Centriolar satellites expedite mother centriole remodeling to promote ciliogenesis
- MRC Human Genetics Unit, Institute of Genetics and Cancer, University of Edinburgh, United Kingdom
- Department of Biochemistry and Biophysics, Cardiovascular Research Institute, University of California, United States
- Lunenfeld-Tanenbaum Research Institute, Sinai Health System, Canada
- Cavanilles Institute of Biodiversity and Evolutionary Biology, University of Valencia, Spain
- Predepartamental Unit of Medicine, Jaume I University, Spain
- Institute of Genetics and Cancer, University of Edinburgh, United Kingdom
- Department of Molecular Genetics, University of Toronto, Canada
- Chan Zuckerberg Biohub, United States
Figures
Figure 1 with 3 supplements
PCM1 is important for perinatal survival.
(A) Immunoblot of mouse embryonic fibroblast (MEF) lysates from wild-type and Pcm1−/− MEFs for PCM1 and GAPDH (loading control). Gel stained with Coomassie blue. (B) Immunostaining of PCM1 (yellow) …
-
Figure 1—source data 1
Full uncropped immunoblots for Figure 1A and Figure 1—figure supplement 1C, labeled and unlabeled.
- https://cdn.elifesciences.org/articles/79299/elife-79299-fig1-data1-v2.pdf
Figure 1—figure supplement 1
PCM1 promotes survival and growth.
(A) Schematics of two CRISPR/Cas9-generated indels in Pcm1, Pcm1Δ5-14 and Pcm1Δ796-800. Both Pcm1Δ5-14 and Pcm1Δ796-800 create frameshifts. Schematic of PCM1 protein, indicating predicted …
Figure 1—figure supplement 2
Pcm1Δ5-14/Δ5-14 and Pcm1Δ796-800/Δ796-800 mice exhibit comparable phenotypes.
(A, B) Observed number of wild-type, Pcm1+/Δ5-14, Pcm1Δ5-14/Δ5-14, Pcm1+/Δ796-800, and Pcm1Δ796-800/Δ796-800 mice as a percentage of the expected number. Chi-squared: ***p < 0.01, *p < 0.05. (C, D) …
Figure 1—figure supplement 3
PCM1 is dispensable for ciliogenesis in some cell types.
(A, C, E) Sagittal sections of wild-type and Pcm1−/− E18.5 embryos immunostained for cilia (polyglutamylated tubulin: TUBPolyE, magenta and ARL13B, yellow). Nuclear stain …
Figure 2 with 4 supplements
Pcm1−/− mice display ciliopathy-associated phenotypes.
(A) Pcm1−/− mouse displaying a domed skull indicative of hydrocephaly. (B) Coronal sections of 5-week-old wild-type and Pcm1−/− brains. (C) Percentages of wild-type and Pcm1−/− mice exhibiting …
Figure 2—figure supplement 1
Pcm1−/− mice display a subset of ciliopathy-associated phenotypes.
(A) Coronal (6 weeks, top images) and sagittal (8 months, bottom images) optical projection tomography (OPT) images of brains of wild-type and Pcm1−/− mice. Dilated ventricle is marked by an arrow. …
Figure 2—video 1
Wild-type sperm morphology and movement.
Sperm were isolated from wild-type testes and imaged in dilute methyl cellulose.
Figure 2—video 2
Pcm1−/− sperm are immotile and lack normal head structures.
Sperm were isolated from Pcm1−/− testes and imaged in dilute methyl cellulose.
Figure 2—video 3
Pcm1−/− sperm exhibit disrupted movement.
Sperm were isolated from Pcm1−/− testes and imaged in media without methyl cellulose.
Figure 3 with 10 supplements
PCM1 is required for efficient basal body synthesis and multiciliogenesis.
(A) Wild-type and Pcm1−/− P3 wholemount brain ventricles immunostained for basal bodies (FOP, yellow), actin (phalloidin, cyan) and cilia (TUBAc, magenta). Inset depicts area of ventricle imaged …
Figure 3—figure supplement 1
Centriole amplification is delayed and fibrogranular material is disrupted in Pcm1−/− ependymal cells.
Ependymal cells from P5 (A) and P16 (B) wild-type and Pcm1−/− ventricles immunostained for basal bodies (FOP, yellow), cilia (TUBAc, magenta) and, at P5, actin (phalloidin, cyan). (C) Cultured …
Figure 3—figure supplement 2
Pcm1−/− ependymal cells form elongated centriole-like structures.
(A) Ependymal cells from P3 wild-type and Pcm1−/− ventricles immunostained for FOP (yellow), actin (phalloidin, cyan), and nuclei (DAPI, blue). A single optical section basal to most basal bodies is …
Figure 3—figure supplement 3
Delayed expression of ciliary proteins in Pcm1−/− mouse tracheal epithelium cells (mTECs).
(A) Wild-type and Pcm1−/− mTECs immunostained for basal bodies (FOP, yellow), cilia (TUBAc, magenta), and nuclei (DAPI, blue) 4, 7, or 12 days after placement at air–liquid interface (ALI). Below: …
Figure 3—video 1
Wild-type cultured ependymal cilia beat in a coordinated way 14 days after serum withdrawal.
Figure 3—video 2
Pcm1−/− ependymal cilia show uncoordinated, slow ciliary beat 16 days after serum withdrawal.
Figure 3—video 3
Pcm1−/− ependymal cilia show uncoordinated, slow ciliary beat 14 days after serum withdrawal.
Figure 3—video 4
Cilia of a tracheal wholemount preparation from a 3-month-old wild-type mouse beating.
Figure 3—video 5
Cilia of a tracheal wholemount preparation from a 2-month-old Pcm1−/− mouse beating.
Figure 3—video 6
Wild-type ALI12 mouse tracheal epithelium cell (mTEC) cilia beating.
Figure 3—video 7
Pcm1−/− ALI12 mouse tracheal epithelium cell (mTEC) cilia beating.
Figure 4 with 2 supplements
PCM1 is essential for centriolar satellite integrity and, in some cell types, ciliogenesis.
(A) Immunoblot of wild-type and PCM1−/− retinal pigmented epithelial 1 (RPE1) cell lysates for PCM1 and GAPDH (loading control). Gel stained with Coomassie blue. (B) Wild-type and PCM1−/− RPE1 cells …
-
Figure 4—source data 1
Full uncropped immunoblots for Figure 4G, labeled and unlabeled.
- https://cdn.elifesciences.org/articles/79299/elife-79299-fig4-data1-v2.pdf
Figure 4—figure supplement 1
PCM1 is dispensable for ciliogenesis in mouse embryonic fibroblasts (MEFs).
(A) Wild-type and Pcm1−/− MEFs serum starved for 36 hr and immunostained for ARL13B (yellow), TUBAc (magenta), and nuclei (DAPI, blue). Scale bar: 10 µm. (B) Percentage of wild-type and Pcm1−/− MEFs …
Figure 4—video 1
Centriolar satellites frequently fuse and divide near the basal body.
Endogenous PCM1-SNAP labeled with tetramethylrhodamine (TMR)-SNAP (yellow) in Pcm1SNAP mouse embryonic fibroblasts (MEFs) reveals that centriolar satellites show saltatory movement, coalescing and …
Figure 5 with 2 supplements
PCM1 promotes mother centriole docking to preciliary vesicles.
(A) 3D-SIM images of Myosin-Va (MyoVa, yellow), centrioles (γ-TUB, cyan) and cilia (TUBAc, magenta) in wild-type and PCM1−/− RPE cells 1 hr after serum starvation. Scale bars: 1 and 0.5 μm for main …
Figure 5—figure supplement 1
PCM1 is dispensable for mother centriole maturation.
(A) Wild-type and PCM1−/− retinal pigmented epithelial 1 (RPE1) cells immunostained for TALPID3 (yellow), centrioles (γ-TUB, cyan), and cilia (ARL13B, magenta). (B) Quantification of TALPID3 levels …
Figure 5—figure supplement 2
PCM1 promotes mother centriole association with vesicles.
Serial-section transmission electron microscopy (TEM) images of wild-type (A) and PCM1−/− (B) retinal pigmented epithelial 1 (RPE1) cells 1 hr after serum starvation. Subdistal appendages (SDA) are …
Figure 6 with 1 supplement
PCM1 promotes removal of CP110 and CEP97 from the mother centriole.
(A) Wild-type and PCM1−/− RPE1 cells serum starved for 24 hr immunostained for CP110 (yellow), centrioles (FOP, cyan), and distal appendages (CEP164, magenta). (B) Wild-type and PCM1−/− RPE1 cells …
Figure 6—figure supplement 1
PCM1 promotes removal of CP110 from basal bodies of airway multiciliated cells.
(A) Wild-type and Pcm1−/− wholemount trachea from P45 mice immunostained for basal bodies (FOP, magenta) and CP110 (yellow). (B) Quantification of CP110 intensity at basal bodies of wild-type and Pcm…
Figure 7 with 1 supplement
PCM1 promotes IFT recruitment and transition zone formation.
(A) Wild-type and PCM1−/− RPE1 cells immunostained for IFT88 (yellow), centrioles (γ-TUB, cyan), and cilia (ARL13B, magenta). (B) Quantification of IFT88 intensity at basal bodies. (C) …
Figure 7—figure supplement 1
PCM1 does not control IFT88 levels in MEF cilia.
(A) Wild-type and Pcm1−/− MEFs immunostained for IFT88 (yellow), cilia (TUBAc, magenta), and nuclei (DAPI, blue). (B) Quantification of IFT88 intensity along the cilia, calculated from line plots of …
Figure 8 with 1 supplement
PCM1 restricts CP110 and CEP97 localization to distal mother centrioles.
(A) Wild-type and PCM1−/− RPE1 cells immunostained for CP110 (yellow), centriolar satellites (PCM1, magenta), and nuclei (DAPI, blue) in cells with serum (cycling) or 1 or 24 hr after withdrawing …
-
Figure 8—source data 1
Full uncropped immunoblots for Figure 8C, I and Figure 8—figure supplement 1E, labeled and unlabeled.
- https://cdn.elifesciences.org/articles/79299/elife-79299-fig8-data1-v2.pdf
Figure 8—figure supplement 1
CP110 localizes to satellites in a CEP290-dependent manner.
(A, B) Cycling wild-type and PCM1−/− RPE1 cells immunostained for CEP290 (yellow), PCM1 (cyan), and CP110 (magenta). (C) Cycling wild-type RPE1 cell stained for Centrin2 (centrioles, CETN2, yellow), …
Figure 9
Centriolar satellites remodel centrioles to promote ciliogenesis.
(A) PCM1 (cyan) scaffolds centriolar satellites, dynamic and heterogeneous condensates of centriolar proteins. During ciliogenesis, we propose that centriolar satellites remove, or wick away, CP110 …
Author response image 1
(A) Wild-type and PCM1-/- RPE1 cells were transduced with scrambled (Scr) control or CP110 shRNAs (#1 and #2). Cells were serum starved for 24 h and immunostained with ARL13B (magenta) and FOP …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Pcm1∆5-14Pcm1em1Pmi MGI:6865681 | This paper | Allele symbol: Pcm1em1Pmi Allele synonym: Pcm1∆5-14; Accession ID: MGI:6865681 | |
| Genetic reagent (M. musculus) | Pcm1∆796-800Pcm1em2Pmi MGI:6865682 | This paper | Allele symbol: Pcm1em2Pmi Allele synonym: Pcm1∆796-800; Accession ID: MGI:6865681 | |
| Genetic reagent (M. musculus) | Pcm1SNAPPcm1em3Pmi MGI:6865681 | This paper | Allele symbol: Pcm1em3Pmi Allele synonym: Pcm1SNAP; Accession ID: MGI:6865681 | |
| Biological sample (M. musculus) | Mouse embryonic fibroblasts (MEFs) | This paper | N/A | |
| Biological sample (M. musculus) | Mouse tracheal epithelial cells (mTECs) | This paper | N/A | See Vladar and Brody, 2013 for protocol. |
| Biological sample (M. musculus) | PCM1−/− RPE 1 | Kumar et al., 2021 | All Figures except Figure 8—figure supplement 1 | |
| Biological sample (M. musculus) | PCM1−/− RPE 1 | Gheiratmand et al., 2019 | In Figure 8—figure supplement 1 | |
| Sequence-based reagent | Pcm1 Exon 2 | Dharmacon | 5′-ATTAAAGGCAACATGGCCAC-3′ | RISPR guide for generation of Pcm15-14 and Pcm1SNAP mouse |
| Sequence-based reagent | Pcm1 Exon 6 | Dharmacon | 5′-TCAGGCCAGAGATCCTCAGC-3′ | CRISPR guide for generation of Pcm1 796–800 mouse |
| Sequence-based reagent | SNAP repair | IDT | 5′- aaaaataattctgaagccaaaaaccgctgcaaggaggatttatgagtttggcagacttcagggagattgacacaacactatgagagacagtaagcactcattgaaatgtgtttagtgcatttgttctgttttatttggaacaaactttattttaaatagcttactataagctcaggctggtctagaacacctgattctcatacttacctcctagtactgcgattataagcatgtgctaccatctccattatataatgtgtatatcatgtagatcaatttatctgtgatacgtgtttgatagtgtattcttttatatttttggttgtgagcctagcctttaacagctgagccatctctccagctcgatagtgtattctttaagataagtgtttgaaagattcctttatattaataagtttgatagaatgctttaaaatctgaagatggttcagcatatgaaagtgcttgccatacaaacctgatgacctcagatcacacagtggcaggagagaactgactccagatagttgctctgacctctgcacacatgctatggtacatacatgtctgcacttacatacaaaaacatgcatatacacaatataattattagtacattttataataaaataaagtttgtctttctgtgttaaaaattaatttttacttattttgcagAGAATTAATTAAAGGCAACATGGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGGCAAGCTGGAACTGTCTGGGTGCGAACAGGGCCTGCACCGTATCATCTTCCTGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAAGTGCCTGCCCCAGCCGCCGTGCTGGGCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAACGCCTACTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCCTGCACCACCCAGTGTTCCAGCAGGAGAGCTTTACCCGCCAGGTGCTGTGGAAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCTACAGCCACCTGGCCGCCCTGGCCGGCAATCCCGCCGCCACCGCCGCCGTGAAAACCGCCCTGAGCGGAAATCCCGTGCCCATTCTGATCCCCTGCCACCGGGTGGTGCAGGGCGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCCGTGAAAGAGTGGCTGCTGGCCCACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGTGGCGGAAGCGGAGCCACAGGAGGAGGTCCTTTTGAAGAAGTCATGCATGATCAGGACTTACCAAACTGGAGCAATGACAGTGTGGATGACCGACTCAACAATATGGTATGATGTTttactctgggtggtatattgttgaccactaatgttcagtgaggctctcccatcgattgtatttactgaaactctgtaaaaactgtaggcagatagactaagggactcttggttgaagacactttagctgtagttaatagaaagcatgaattagcttaaacaaaaaatgatttattaaaaggaggtgaaagtgctttatggaagccatgttaaagagtatagctcagttttaggaaaggaaaaagaaacagcagagttgttcgaaattgcttttcacctctgtgcctgtgcttctaagaccttttccctaaccgagctttcccttctagatctgccttctttctctctctgctttgtgtcatatattgagatggcctttttaaagatttgcagccatggaggaacttatataatgactaatttaacattatgattatctagctaaatttgtttagatctccttttttcacttatcaggatcatgaaagggatgaattaaataatataaaaggttcacaggactacccatacatggaacagttcctcgaggggcaaaatttcctagaagtgatgacagtactaagcagttttattatag- 3′ | Repair template for generation of Pcm1SNAP mouse |
| Sequence-based reagent | PCM1 Exon 3 | Synthego | 5′-GAAAAGAAUAAGAAAAAGUU-3′ | CRISPR guide for generation of PCM1−/− RPE cells |
| Sequence-based reagent | PCM1 Exon 3 | Synthego | 5′-CGACUCCGGAGAAAUAUCA-3′ | CRISPR guide for generation of PCM1−/− RPE cells |
| Sequence-based reagent | Luciferase GL2 Duplex siRNA | Dharmacon | 5′-CGUACGCGGAAUACUUCGA-3′ | Control siRNA |
| Sequence-based reagent | CEP290 ID: s37024 Silencer Select siRNA | Ambion/Thermo Fisher | 5′-GAUACUCGGUUUUUACGUA-3′ | CEP290 siRNA |
| Sequence-based reagent | CEP290 ID: s37025 Silencer Select siRNA | Ambion/Thermo Fisher | 5′-CACUUACGGACUUCGUUAA-3′ | CEP290 siRNA |
| Sequence-based reagent | Pcm1 2F | Sigma | 5′ CTCTGACCTCTGCACACATG 3′ | Genotyping Pcm1∆5-14 mouse. PCR followed by Sanger sequencing. Product size: 332 bp |
| Sequence-based reagent | Pcm1 2R | Sigma | 5′ ACAATCGATGGGAGAGCCTC 3′ | Genotyping Pcm1∆5-14 mouse. PCR followed by Sanger sequencing. Product size: 332 bp |
| Sequence-based reagent | Pcm1 6F | Sigma | 5′ AGTATCGCTGTACTTTGCCA 3′ | Genotyping Pcm1∆796-800 mouse. PCR followed by Dde1 digestion. Product size: 266 bp |
| Sequence-based reagent | Pcm1 6R | Sigma | 5′ CAGAGTCATCCATCACAGCTAT 3′ | Genotyping Pcm1∆796-800 mouse. PCR followed by Dde1 digestion. Product size: 266 bp |
| Sequence-based reagent | Pcm1 2F | Sigma | 5′ CTCTGACCTCTGCACACATG 3′ | Genotyping Pcm1SNAP mouse. PCR. Product size: 332 bp, only amplifies in WT |
| Sequence-based reagent | Pcm1 2R | Sigma | 5′ ACAATCGATGGGAGAGCCTC 3′ | Genotyping Pcm1SNAP mouse. PCR. Product size: 332 bp, only amplifies in WT |
| Sequence-based reagent | SNAP F | Sigma | 5′ GGCCTGCACCGTATCATCTT 3′ | Genotyping Pcm1SNAP mouse. PCR. Product size: 132 bp, only amplifies in mutant |
| Sequence-based reagent | SNAP R | Sigma | 5′ AAAGTAGGCGTTGAGCCAGG 3′ | Genotyping Pcm1SNAP mouse. PCR. Product size: 132 bp, only amplifies in mutant |
| Chemical compound, drug | SNAP-Cell 647-SiR | New England Biolabs | ||
| Chemical compound, drug | nocodozole | Sigma | SML1665 | 20 μM |
| Antibody | Acetylated Alpha Tubulin | Sigma | 6-11B-1 T6793 | IF (1:1000–1:2000) |
| Antibody | ANKRD26 | GeneTex | GTX128255 | IF(1:100 MeOH) |
| Antibody | ARL13B | Proteintech Group | 17711-1-AP | IF (1:1000, PFA) |
| Antibody | α-tubulin | Sigma | DM1A | WB (1:1000) |
| Antibody | α-tubulin | Abcam | ab4074 | WB (1:1000) |
| Antibody | CENTRIN | Merck | 20 H5 04-1624 | IF (1:300 MeOH w. PE) |
| Antibody | CENTRIOLIN | Santa Cruz | sc-365521 | IF (1:100 MeOH w PE) |
| Antibody | CENTROBIN | Abcam | Ab70448 | IF (1:100 MeOH) |
| Antibody | CEP131 | Proteintech Group | 25735-1-AP | IF (1:75 MeOH w PE) |
| Antibody | CEP162 | Sigma Prestige | HPA030170 | IF(1:100 MeOH) |
| Antibody | CEP164 | Santa Cruz | sc-240226 | IF(1:100 MeOH) |
| Antibody | CEP290 | Santa Cruz | B-7 sc-390462 | IF (1:500 MeOH) |
| Antibody | CEP97 | Proteintech Group | 22050-1-AP | IF(1:100 MeOH) |
| Antibody | CP110 | Proteintech Group | 12780-1-AP | IF/WB (1:1000) |
| Antibody | CP110 | Millipore | MABT1354 | IF (1:100 MeOH w. PE) |
| Antibody | FBF1 | Proteintech Group | 11531-1-AP | IF(1:100 MeOH) |
| Antibody | FOP | Proteintech Group | 11343-1-AP | IF (1:100 PFA or MeOH) |
| Antibody | Gamma Tubulin | Sigma | GTU88 T6557 | IF (1:500, MeOH w PE) |
| Antibody | GAPDH | Proteintech Group | 6008-1-Ig | WB (1:100,000) |
| Antibody | IFT81 | Proteintech Group | 11744-1-AP | IF (1:100 PFA) |
| Antibody | IFT88 | Proteintech Group | 13967-1-AP | IF (1:100 PFA) |
| Antibody | MIB1 | Sigma | M5948 | IF (1:1000 MeOH w. PE) |
| Antibody | MYOVA | Cell Signaling Technology | 3402S | IF(1:100 MeOH) |
| Antibody | NINEIN | Michel Bornens | L79 | IF(1:200 MeOH) |
| Antibody | PCM1 | Proteintech Group | 19856-1-AP | IF (1:100, MeOH w PE) |
| Antibody | PCM1 C | Novus Biologicals | NBP1-87196 | WB (1:1000) |
| Antibody | PCM1 N | Novus Biologicals | H0005108-B01P | WB (1:1000) |
| Antibody | PCM1 | Santa Cruz | D-19 sc-50164 | (Figure 7—figure supplement 1) IF (1:1000 MeOH) |
| Antibody | PCNT | Abcam | ab4448 | IF (1:1000, MeOH) |
| Antibody | Polyglutamylated tubulin | Adipogen HPA030170 | AG-20B-0020-C100/GT335 | IF (1:500) |
| Antibody | RAB34 | Proteintech Group | 27435-1-AP | IF (1:500) |
| Antibody | RPGRIP1L | Proteintech Group | 29778-1-AP | IF (1:100 PFA w 1% SDS) |
| Antibody | TALPID3 | Proteintech Group | 24421-1-AP | IF(1:100 MeOH) |
| Antibody | TTBK2 | Sigma | HPA018113 | IF(I:100) |
| Antibody | ECL -Mouse IgG, HRP-conjugated Host: Sheep | GE Healthcare UK Ltd | WB (1:7500) | |
| Antibody | ECL -Rabbit IgG, HRP-conjugated Host: Sheep | GE Healthcare UK Ltd | WB (1:7500) | |
| Antibody | HRP-conjugated –Rabbit IgG H+L Host: Goat | Bio-Rad | WB (1:5000) | |
| Antibody | HRP-conjugated –Mouse IgG H+L Host: Goat | Bio-Rad | WB (1:5000) | |
| Antibody | Alexa 488-conjugated – Mouse Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
| Antibody | Alexa 594-conjugated – Rabbit Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
| Antibody | Alexa 488-conjugated – Rabbit Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
| Antibody | Alexa 594-conjugated – Mouse Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
| Antibody | Alexa 647-conjugated – Rabbit Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
| Antibody | Alexa 647-conjugated – Mouse Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
| Antibody | Alexa 647-conjugated – Goat Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
| Software algorithm | QuPath | PMID:29203879 | https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper | |
| Software algorithm | Nis-Elements AR V4.6 | Nikon Instruments | ||
| Software algorithm | FIJI | Schindelin et al., 2012 | https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper | |
| Software algorithm | CellProfiler | Stirling et al., 2021 | https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper | |
| Software algorithm | Imaris | Oxford Instruments |
Additional files
-
Supplementary file 1
gRNAs, repair template and siRNA sequences.
- https://cdn.elifesciences.org/articles/79299/elife-79299-supp1-v2.xlsx
-
Supplementary file 2
Genotyping primer sequences.
- https://cdn.elifesciences.org/articles/79299/elife-79299-supp2-v2.xlsx
-
Supplementary file 3
Primary antibodies.
- https://cdn.elifesciences.org/articles/79299/elife-79299-supp3-v2.xlsx
-
Supplementary file 4
Secondary antibodies.
- https://cdn.elifesciences.org/articles/79299/elife-79299-supp4-v2.xlsx
-
Supplementary file 5
Differentially expressed proteins between wild-type and Pcm1−/− mouse tracheal epithelial cells (mTECs) on at least one timepoint (ALI1, ALI7, and/or ALI21).
Expression is given as label-free quantitative (LFQ) normalized by variance stabilizing transformation as described in Materials and Methods, significantly differentially expressed proteins were defined by a false discovery rate (FDR) cutoff of 0.05.
- https://cdn.elifesciences.org/articles/79299/elife-79299-supp5-v2.xlsx
-
Transparent reporting form
- https://cdn.elifesciences.org/articles/79299/elife-79299-transrepform1-v2.docx
