structures formed by holo(D3-dC) "were no longer chenille-like," but instead "reminiscent of rod-shaped chromosomes produced by condensin I". It does appear that the chromosome axes are better defined in this condition, as confirmed by the line scans in Figure 4C. However, in order to justify the comparison, the authors should include WT chromosomes both in the representative images in 4B and in the line scans in 4C. After all, the difference in the shape of the normalized DAPI intensity distribution (Figure 4C) is not enormous (and there is no statistical analysis of it), so having the WT distribution for comparison would allow the reader to evaluate how complete the rescue actually is. There should be quantification of the ∆G2(WT) vs ∆G2(D3-dC) DAPI images shown in Figure 4D. Figure 4 Figure Supplement 2C has line scans of the relative DAPI intensity distributions of ∆G2(WT) vs WT and ∆G2(D3dC) compared to WT, but the authors need to include the normalized DAPI intensity distributions of ∆G2(WT) vs ∆G(D3-dC) in Figure 4 since these are the conditions being directly compared in Figure 4D and the authors claim that the morphologies are the same at 200nm (i.e. ∆G2(D3-dC) and ∆G2(WT) are both chenille-like). The CAP-H2 intensities should also be included, meaning Figure 4 Figure Supplement 2 B should be moved to Figure 4 (and the 200nm condition should be quantified).

8) In Figure 4 figure supplement 1C, the authors should add ∆G2(D3-dC) mutants to their analysis. ∆G2(D3-dC) mutants are unable to recapitulate the chromosome compaction activity of holo(D3-dC) mutants. It would be natural then, to see if the combination of ∆G2 and D3-dC mutants has any impact on ATP hydrolysis – if combining these mutations lowers the ATP-hydrolysis capacity of the resulting complex, then this would add further insight into why this complex can't match holo(D3-dC) chromosome compaction ability as well as the nature of the "cryptic" function of CAP-G2 exposed by C-terminus deletion.

Reviewer #3 (Recommendations for the authors):

1. The quantification of chromosome shape (DNA and condensin distribution across the chromatid) is very useful. However, a direct comparison between conditions incl. wt extracts is difficult as the data is distributed over different graphs. A unifying graph would be helpful.

2. To facilitate comparison across different model systems, please mention ortholog names of CAP-G and -D subunits in the introduction.

3. Abstract: 'how condensin II might work has remained largely unexplored'. I think this statement is not correct (and not needed) as the basic mechanism is understood, but the regulation is much more unexplored.

https://doi.org/10.7554/eLife.78984.sa1

Author response

Essential revisions:

1) The use of mouse sperm nuclei, instead of Xenopus sperm nuclei, for the majority of the analyses is not explained by the authors, and there is a concern that this could be altering or masking phenotypes. In this work, depletion of condensin I results in changes to mouse chromatid morphology, but they are still individualized and there is axially localized condensin. However, in previous papers from the lab (Ono et al., Cell, 2003), depletion of condensin I caused the complete loss of condensation and individualization when Xenopus sperm nuclei were used, similar to the depletion of condensin I and II. It is very important that the authors address this directly, as they did in a previous paper (Kinoshita et al., JCB, 2022) where they demonstrated differential effects of certain condensin I mutants depending on the nuclei source. Specifically, the authors should justify the use of mouse sperm in the manuscript in light of their previous findings, and perform key analyses (condensin I depletion, as well as analysis of the G2, D3, and D3 tail mutants) using Xenopus sperm. Since it was previously suggested that mouse nuclei are not as dependent on topo II in this system (Shintomi et al., Science, 2017), it might be useful to see if the addition of extra topo II to condensin I-depleted extracts containing Xenopus sperm allows for a similar level of condensin-II dependent condensation that is observed with mouse nuclei.

As the reviewers correctly point out, we noticed that the functional contribution of condensin II to single chromatid assembly could be observed more readily when mouse sperm nuclei are used as a substrate (Shintomi et al., 2017; the current study). Although the exact reason for this observation is unknown, we suspect that the slow kinetics of nucleosome assembly on the mouse sperm substrate could create an environment in favor of condensin II’s action. We, therefore, reasoned that the use of mouse sperm nuclei as a substrate might provide deep insights into the action of condensin II, which was otherwise rather cryptic when Xenopus sperm nuclei are used as a substrate (Ono et al., 2003). Note that one of the goals of the current study is to dissect the role of the individual subunits of condensin II by using Xenopus egg extracts as a functional assay. It is, therefore, reasonable to select the best substrate for this specific goal. We must admit that proper justification for the use of the mouse sperm substrate was missing in the original manuscript. In the revised manuscript, we have added a brief explanation as follows:

Lines 128-137:

“Conventional assays of mitotic chromosome assembly using Xenopus egg extracts had used Xenopus sperm nuclei as a substrate (Hirano et al., 1997; Ono et al., 2003; Shintomi and Hirano, 2011). More recently, we modified these assays by introducing mouse sperm nuclei into the same extracts, which allowed us to gain additional insights into the mechanism of mitotic chromosome assembly (Shintomi et al., 2017; Kinoshita et al., 2022). It was noticed that the functional contribution of condensin II was observed more prominently when mouse sperm nuclei were used as a substrate than when Xenopus sperm nuclei were used (Shintomi et al., 2017). We suspected that the slow kinetics of nucleosome assembly on the mouse sperm substrate creates an environment in favor of condensin II’s action. For this reason, mouse sperm nuclei were used as a substrate in the current study.”

2) More generally, the authors should explain and discuss in more detail their choice to choose to use Xenopus extract, mouse and human proteins, and mouse nuclei. How can the authors exclude that the observed effects are not due to the heterologous systems?

As far as the source of recombinant condensin subunits is concerned, there is a very long history in the authors’ group. As early as in the mid-1990s, we had attempted to reconstitute recombinant condensin complexes by using Xenopus cDNAs as a starting material. This attempt failed because it turned out that the residual expression of a Xenopus condensin subunit is highly toxic to bacterial growth and hampered the propagation of its full-length cDNA in bacterial cells. The exact reason for the toxicity was unknown. We then used human cDNAs for the same purpose. Although we were able to report the first reconstitution of condensin holocomplexes from human recombinant subunits (Onn et al., 2007), this trial brought only a partial success: one of the human SMC subunits was poorly expressed in insect cells, making it difficult for us to use them for comprehensive functional assays. We finally overcame these technical difficulties by using mouse cDNAs for the SMC subunits (Kinoshita et al., 2015). Most recently, we have further refined the purification scheme of the mammalian condensin I complexes and reported an exciting set of functional data (Kinoshita et al., 2022). We hope that the reviewers appreciate the fact that biochemical reconstitution of a large protein complex such as condensins remains technically challenging even in this era, and that the current study represents part of a two-decade-long effort of the authors' laboratory. Because the introduction of recombinant mammalian condensin complexes into Xenopus egg extracts has been described before (Kinoshita et al., 2015; 2022), we do not think that detailed justification needs to be provided in the current manuscript. We have added brief explanations for the use of mouse sperm nuclei with Xenopus egg extract in our response to comment #1 above (Line 127-137).

It should also be noted that our observations made in the combination of mouse sperm nuclei and Xenopus egg extracts can be recapitulated, at least in part, with Xenopus sperm nuclei in the extract-free assay (Figure 6; Figure 6-fugure supplement 1). Thus, the use of different substrates in experimental setups can be fully justified. Note that we used Xenopus sperm nuclei in the extract-free assay because no reproducible protocol for Npm2-mediated swelling of mouse sperm nuclei was available. In the revised manuscript, this technical issue has been briefly mentioned as follows:

Lines 292-294:

“… chromatin remodelers (Xenopus sperm nuclei were used as the substrate in this assay because no reproducible protocol for Npm2-mediated swelling of mouse sperm nuclei was available).”

3) The depletion of the Xenopus CAP-H2 subunit is incomplete in the condI/II depleted extracts (Figure 2—figure supplement 1A). Furthermore, a previous paper from the lab demonstrated that Xenopus CAP-G2 is only partially depleted using a similar depletion scheme (Ono et al., Cell, 2003, Figure 5B). A main focus of the work is the role of CAP-G2. However, the depletion of xCAP-G2 from Xenopus extracts is not documented (in contrast to many or all other condensin I and condensin II subunits) (Figure 2- supplement 1).

Thus, there are likely significant amounts of CAP-H2 and CAP-G2 in the condI/II depleted extracts, which could be incorporated into the recombinant mouse/human condensin II complexes. In support of this, there is clear axial staining of Xenopus CAP-H2 in the "rec cond II holo (WT)" condition, but not the buffer only condition, in condI/II depleted extracts (Figure 1B). This is important, as residual levels of xCAP-G2 may confuse the interpretation of the role of this subunit (the self-inhibition could be explained by an excess of CAP-G2). This could be especially problematic when analyzing the effects of recombinant complexes that do not contain G2 or in which H2 was mutated, especially at lower concentrations of the complexes (see below). The authors should quantify the levels of Xenopus CAP-H2 and CAP-G2 on chromatids in all conditions in Figure 1B, as well as provide the levels of mouse SMC2 or SMC4 in the add-back conditions since mouse H2 may not properly reflect the total levels of condensin II on chromatids in the depletion/add-back system. They should also attempt a third round of depletion using anti-XCAP-G and anti-XCAP-H2 antibodies to more completely remove these subunits, and repeat Figures 2C, 4D, and 5B, which are key findings of the paper. If antibodies are not available, proteomics might be suitable to address this point. If this depletion is not technically feasible, the authors should provide clear caveats in the manuscript, and if possible clear up any misunderstandings.

We thank the reviewers for bringing up the issue of the band found in the immunoblot (Figure 2—figure supplement 1A) and immunofluorescence signals detected in the panel in which the anti-XCAP-H2 antibody (in-house identifier AfR201) was used (Figure 1B in the original manuscript). As described below, we now demonstrate that the band found in the lane of the Δcond I/II extract is a non-specific band that migrates very closely to XCAP-H2. In brief, we re-ran immunodepletion samples and tested another XCAP-H2 antibody derived from a different rabbit immunized with the same antigen. This antibody (in-house identifier AfR202) did not detect the non-specific band cross-reacted with AfR201, demonstrating convincingly that XCAP-H2 has been sufficiently immunodepleted in the Δcond I/II sample. To prevent any confusion, we have replaced the original immunoblot set with a new set that includes the results obtained with both XCAP-H2 antibodies (AfR201 and AfR202). We apologize for the potentially misleading presentation made in the original manuscript. In the revised manuscript, we have added the following sentence to the corresponding figure legend of Figure 2—figure supplement 1A:

Lines 1068-1072:

“Immunodepletion of Xenopus CAP-H2 (XCAP-H2) was evaluated with two different affinity-purified antibodies (AfR201 and AfR202) raised against the same antigen to confirm that the band migrating slightly slower than XCAP-H2 is a non-specific band cross-reacted only with AfR201 but not with AfR202.”

We then investigated the possible origin of the faint immunofluorescence signal detected as XCAP-H2 (AfR201) on chenille-like chromosomes formed in the Δcond I/II +holo(WT) extract (originally Figure 1B, now moved to Author response image 1A). We now provide evidence that the faint signal represents hCAP-H2, rather than XCAP-H2. This problem stems from the double labeling technique using two primary antibodies derived from the same species, as discussed below. For the double labeling of XCAP-H2 and hCAP-H2, we used AfR201 (affinity-purified antibody against XCAP-H2) and biotin-labeled AfR205 (affinity-purified antibody against hCAP-H2), both of which were derived from rabbits. In brief, the samples were incubated with AfR201 and then with Alexa 568-conjugated anti-rabbit IgG to label XCAP-H2. After washing, the samples were incubated with a high concentration of non-immune rabbit IgG to prevent a small, unreacted fraction of the secondary antibody from absorbing any rabbit antibody subsequently added. Following this “quenching” step, the samples were incubated with biotin-labeled AfR205 and then with Alexa 488-conjugated streptavidin to label hCAP-H2. This double labeling method has been well established and used in many previous studies from our laboratory (Kinoshita et al., 2015, 2022; Ono et al., 2003; Shintomi et al., 2011, 2017, 2021; Yamashita et al., 2013). Nevertheless, we notice that the quenching step is sometimes not complete, potentially allowing the Alexa 568-conjugated anti-rabbit IgG to absorb a very small amount of AfR205 subsequently added. If this happened, the channel for Alexa 568 would detect a faint signal that corresponds to hCAP-H2 rather than XCAP-H2.

To rigorously test the possibility discussed above, we first quantified the immunofluorescence signals (divided by DAPI intensity and normalized relative to Δcond I +buffer) presented in the original Figure 1B (Author response image 1A). As the reviewers pointed out, a residual yet significant level of signals was measured in the Δcond I/II +holo(WT) extract (Author response image 1B). When the double labeling experiment was repeated using AfR202 instead of AfR201, the corresponding signals were still measurable although they were much lower than those detected with AfR201 (Author response image 1C and 1D). Finally, we repeated the experiment and split each sample into two. Each set was then labeled separately with AfR202 or with the anti-hCAP-H2 antibody (single labeling). In this case, a residual signal was no longer detectable with AfR202 in the Δcond I/II +holo(WT) extract (Author response image 1E). Taken all together, we conclude that the residual signal detected as XCAP-H2 in the original Figure 1B (Author response image 1A) was an artifact derived from incomplete quenching that accompanies the double labeling method. In the revised manuscript, we have decided to present a set of the single labeled images (revised Figure 1B). Accordingly, we have replaced the original panels D and E with those from the same experiment.

The reviewers raise the possibility that XCAP-G2 may remain in the immunodepleted Xenopus egg extract and that it may incorporate into the recombinant complex to produce unforeseeable effects. Unfortunately, we no longer have a reliable antibody to probe XCAP-G2 by immunoblotting, but the following arguments make the suggested possibility very unlikely. For instance, the concentration of endogenous XCAP-G2 in Xenopus egg extracts was estimated to be ~20-30 nM (Wuhr et al., 2014). If we assume that 5% of it is left in the depleted extract, the final concentration would be ~1-1.5 nM. Note that 25-200 nM of recombinant condensin II were added to the extract, suggesting that only a marginal effect would be expected even when all of the remaining endogenous XCAP-G2 subunit were incorporated into the recombinant complex(es). We also present all possible controls in our add-back assay, which include other mutant complexes such as ΔD3 and ΔD3ΔG2. Most convincingly, the negative role of CAP-G2 is demonstrated also in the extract-free assay using the Npm-treated chromatin as a binding substrate for recombinant condensin II (Figure 6 and Figure 6-supplement figure 1). This assay does not use Xenopus egg extract, thereby eliminating the possibility that XCAP-G has an impact, if any, on the action of recombinant condensin II. Moreover, in the revised manuscript, we have included additional results of the chromatin binding assay using holocomplexes harboring hCAP-H2 BC1/2D mutations (Figure 6—figure supplement 1C and 1D). The results also complement those from the Xenopus egg extract assay (Figure 5), eliminating the reviewers’ concern that residual XCAP-H might produce unforeseeable effects in the add-back assay. In the revised manuscript, we have modified the text accordingly to emphasize the complementary role of the extract-free assay in the current study:

Lines 281-284:

“However, the egg extracts contain a number of activities that modify or potentially supplement the activities of the recombinant condensin II complex. In an attempt to fill the gap between the extract-based assay and other biochemical/biophysical assays (Kong et al., 2020), we next wished to set up a simple chromatin-binding assay that does not utilize the extracts.”

Author response image 1
Evidence that the faint immunofluorescence signal detected as XCAP-H2 on chenille-like chromosomes formed in the Δcond I/II +holo(WT) extract is an artifact.

(A) Double labeling of chromatin/chromosomes with antibodies against XCAP-H2 (AfR201) and hCAP-H2. This panel was presented in Figure 1B in the original manuscript. (B) From the double-labeling experiment described in (A), signal intensities of XCAP-H2 were divided by DAPI signal intensities, and the mean values were normalized relatively to the value by Δcond I extract. The mean ± SD is shown (n = 15 chromosome clusters). Mean values were listed in bold. P values listed were assessed by two-tailed Welch’s t-test. (C) The double-labeling experiment was repeated using antibodies against XCAP-H2 (AfR202) and hCAP-H2. (D) From the double-labeling experiment described in (C), signal intensities of XCAP-H2 were divided by DAPI signal intensities and plotted as above. (E) From the single-labeling experiment shown in the revised Figure 1B, signal intensities of XCAP-H2 were divided by DAPI signal intensities and plotted as above.

4) Related to points 1 and 3, the concentration of recombinant condensin II complexes in many experiments is 200 nM, including the holo(WT) condition. However, the endogenous concentration of non-SMC condensin II subunits in Xenopus egg extracts is much lower (~20-30 nM; Wuhr et al., 2014). Given the dose-dependence effects of the holo(WT) complex on chromatid structure (Figure 2—figure supplement 1B), this would suggest that the mouse/human hybrid complex used here is somehow less active, either due to protein folding issues or evolutionary differences. Alternatively, the high concentration of holo(WT) complexes used here may be required to overcome the loss of a factor that was depleted from extracts that are not present in the purified complex. Further, condensin I complexes are present at ~5 times the concentration of condensin II in egg extracts (Shintomi and Hirano, G and D, 2011), and this difference in relative amounts has been proposed to underlie the reason why condensin II plays a relatively minor role in condensation in egg extracts compared to condensin I. The authors should provide an explanation for why this concentration was used since at 50 nM, which is more similar to endogenous levels of condensin II, holo(WT) was much less effective in promoting chromatid structure when compared to endogenous condensin II (Figure 2—figure supplement 1B vs Figure 1B).

We thank the reviewers for bringing up this important issue. It is not fully understood why higher concentrations of recombinant condensin II are required to functionally replace endogenous native condensin II. We consider two possibilities. The first is the species difference in the core activity between Xenopus and mammalian condensin II. Although the primary sequences of the condensin II subunits are conserved reasonably well between Xenopus laevis and mammals, they are not identical. It is possible that mammalian condensin II does not exhibit its full activity in the environment of Xenopus egg extracts. The second possibility is the different states of post-translational modifications. Native condensin II already bears physiological modifications in egg extracts. While we anticipate that the recombinant complexes are modified appropriately and get activated in Xenopus egg extracts, there is no guarantee that the anticipated modifications are completed under the current experimental condition. Apart from these issues, we wish to emphasize again that the current work aims to dissect the role of the individual subunits of condensin II by using Xenopus egg extracts as a functional assay. In this sense, as long as proper controls are provided, we can draw a solid set of conclusions from this heterologous experimental setup. In the revised manuscript, we have added the following sentences:

Lines 147-156:

“The addition of holo(WT) at 200 nM caused the formation of chromosomal structures similar to those formed by endogenous condensin II (Figure 1D and 1E). We noticed that this concentration (200 nM) was higher than the concentration of endogenous condensin II (~25 nM) in Xenopus egg extracts that had been estimated by proteomic analysis (Wuhr et al., 2014). Potential explanations for this apparent discrepancy could include the species difference in the primary structures of the subunits or the different states of post-translational modifications. Despite the caveat, these experiments demonstrate that the recombinant mammalian condensin II holocomplex can functionally replace endogenous condensin II in Xenopus egg extracts under the current condition.”

5) Furthermore, it appears that the kinetics of condensation in the ∆cond I/II + condensin II holo(WT) condition (Figure 2—figure supplement 1C) are quite slow compared to WT extracts containing mouse sperm (see Shintomi et al., Science, 2017). The authors should compare the condensation kinetics of WT, cond I -depleted, and ∆cond I/II + condensin II holo(WT) extracts. If cond I-depleted assembly kinetics are more similar to WT than to ∆cond I/II + condensin II holo(WT), this could compromise the validity of the add-back system that forms the basis of the work.

It seems true that the kinetics of chromosome assembly by the recombinant condensin II holo(WT) is slower than that observed in unperturbed Xenopus egg extracts. Although the exact reason for this is unknown, we can speculate a number of possible factors that possibly cause the slow kinetics, as discussed above in our response to comment #4. It should also be mentioned that our previous studies using a similar heterologous system produced a wealth of valuable information about the mechanism of action of condensin I (Kinoshita et al., 2015, 2022). At present, no other experimental systems enable the functional dissection of multiprotein complexes under physiological conditions at this level of precision. In the revised manuscript, we have added a brief sentence that describes the limitation of the current approach (Lines xxx-xxx), as mentioned above in our response to comment #4.

6) It is puzzling that the basic amino acid clusters of CAP-H2, which are supposed to bind DNA and together with CAP-G2 form the safety belt, is essential for DNA binding and certain activity in chromosome condensation, while the CAP-G2 subunit appears dispensable. The authors do not provide an adequate explanation for this finding. Do the basic amino acid clusters act independently of the safety belt and of CAP-G2?

The safety belt mechanism composed of Brn1/CAP-H and Ycg1/CAP-G has been proposed based on experiments using yeast condensin, which is closer to condensin I than condensin II in mammals. It is still unknown whether mammalian condensins also function through a similar mechanism, or whether the safety belt mechanism is specific to condensin I or is also applied to condensin II. Although we show that the BC1/2D mutations in CAP-H2, but not loss of CAP-G2, cause complete loss of activities, the currently available evidence is insufficient to discuss this issue beyond the following statements placed in the Discussion of the original manuscript:

Line 385:

“it should be noted that there has been no direct evidence to date that mammalian condensins use a safety-belt mechanism for DNA binding as demonstrated by budding yeast condensin. Further investigation is required to clarify whether mammalian condensins operate through a safety belt mechanism.”

Nevertheless, we have noticed a recent paper reporting that the Ycg1/CAP-G may not be an essential component in the proposed safety belt in the filamentous fungus Chaetomium thermophilum (Shaltiel et al., 2022). In the revised manuscript, we have added the following sentence to clarify this issue:

Lines 388-390:

“Even if a similar mechanism operates in mammalian condensin II, it is possible that the functional requirement for CAP-G2 is somewhat relaxed, as has been recently shown in condensin from the filamentous fungus Chaetomium thermophilum (Shaltiel et al., 2022).”

7) Moreover, the H2-BC1/2D mutant complex (lacking the basic residues) is still inhibited by the presence of CAP-G2 (as suggested in Figure 5 —figure supplement). This implies that the basic amino acid clusters are (only?) needed to overcome the inhibition by CAP-G2 but they are not needed for the inhibition itself. This should be more clearly discussed in the manuscript.

One possibility is that an additional chromatin targeting region(s) is present in the condensin II complex but is physically hidden or functionally suppressed by the presence of CAP-G2. Along this line, our previous studies provided evidence that mammalian condensin I has a loading mechanism that is independent of the proposed safety belt and that CAP-D2 is involved in such a mechanism (Hara et al., 2019; Kinoshita et al., 2022). The current study shows that the action of CAP-D3 is negatively regulated by CAP-G2, supporting the notion that CAP-D3 is responsible for condensin II loading in the context of DG2(H2-BC1/2D). To make this point clearer, we have added the following brief sentence in the revised manuscript:

Lines 390-393:

“Moreover, it is worthy to note that ΔG2(H2-BC1/2D), but not holo(H2-BC1/2D), retains the ability to associate with chromatin, suggesting the existence of a loading pathway that is actualized in the absence of CAP-G2 (e.g., CAP-D3-dependent pathway).”

8) In the Abstract: 'play positive and negative roles, respectively' is too oversimplified. Depletion experiments globally reveal such roles, but the reality is more complicated with all subunits contributing to the mechanism (positively).

We agree with this comment. We have modified the sentence so that it focuses on the role of the two HEAT subunits in the loading of condensin II and its impact on chromosome axis assembly (rather than chromosome assembly in general) as follows:

Lines 34-36:

“We find that one of two HEAT subunits, CAP-D3, plays a crucial role in condensin II-mediated assembly of chromosome axes whereas the other HEAT subunit, CAP-G2, has a very strong negative impact on this process.”

9) Many of the conclusions are backed up by a single representative image. Quantification for all the assays underlying the key conclusions in the manuscript should be presented. In addition, better reporting is required in the figure legends. How many times was each assay performed? How many nuclei were examined in each case?

We are somewhat confused with this comment. In the original manuscript, we included the quantification (ie., line scans, signal intensity, and/or nuclei size measurements) in the figure panels along with the representative images, as well as the number of experimental repeats and the number of chromosome clusters or nuclei measured (n value), wherever applicable. In the revised manuscript, however, we have made some modifications in the figure legends to make the link between the image panels and the quantification panels clearer. The text changes have been shown in blue in the “Related Manuscript” file of the Article text.

Please also respond to additional points raised by individual reviewers below.

Reviewer #1 (Recommendations for the authors):

1. One of the most interesting findings in the manuscript is the potential relationship between CAP-G2 C terminal region and CAP-D2. The authors speculate that phosphorylation could regulate this relationship. Could the authors test this in their assay?

We assume that the reviewer meant the relationship between CAP-D3 C-terminal region and CAP-G2 (and NOT “between CAP-G2 C terminal region and CAP-D2”). We also find that the potential, functional relationship between the CAP-D3 C-tail and CAP-G2 is of great interest. Although we provided evidence that at least two sites, T1415 and S1474, are phosphorylated in a mitotic extract (Figure 4—figure supplement 1B), the CAP-D3 C-tail contains 9 additional CDK consensus sites and 33 other serines/threonines. Identification of key phosphorylation sites in the D3 C-tail that might affect its physical and functional interaction with CAP-G2 would require a substantial amount of work and is clearly beyond the scope of the current manuscript. We will address this very important question in future studies.

2. How do the levels of condensin on chromosomes in this assay compare to the levels in vivo? Could the effects observed be due to greatly elevated levels?

We are afraid that we do not fully understand this comment, but interpret it to mean that the reviewer questions the relatively high concentrations of the recombinant complexes added back into the extracts. If so, please see our response to comment #4 in the Essential Revision.

Reviewer #2 (Recommendations for the authors):

1) Figure 6 doesn't seem to add much new insight, and it is odd that the authors use Xenopus sperm in this figure only and don't explain their motivation for this. Thus, I feel it should either be removed from the paper or be moved to supplementary info.

The reason for the use of Xenopus sperm nuclei in this assay has been described in our response to comment #2 in the Essential Revision. The following sentence has been added to the revised manuscript.

Lines 292-294:

“… chromatin remodelers (Xenopus sperm nuclei were used as the substrate in this assay because no reproducible protocol for Npm2-mediated swelling of mouse sperm nuclei was available).”

It should also be emphasized that the extract-free assay nicely complements the extract-based add-back assay (also see our response to comment #3 in the Essential Revisions). For instance, the reviewers expressed their concern that residual levels of endogenous subunits remaining in the immunodepleted extracts might incorporate into the recombinant complexes, thereby causing unforeseeable effects in the add-back assay. Npm2-treated chromatin binding assay, which does not use Xenopus egg extracts, can recapitulate part of the activities of the recombinant complexes (i.e., chromatin loading and resulting chromatin compaction), thereby helping to rule out the reviewers’ concern. For this reason, we wish to keep Figure 6 as one of the main figures. To further clarify our motivation for the addition of Figure 6 to the current manuscript, we have modified the text in the revised manuscript as follows:

Lines 281-284:

“However, the egg extracts contain a number of activities that modify or potentially supplement the activities of the recombinant condensin II complex. In an attempt to fill

the gap in technical approaches between the extract-based assay and other biochemical/biophysical assays (Kong et al., 2020), we next wished to set up a simple chromatin-binding assay that does not utilize the extracts.”

2) The paper would be significantly enhanced with further mechanistic insights into the repressive function of the D3 tail. This could be achieved through phospho-mimetic mutations, and/or through the addition of excess D3 tail to the D3-dC condition to see if it can be inhibited in trans.

This constructive comment is fully appreciated. We do think that exploring the potential phospho-regulation of condensin II mediated by the D3 C-tail is a very important direction in the future, but such an effort is beyond the scope of the current manuscript. See our response to comment #1 of Reviewer #1.

3) The cartoon in Figure 1D seems more appropriate for the Discussion and Figure 7. To my knowledge, the authors do not provide direct evidence for the loops and axis featured in 1D, which would require Hi-C experiments.

We have removed the cartoon from the revised manuscript.

4) In Figure 1D, for the quantification of the line scans, it would be useful to have chromosomes assembled in WT extracts included so that the reader can be sure of the differences between WT chromosome morphology and "chenille" morphology shown in the representative images are borne out quantitatively.

This constructive comment is fully appreciated. We have replaced the line scans in Figure 1D with a re-quantified version that includes the line scans of the chromosomes assembled in the Δmock ( = WT) extract. The measurements for the new line scans have also been included in Figure 1-source data 1.

5) In the ATP-hydrolysis assays in Figure 3, the authors show that ∆G2(WT) mutants have increased ATP activity compared to holo(WT), both with and without dsDNA as a substrate. Given prior work from the lab demonstrating that condensin I goes through continuous cycles of ATP-hydrolysis-dependent turnover in Xenopus egg extracts and that transition state mutations slow this turnover rate, it would be interesting to investigate the kinetics of ∆G2(WT) condensin II turnover. If enhanced ATP-hydrolysis were to be a causal factor in the high chromosomal accumulation of condensin II in ∆G2(WT) mutants (which the authors are careful not to claim outright), then we might expect to see an increased rate of condensin II turnover in ∆G2(WT) cond II compared to holo(WT) cond II as well. Such a result would strengthen the possibility of a mechanistic link between CAP-G2's negative regulation of ATP hydrolysis and its negative regulation of condensin II loading on chromosomes. This could be easily tested with the type of two-color assays this lab has previously performed on condensin I mutants.

We thank the reviewer for the recognition of a technique that was previously reported by our group (Kinoshita et al., 2015). However, we wish to remind the reviewer that the two-color assays require additional construction, expression and purification of the corresponding wild-type and mutant complexes. Although the suggested experiments are beyond the scope of the current study, we expect that they will produce useful information in the future.

6) Also in regard to the ATP-hydrolysis assay in Figure 3, it would be worthwhile to include ∆D3(WT) and ∆H2(WT) mutants for completeness. For example, maybe the enhanced ATP-hydrolysis ability of ∆G(WT) isn't specific to CAP-G function, but is instead a result related to sterics, wherein deletion of any of the condensin non-SMC subunits allows more room for ATP to bind and undergo hydrolysis. Demonstrating that ∆D3(WT) does not have increased ATP-hydrolysis activity compared to holo(WT) would eliminate this possibility and further support the notion of CAP-D3 playing a positive role in the chromosomal accumulation of condensin II and axis formation.

We read the second sentence of this comment as “…maybe the enhanced ATP-hydrolysis ability of ∆G2(W’) isn't specific to CAP-G2 function”. That said, we are afraid the reviewer tries to overinterpret our results. In the current manuscript, we do not claim that the enhanced ATPase rate of DG2(WT) is directly coupled to its enhanced association with chromosomes. We simply say that “CAP-G2 negatively regulates the ATPase activity of condensin II as well as its ability to associate with chromosomes”. In fact, we also show that DG2(SMC-TR) has a negligible level of ATPase activity (Figure 3C; p = < 0.001 to holo[WT]) but displays a higher level of chromosome association than holo(WT) (Figure 3A and B; p = < 0.001). We believe that the suggested experiment is not necessary to further substantiate the major conclusions reported in the current manuscript.

7) The authors write that at 200nM, the structures formed by holo(D3-dC) "were no longer chenille-like," but instead "reminiscent of rod-shaped chromosomes produced by condensin I". It does appear that the chromosome axes are better defined in this condition, as confirmed by the line scans in Figure 4C. However, in order to justify the comparison, the authors should include WT chromosomes both in the representative images in 4B and in the line scans in 4C. After all, the difference in the shape of the normalized DAPI intensity distribution (Figure 4C) is not enormous (and there is no statistical analysis of it), so having the WT distribution for comparison would allow the reader to evaluate how complete the rescue actually is. There should be quantification of the ∆G2(WT) vs ∆G2(D3-dC) DAPI images shown in Figure 4D. Figure 4 Figure Supplement 2C has line scans of the relative DAPI intensity distributions of ∆G2(WT) vs WT and ∆G2(D3dC) compared to WT, but the authors need to include the normalized DAPI intensity distributions of ∆G2(WT) vs ∆G(D3-dC) in Figure 4 since these are the conditions being directly compared in Figure 4D and the authors claim that the morphologies are the same at 200nm (i.e. ∆G2(D3-dC) and ∆G2(WT) are both chenille-like). The CAP-H2 intensities should also be included, meaning Figure 4 Figure Supplement 2 B should be moved to Figure 4 (and the 200nm condition should be quantified).

We wrote that the chromosomes formed by holo(D3-dC) addition at 200 nM were “reminiscent of rod-shaped chromosomes produced by condensin I”. This was based on the observation that the fuzzy chromatin observed in chenille-like chromosomes is more concentrated in the axial center in the holo(D3-dC) chromosomes. We have chosen the modest expression in the current manuscript because we thought that a direct comparison between condensin II holo(D3-dC) and condensin I would require a more detailed understanding of the mechanism of action of holo(D3-dC) and the suppressive function of the D3 C-tail. We fully appreciate that this is a very important issue that needs to be thoroughly addressed in future studies. Such efforts will help to further dissect the similarities and differences between condensin I and condensin II in terms of both their mechanisms of action and regulation.

In our view, the current format of the presentation can be used to illustrate the similarities between ∆G2(WT) and ∆G2(D3-dC) by using holo(WT) as a control. We have made available DAPI and hCAP-H2 measurements of all complexes and conditions in Figure 4, including the hCAP-H2 lines scans for ∆G2(D3-dC) at 200 nM, as source data (Figure 4-source data 1) submitted with the manuscript.

Line 1197-1198:

“Figure 4-source data 1. Microsoft excel of non-normalized data of all conditions corresponding to Figure 4 and Figure 4—figure supplement 2.”

8) In Figure 4 figure supplement 1C, the authors should add ∆G2(D3-dC) mutants to their analysis. ∆G2(D3-dC) mutants are unable to recapitulate the chromosome compaction activity of holo(D3-dC) mutants. It would be natural then, to see if the combination of ∆G2 and D3-dC mutants has any impact on ATP hydrolysis – if combining these mutations lowers the ATP-hydrolysis capacity of the resulting complex, then this would add further insight into why this complex can't match holo(D3-dC) chromosome compaction ability as well as the nature of the "cryptic" function of CAP-G2 exposed by C-terminus deletion.

This comment is related to comment #6 above (see our response to comment #6, too). Although our findings that DG2(WT) and holo(D3-dC) display increased ATPase rates are very illuminating, we consider that a comparison of the ATPase rates between the two mutant complexes would be insufficient to interpret the phenotypic difference observed in the add-back assay. For this reason, we do not think that an additional measurement of the ATPase rate of ∆G2(D3-dC) would give us valuable information. In the future, we wish to address the functional differences among these mutant complexes using different assays including loop extrusion assays.

Reviewer #3 (Recommendations for the authors):

1. The quantification of chromosome shape (DNA and condensin distribution across the chromatid) is very useful. However, a direct comparison between conditions incl. wt extracts is difficult as the data is distributed over different graphs. A unifying graph would be helpful.

We assume that the reviewer refers to the multiple graphs presented in Figure 4—figure supplement 2. Due to the large number of different complexes and different concentrations tested, we find it difficult to make a unified graph. We believe that the current compilation of graphs communicates the key conclusions of the manuscript.

2. To facilitate comparison across different model systems, please mention ortholog names of CAP-G and -D subunits in the introduction.

Please note that the names of the budding yeast orthologs (Brn1/CAP-H… Ycg1/CAP-G…) were included in the Discussion of the original manuscript. In the revised manuscript, we have added them in the Introduction, too.

Lines 57-58:

“CAP-H/Brn1… CAP-D2/Ycs4… CAP-G/Ycg1…”

3. Abstract: 'how condensin II might work has remained largely unexplored'. I think this statement is not correct (and not needed) as the basic mechanism is understood, but the regulation is much more unexplored.

The reviewer says that the basic mechanism of condensin II is already understood. We respectfully disagree with this statement. To our knowledge, only two studies have attempted, so far, to test the molecular activities of condensin II using its purified fraction (Houlard et al., 2022; Kong et al., 2020), and our current understanding of the mechanism of condensin II is still far from complete. Moreover, compared to the long history of analyses of condensin I, only a limited set of biochemical/biophysical assays has been applied for the analyses of condensin II. We do agree with the reviewer, however, that the regulation of condensin II is less explored. In the revised manuscript, the abstract text has been modified as follows:

Lines 31-32:

“Although the mechanism of action and regulation of condensin I have been studied extensively, our corresponding knowledge of condensin II remains very limited.”

https://doi.org/10.7554/eLife.78984.sa2

Article and author information

Author details

  1. Makoto M Yoshida

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Conceptualized the project
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0618-1717
  2. Kazuhisa Kinoshita

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Contributed to an early stage of the condensin II expression project
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0882-4296
  3. Yuuki Aizawa

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Performed the ATPase assay and data analysis
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-5002-7557
  4. Shoji Tane

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Performed condensin I purification and the corresponding experiment and data analysis
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-0209-347X
  5. Daisuke Yamashita

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Present address
    Otsuka Pharmaceutical Co., Ltd, Tokushima, Japan
    Contribution
    Prepared phosphospecific antibodies against hCAP-D3
    Competing interests
    is currently affiliated with Otsuka Pharmaceutical Co., Ltd. The author has no financial interests to declare
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0001-6054-5617
  6. Keishi Shintomi

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Prepared Npm2 and mouse sperm nuclei
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0003-0484-9901
  7. Tatsuya Hirano

    Chromosome Dynamics Laboratory, RIKEN, Wako, Japan
    Contribution
    Conceptualized the project
    For correspondence
    hiranot@riken.jp
    Competing interests
    No competing interests declared
    ORCID icon "This ORCID iD identifies the author of this article:" 0000-0002-4219-6473

Funding

Japan Society for the Promotion of Science (#20K15723)

  • Makoto M Yoshida

Japan Society for the Promotion of Science (#15K06959)

  • Kazuhisa Kinoshita

Japan Society for the Promotion of Science (#19K06499)

  • Kazuhisa Kinoshita

Japan Society for the Promotion of Science (#18H02381)

  • Keishi Shintomi

Japan Society for the Promotion of Science (#19H05755)

  • Keishi Shintomi

Japan Society for the Promotion of Science (#18H05276)

  • Tatsuya Hirano

Japan Society for the Promotion of Science (#20H0593)

  • Tatsuya Hirano

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.

Acknowledgements

We thank F Inoue, H Watanabe, and M Ohsugi for their help with mouse sperm nuclei preparation and we thank members of the Hirano lab for critically reading the manuscript.

Ethics

Female Xenopus laevis frogs (RRID: NXR 0.031, Hamamatsu Seibutsu-Kyozai) were used to lay eggs to harvest Xenopus egg extract (Hirano et al., 1997). Male X. laevis frogs (RRID: NXR 0.031, Hamamatsu Seibutsu-Kyozai) were dissected to prepare sperm nuclei from testes (Shintomi and Hirano, 2017). Frogs were used in compliance with the institutional regulations of the RIKEN Wako Campus. Mice (BALB/c ×; C57BL/6JF1) for sperm nuclei (Shintomi et al., 2017) were used in compliance with protocols approved by the Animal Care and Use Committee of the University of Tokyo (for M. Ohsugi who provided mouse sperm).

Senior Editor

  1. Jessica K Tyler, Weill Cornell Medicine, United States

Reviewing Editor

  1. Adèle L Marston, University of Edinburgh, United Kingdom

Reviewers

  1. Adèle L Marston, University of Edinburgh, United Kingdom
  2. Alexander E Kelly, National Cancer Institute, United States

Publication history

  1. Received: March 26, 2022
  2. Preprint posted: April 5, 2022 (view preprint)
  3. Accepted: August 11, 2022
  4. Accepted Manuscript published: August 19, 2022 (version 1)
  5. Version of Record published: August 31, 2022 (version 2)

Copyright

© 2022, Yoshida et al.

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Metrics

  • 559
    Page views
  • 262
    Downloads
  • 0
    Citations

Article citation count generated by polling the highest count across the following sources: Crossref, PubMed Central, Scopus.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Makoto M Yoshida
  2. Kazuhisa Kinoshita
  3. Yuuki Aizawa
  4. Shoji Tane
  5. Daisuke Yamashita
  6. Keishi Shintomi
  7. Tatsuya Hirano
(2022)
Molecular dissection of condensin II-mediated chromosome assembly using in vitro assays
eLife 11:e78984.
https://doi.org/10.7554/eLife.78984
  1. Further reading

Further reading

    1. Chromosomes and Gene Expression
    2. Genetics and Genomics
    Meng Huang, Minjie Hong ... Xuezhu Feng
    Research Article Updated

    Histone methylation plays crucial roles in the development, gene regulation, and maintenance of stem cell pluripotency in mammals. Recent work shows that histone methylation is associated with aging, yet the underlying mechanism remains unclear. In this work, we identified a class of putative histone 3 lysine 9 mono/dimethyltransferase genes (met-2, set-6, set-19, set-20, set-21, set-32, and set-33), mutations in which induce synergistic lifespan extension in the long-lived DAF-2 (insulin growth factor 1 [IGF-1] receptor) mutant in Caenorhabditis elegans. These putative histone methyltransferase plus daf-2 double mutants not only exhibited an average lifespan nearly three times that of wild-type animals and a maximal lifespan of approximately 100 days, but also significantly increased resistance to oxidative and heat stress. Synergistic lifespan extension depends on the transcription factor DAF-16 (FOXO). mRNA-seq experiments revealed that the mRNA levels of DAF-16 Class I genes, which are activated by DAF-16, were further elevated in the daf-2;set double mutants. Among these genes, tts-1, F35E8.7, ins-35, nhr-62, sod-3, asm-2, and Y39G8B.7 are required for the lifespan extension of the daf-2;set-21 double mutant. In addition, treating daf-2 animals with the H3K9me1/2 methyltransferase G9a inhibitor also extends lifespan and increases stress resistance. Therefore, investigation of DAF-2 and H3K9me1/2 deficiency-mediated synergistic longevity will contribute to a better understanding of the molecular mechanisms of aging and therapeutic applications.

    1. Chromosomes and Gene Expression
    2. Structural Biology and Molecular Biophysics
    Lena Maria Muckenfuss, Anabel Carmen Migenda Herranz ... Martin Jinek
    Research Article Updated

    3′ end formation of most eukaryotic mRNAs is dependent on the assembly of a ~1.5 MDa multiprotein complex, that catalyzes the coupled reaction of pre-mRNA cleavage and polyadenylation. In mammals, the cleavage and polyadenylation specificity factor (CPSF) constitutes the core of the 3′ end processing machinery onto which the remaining factors, including cleavage stimulation factor (CstF) and poly(A) polymerase (PAP), assemble. These interactions are mediated by Fip1, a CPSF subunit characterized by high degree of intrinsic disorder. Here, we report two crystal structures revealing the interactions of human Fip1 (hFip1) with CPSF30 and CstF77. We demonstrate that CPSF contains two copies of hFip1, each binding to the zinc finger (ZF) domains 4 and 5 of CPSF30. Using polyadenylation assays we show that the two hFip1 copies are functionally redundant in recruiting one copy of PAP, thereby increasing the processivity of RNA polyadenylation. We further show that the interaction between hFip1 and CstF77 is mediated via a short motif in the N-terminal ‘acidic’ region of hFip1. In turn, CstF77 competitively inhibits CPSF-dependent PAP recruitment and 3′ polyadenylation. Taken together, these results provide a structural basis for the multivalent scaffolding and regulatory functions of hFip1 in 3′ end processing.