Centriolar satellites expedite mother centriole remodeling to promote ciliogenesis

  1. Emma A Hall
  2. Dhivya Kumar
  3. Suzanna L Prosser
  4. Patricia L Yeyati
  5. Vicente Herranz-Pérez
  6. Jose Manuel García-Verdugo
  7. Lorraine Rose
  8. Lisa McKie
  9. Daniel O Dodd
  10. Peter A Tennant
  11. Roly Megaw
  12. Laura C Murphy
  13. Marisa F Ferreira
  14. Graeme Grimes
  15. Lucy Williams
  16. Tooba Quidwai
  17. Laurence Pelletier
  18. Jeremy F Reiter  Is a corresponding author
  19. Pleasantine Mill  Is a corresponding author
  1. MRC Human Genetics Unit, Institute of Genetics and Cancer, University of Edinburgh, United Kingdom
  2. Department of Biochemistry and Biophysics, Cardiovascular Research Institute, University of California, United States
  3. Lunenfeld-Tanenbaum Research Institute, Sinai Health System, Canada
  4. Cavanilles Institute of Biodiversity and Evolutionary Biology, University of Valencia, Spain
  5. Predepartamental Unit of Medicine, Jaume I University, Spain
  6. Institute of Genetics and Cancer, University of Edinburgh, United Kingdom
  7. Department of Molecular Genetics, University of Toronto, Canada
  8. Chan Zuckerberg Biohub, United States
10 figures, 1 table and 6 additional files

Figures

Figure 1 with 3 supplements
PCM1 is important for perinatal survival.

(A) Immunoblot of mouse embryonic fibroblast (MEF) lysates from wild-type and Pcm1−/− MEFs for PCM1 and GAPDH (loading control). Gel stained with Coomassie blue. (B) Immunostaining of PCM1 (yellow) …

Figure 1—figure supplement 1
PCM1 promotes survival and growth.

(A) Schematics of two CRISPR/Cas9-generated indels in Pcm1, Pcm1Δ5-14 and Pcm1Δ796-800. Both Pcm1Δ5-14 and Pcm1Δ796-800 create frameshifts. Schematic of PCM1 protein, indicating predicted …

Figure 1—figure supplement 2
Pcm1Δ5-14/Δ5-14 and Pcm1Δ796-800/Δ796-800 mice exhibit comparable phenotypes.

(A, B) Observed number of wild-type, Pcm1+/Δ5-14, Pcm1Δ5-14/Δ5-14, Pcm1+/Δ796-800, and Pcm1Δ796-800/Δ796-800 mice as a percentage of the expected number. Chi-squared: ***p < 0.01, *p < 0.05. (C, D) …

Figure 1—figure supplement 3
PCM1 is dispensable for ciliogenesis in some cell types.

(A, C, E) Sagittal sections of wild-type and Pcm1−/− E18.5 embryos immunostained for cilia (polyglutamylated tubulin: TUBPolyE, magenta and ARL13B, yellow). Nuclear stain …

Figure 2 with 4 supplements
Pcm1−/− mice display ciliopathy-associated phenotypes.

(A) Pcm1−/− mouse displaying a domed skull indicative of hydrocephaly. (B) Coronal sections of 5-week-old wild-type and Pcm1−/− brains. (C) Percentages of wild-type and Pcm1−/− mice exhibiting …

Figure 2—figure supplement 1
Pcm1−/− mice display a subset of ciliopathy-associated phenotypes.

(A) Coronal (6 weeks, top images) and sagittal (8 months, bottom images) optical projection tomography (OPT) images of brains of wild-type and Pcm1−/− mice. Dilated ventricle is marked by an arrow. …

Figure 2—video 1
Wild-type sperm morphology and movement.

Sperm were isolated from wild-type testes and imaged in dilute methyl cellulose.

Figure 2—video 2
Pcm1−/− sperm are immotile and lack normal head structures.

Sperm were isolated from Pcm1−/− testes and imaged in dilute methyl cellulose.

Figure 2—video 3
Pcm1−/− sperm exhibit disrupted movement.

Sperm were isolated from Pcm1−/− testes and imaged in media without methyl cellulose.

Figure 3 with 10 supplements
PCM1 is required for efficient basal body synthesis and multiciliogenesis.

(A) Wild-type and Pcm1−/− P3 wholemount brain ventricles immunostained for basal bodies (FOP, yellow), actin (phalloidin, cyan) and cilia (TUBAc, magenta). Inset depicts area of ventricle imaged …

Figure 3—figure supplement 1
Centriole amplification is delayed and fibrogranular material is disrupted in Pcm1−/− ependymal cells.

Ependymal cells from P5 (A) and P16 (B) wild-type and Pcm1−/− ventricles immunostained for basal bodies (FOP, yellow), cilia (TUBAc, magenta) and, at P5, actin (phalloidin, cyan). (C) Cultured …

Figure 3—figure supplement 2
Pcm1−/− ependymal cells form elongated centriole-like structures.

(A) Ependymal cells from P3 wild-type and Pcm1−/− ventricles immunostained for FOP (yellow), actin (phalloidin, cyan), and nuclei (DAPI, blue). A single optical section basal to most basal bodies is …

Figure 3—figure supplement 3
Delayed expression of ciliary proteins in Pcm1−/− mouse tracheal epithelium cells (mTECs).

(A) Wild-type and Pcm1−/− mTECs immunostained for basal bodies (FOP, yellow), cilia (TUBAc, magenta), and nuclei (DAPI, blue) 4, 7, or 12 days after placement at air–liquid interface (ALI). Below: …

Figure 3—video 1
Wild-type cultured ependymal cilia beat in a coordinated way 14 days after serum withdrawal.
Figure 3—video 2
Pcm1−/− ependymal cilia show uncoordinated, slow ciliary beat 16 days after serum withdrawal.
Figure 3—video 3
Pcm1−/− ependymal cilia show uncoordinated, slow ciliary beat 14 days after serum withdrawal.
Figure 3—video 4
Cilia of a tracheal wholemount preparation from a 3-month-old wild-type mouse beating.
Figure 3—video 5
Cilia of a tracheal wholemount preparation from a 2-month-old Pcm1−/− mouse beating.
Figure 3—video 6
Wild-type ALI12 mouse tracheal epithelium cell (mTEC) cilia beating.
Figure 3—video 7
Pcm1−/− ALI12 mouse tracheal epithelium cell (mTEC) cilia beating.
Figure 4 with 2 supplements
PCM1 is essential for centriolar satellite integrity and, in some cell types, ciliogenesis.

(A) Immunoblot of wild-type and PCM1−/ retinal pigmented epithelial 1 (RPE1) cell lysates for PCM1 and GAPDH (loading control). Gel stained with Coomassie blue. (B) Wild-type and PCM1−/− RPE1 cells …

Figure 4—source data 1

Full uncropped immunoblots for Figure 4G, labeled and unlabeled.

https://cdn.elifesciences.org/articles/79299/elife-79299-fig4-data1-v2.pdf
Figure 4—figure supplement 1
PCM1 is dispensable for ciliogenesis in mouse embryonic fibroblasts (MEFs).

(A) Wild-type and Pcm1−/− MEFs serum starved for 36 hr and immunostained for ARL13B (yellow), TUBAc (magenta), and nuclei (DAPI, blue). Scale bar: 10 µm. (B) Percentage of wild-type and Pcm1−/ MEFs …

Figure 4—video 1
Centriolar satellites frequently fuse and divide near the basal body.

Endogenous PCM1-SNAP labeled with tetramethylrhodamine (TMR)-SNAP (yellow) in Pcm1SNAP mouse embryonic fibroblasts (MEFs) reveals that centriolar satellites show saltatory movement, coalescing and …

Figure 5 with 2 supplements
PCM1 promotes mother centriole docking to preciliary vesicles.

(A) 3D-SIM images of Myosin-Va (MyoVa, yellow), centrioles (γ-TUB, cyan) and cilia (TUBAc, magenta) in wild-type and PCM1−/− RPE cells 1 hr after serum starvation. Scale bars: 1 and 0.5 μm for main …

Figure 5—figure supplement 1
PCM1 is dispensable for mother centriole maturation.

(A) Wild-type and PCM1−/− retinal pigmented epithelial 1 (RPE1) cells immunostained for TALPID3 (yellow), centrioles (γ-TUB, cyan), and cilia (ARL13B, magenta). (B) Quantification of TALPID3 levels …

Figure 5—figure supplement 2
PCM1 promotes mother centriole association with vesicles.

Serial-section transmission electron microscopy (TEM) images of wild-type (A) and PCM1−/− (B) retinal pigmented epithelial 1 (RPE1) cells 1 hr after serum starvation. Subdistal appendages (SDA) are …

Figure 6 with 1 supplement
PCM1 promotes removal of CP110 and CEP97 from the mother centriole.

(A) Wild-type and PCM1−/− RPE1 cells serum starved for 24 hr immunostained for CP110 (yellow), centrioles (FOP, cyan), and distal appendages (CEP164, magenta). (B) Wild-type and PCM1−/− RPE1 cells …

Figure 6—figure supplement 1
PCM1 promotes removal of CP110 from basal bodies of airway multiciliated cells.

(A) Wild-type and Pcm1−/− wholemount trachea from P45 mice immunostained for basal bodies (FOP, magenta) and CP110 (yellow). (B) Quantification of CP110 intensity at basal bodies of wild-type and Pcm…

Figure 7 with 1 supplement
PCM1 promotes IFT recruitment and transition zone formation.

(A) Wild-type and PCM1−/− RPE1 cells immunostained for IFT88 (yellow), centrioles (γ-TUB, cyan), and cilia (ARL13B, magenta). (B) Quantification of IFT88 intensity at basal bodies. (C) …

Figure 7—figure supplement 1
PCM1 does not control IFT88 levels in MEF cilia.

(A) Wild-type and Pcm1−/− MEFs immunostained for IFT88 (yellow), cilia (TUBAc, magenta), and nuclei (DAPI, blue). (B) Quantification of IFT88 intensity along the cilia, calculated from line plots of …

Figure 8 with 1 supplement
PCM1 restricts CP110 and CEP97 localization to distal mother centrioles.

(A) Wild-type and PCM1−/− RPE1 cells immunostained for CP110 (yellow), centriolar satellites (PCM1, magenta), and nuclei (DAPI, blue) in cells with serum (cycling) or 1 or 24 hr after withdrawing …

Figure 8—figure supplement 1
CP110 localizes to satellites in a CEP290-dependent manner.

(A, B) Cycling wild-type and PCM1−/− RPE1 cells immunostained for CEP290 (yellow), PCM1 (cyan), and CP110 (magenta). (C) Cycling wild-type RPE1 cell stained for Centrin2 (centrioles, CETN2, yellow), …

Centriolar satellites remodel centrioles to promote ciliogenesis.

(A) PCM1 (cyan) scaffolds centriolar satellites, dynamic and heterogeneous condensates of centriolar proteins. During ciliogenesis, we propose that centriolar satellites remove, or wick away, CP110 …

Author response image 1

(A) Wild-type and PCM1-/- RPE1 cells were transduced with scrambled (Scr) control or CP110 shRNAs (#1 and #2). Cells were serum starved for 24 h and immunostained with ARL13B (magenta) and FOP …

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent (M. musculus)Pcm15-14Pcm1em1Pmi MGI:6865681This paperAllele symbol: Pcm1em1Pmi Allele synonym: Pcm15-14; Accession ID: MGI:6865681
Genetic reagent (M. musculus)Pcm1∆796-800Pcm1em2Pmi MGI:6865682This paperAllele symbol: Pcm1em2Pmi Allele synonym: Pcm1796-800; Accession ID: MGI:6865681
Genetic reagent (M. musculus)Pcm1SNAPPcm1em3Pmi MGI:6865681This paperAllele symbol: Pcm1em3Pmi Allele synonym: Pcm1SNAP; Accession ID: MGI:6865681
Biological sample (M. musculus)Mouse embryonic fibroblasts (MEFs)This paperN/A
Biological sample (M. musculus)Mouse tracheal epithelial cells (mTECs)This paperN/ASee Vladar and Brody, 2013 for protocol.
Biological sample (M. musculus)PCM1−/− RPE 1Kumar et al., 2021All Figures except Figure 8—figure supplement 1
Biological sample (M. musculus)PCM1−/− RPE 1Gheiratmand et al., 2019In Figure 8—figure supplement 1
Sequence-based reagentPcm1 Exon 2Dharmacon5′-ATTAAAGGCAACATGGCCAC-3′RISPR guide for generation of Pcm15-14 and Pcm1SNAP mouse
Sequence-based reagentPcm1 Exon 6Dharmacon5′-TCAGGCCAGAGATCCTCAGC-3′CRISPR guide for generation of Pcm1 796–800 mouse
Sequence-based reagentSNAP repairIDT5′- aaaaataattctgaagccaaaaaccgctgcaaggaggatttatgagtttggcagacttcagggagattgacacaacactatgagagacagtaagcactcattgaaatgtgtttagtgcatttgttctgttttatttggaacaaactttattttaaatagcttactataagctcaggctggtctagaacacctgattctcatacttacctcctagtactgcgattataagcatgtgctaccatctccattatataatgtgtatatcatgtagatcaatttatctgtgatacgtgtttgatagtgtattcttttatatttttggttgtgagcctagcctttaacagctgagccatctctccagctcgatagtgtattctttaagataagtgtttgaaagattcctttatattaataagtttgatagaatgctttaaaatctgaagatggttcagcatatgaaagtgcttgccatacaaacctgatgacctcagatcacacagtggcaggagagaactgactccagatagttgctctgacctctgcacacatgctatggtacatacatgtctgcacttacatacaaaaacatgcatatacacaatataattattagtacattttataataaaataaagtttgtctttctgtgttaaaaattaatttttacttattttgcagAGAATTAATTAAAGGCAACATGGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGGCAAGCTGGAACTGTCTGGGTGCGAACAGGGCCTGCACCGTATCATCTTCCTGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAAGTGCCTGCCCCAGCCGCCGTGCTGGGCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAACGCCTACTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCCTGCACCACCCAGTGTTCCAGCAGGAGAGCTTTACCCGCCAGGTGCTGTGGAAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCTACAGCCACCTGGCCGCCCTGGCCGGCAATCCCGCCGCCACCGCCGCCGTGAAAACCGCCCTGAGCGGAAATCCCGTGCCCATTCTGATCCCCTGCCACCGGGTGGTGCAGGGCGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCCGTGAAAGAGTGGCTGCTGGCCCACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGTGGCGGAAGCGGAGCCACAGGAGGAGGTCCTTTTGAAGAAGTCATGCATGATCAGGACTTACCAAACTGGAGCAATGACAGTGTGGATGACCGACTCAACAATATGGTATGATGTTttactctgggtggtatattgttgaccactaatgttcagtgaggctctcccatcgattgtatttactgaaactctgtaaaaactgtaggcagatagactaagggactcttggttgaagacactttagctgtagttaatagaaagcatgaattagcttaaacaaaaaatgatttattaaaaggaggtgaaagtgctttatggaagccatgttaaagagtatagctcagttttaggaaaggaaaaagaaacagcagagttgttcgaaattgcttttcacctctgtgcctgtgcttctaagaccttttccctaaccgagctttcccttctagatctgccttctttctctctctgctttgtgtcatatattgagatggcctttttaaagatttgcagccatggaggaacttatataatgactaatttaacattatgattatctagctaaatttgtttagatctccttttttcacttatcaggatcatgaaagggatgaattaaataatataaaaggttcacaggactacccatacatggaacagttcctcgaggggcaaaatttcctagaagtgatgacagtactaagcagttttattatag- 3′Repair template for generation of Pcm1SNAP mouse
Sequence-based reagentPCM1 Exon 3Synthego5′-GAAAAGAAUAAGAAAAAGUU-3′CRISPR guide for generation of PCM1−/− RPE cells
Sequence-based reagentPCM1 Exon 3Synthego5′-CGACUCCGGAGAAAUAUCA-3′CRISPR guide for generation of PCM1−/− RPE cells
Sequence-based reagentLuciferase GL2 Duplex siRNADharmacon5′-CGUACGCGGAAUACUUCGA-3′Control siRNA
Sequence-based reagentCEP290 ID: s37024 Silencer Select siRNAAmbion/Thermo Fisher5′-GAUACUCGGUUUUUACGUA-3′CEP290 siRNA
Sequence-based reagentCEP290 ID: s37025 Silencer Select siRNAAmbion/Thermo Fisher5′-CACUUACGGACUUCGUUAA-3′CEP290 siRNA
Sequence-based reagentPcm1 2FSigma5′ CTCTGACCTCTGCACACATG 3′Genotyping Pcm15-14 mouse. PCR followed by Sanger sequencing. Product size: 332 bp
Sequence-based reagentPcm1 2RSigma5′ ACAATCGATGGGAGAGCCTC 3′Genotyping Pcm15-14 mouse. PCR followed by Sanger sequencing. Product size: 332 bp
Sequence-based reagentPcm1 6FSigma5′ AGTATCGCTGTACTTTGCCA 3′Genotyping Pcm1796-800 mouse. PCR followed by Dde1 digestion. Product size: 266 bp
Sequence-based reagentPcm1 6RSigma5′ CAGAGTCATCCATCACAGCTAT 3′Genotyping Pcm1796-800 mouse. PCR followed by Dde1 digestion. Product size: 266 bp
Sequence-based reagentPcm1 2FSigma5′ CTCTGACCTCTGCACACATG 3′Genotyping Pcm1SNAP mouse. PCR. Product size: 332 bp, only amplifies in WT
Sequence-based reagentPcm1 2RSigma5′ ACAATCGATGGGAGAGCCTC 3′Genotyping Pcm1SNAP mouse. PCR. Product size: 332 bp, only amplifies in WT
Sequence-based reagentSNAP FSigma5′ GGCCTGCACCGTATCATCTT 3′Genotyping Pcm1SNAP mouse. PCR. Product size: 132 bp, only amplifies in mutant
Sequence-based reagentSNAP RSigma5′ AAAGTAGGCGTTGAGCCAGG 3′Genotyping Pcm1SNAP mouse. PCR. Product size: 132 bp, only amplifies in mutant
Chemical compound, drugSNAP-Cell 647-SiRNew England Biolabs
Chemical compound, drugnocodozoleSigmaSML166520 μM
AntibodyAcetylated Alpha TubulinSigma6-11B-1 T6793IF (1:1000–1:2000)
AntibodyANKRD26GeneTexGTX128255IF(1:100 MeOH)
AntibodyARL13BProteintech Group17711-1-APIF (1:1000, PFA)
Antibodyα-tubulinSigmaDM1AWB (1:1000)
Antibodyα-tubulinAbcamab4074WB (1:1000)
AntibodyCENTRINMerck20 H5 04-1624IF (1:300 MeOH w. PE)
AntibodyCENTRIOLINSanta Cruzsc-365521IF (1:100 MeOH w PE)
AntibodyCENTROBINAbcamAb70448IF (1:100 MeOH)
AntibodyCEP131Proteintech Group25735-1-APIF (1:75 MeOH w PE)
AntibodyCEP162Sigma PrestigeHPA030170IF(1:100 MeOH)
AntibodyCEP164Santa Cruzsc-240226IF(1:100 MeOH)
AntibodyCEP290Santa CruzB-7 sc-390462IF (1:500 MeOH)
AntibodyCEP97Proteintech Group22050-1-APIF(1:100 MeOH)
AntibodyCP110Proteintech Group12780-1-APIF/WB (1:1000)
AntibodyCP110MilliporeMABT1354IF (1:100 MeOH w. PE)
AntibodyFBF1Proteintech Group11531-1-APIF(1:100 MeOH)
AntibodyFOPProteintech Group11343-1-APIF (1:100 PFA or MeOH)
AntibodyGamma TubulinSigmaGTU88 T6557IF (1:500, MeOH w PE)
AntibodyGAPDHProteintech Group6008-1-IgWB (1:100,000)
AntibodyIFT81Proteintech Group11744-1-APIF (1:100 PFA)
AntibodyIFT88Proteintech Group13967-1-APIF (1:100 PFA)
AntibodyMIB1SigmaM5948IF (1:1000 MeOH w. PE)
AntibodyMYOVACell Signaling Technology3402SIF(1:100 MeOH)
AntibodyNINEINMichel BornensL79IF(1:200 MeOH)
AntibodyPCM1Proteintech Group19856-1-APIF (1:100, MeOH w PE)
AntibodyPCM1 CNovus BiologicalsNBP1-87196WB (1:1000)
AntibodyPCM1 NNovus BiologicalsH0005108-B01PWB (1:1000)
AntibodyPCM1Santa CruzD-19 sc-50164(Figure 7—figure supplement 1) IF (1:1000 MeOH)
AntibodyPCNTAbcamab4448IF (1:1000, MeOH)
AntibodyPolyglutamylated tubulinAdipogen HPA030170AG-20B-0020-C100/GT335IF (1:500)
AntibodyRAB34Proteintech Group27435-1-APIF (1:500)
AntibodyRPGRIP1LProteintech Group29778-1-APIF (1:100 PFA w 1% SDS)
AntibodyTALPID3Proteintech Group24421-1-APIF(1:100 MeOH)
AntibodyTTBK2SigmaHPA018113IF(I:100)
AntibodyECL -Mouse IgG, HRP-conjugated Host: SheepGE Healthcare UK LtdWB (1:7500)
AntibodyECL -Rabbit IgG, HRP-conjugated Host: SheepGE Healthcare UK LtdWB (1:7500)
AntibodyHRP-conjugated –Rabbit IgG H+L Host: GoatBio-RadWB (1:5000)
AntibodyHRP-conjugated –Mouse IgG H+L Host: GoatBio-RadWB (1:5000)
AntibodyAlexa 488-conjugated – Mouse Host: DonkeyInvitrogen Molecular ProbesIF (1:500)
AntibodyAlexa 594-conjugated – Rabbit Host: DonkeyInvitrogen Molecular ProbesIF (1:500)
AntibodyAlexa 488-conjugated – Rabbit Host: DonkeyInvitrogen Molecular ProbesIF (1:500)
AntibodyAlexa 594-conjugated – Mouse Host: DonkeyInvitrogen Molecular ProbesIF (1:500)
AntibodyAlexa 647-conjugated – Rabbit Host: DonkeyInvitrogen Molecular ProbesIF (1:500)
AntibodyAlexa 647-conjugated – Mouse Host: DonkeyInvitrogen Molecular ProbesIF (1:500)
AntibodyAlexa 647-conjugated – Goat Host: DonkeyInvitrogen Molecular ProbesIF (1:500)
Software algorithmQuPathPMID:29203879https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper
Software algorithmNis-Elements AR V4.6Nikon Instruments
Software algorithmFIJISchindelin et al., 2012https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper
Software algorithmCellProfilerStirling et al., 2021https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper
Software algorithmImarisOxford Instruments

Additional files

Supplementary file 1

gRNAs, repair template and siRNA sequences.

https://cdn.elifesciences.org/articles/79299/elife-79299-supp1-v2.xlsx
Supplementary file 2

Genotyping primer sequences.

https://cdn.elifesciences.org/articles/79299/elife-79299-supp2-v2.xlsx
Supplementary file 3

Primary antibodies.

https://cdn.elifesciences.org/articles/79299/elife-79299-supp3-v2.xlsx
Supplementary file 4

Secondary antibodies.

https://cdn.elifesciences.org/articles/79299/elife-79299-supp4-v2.xlsx
Supplementary file 5

Differentially expressed proteins between wild-type and Pcm1−/− mouse tracheal epithelial cells (mTECs) on at least one timepoint (ALI1, ALI7, and/or ALI21).

Expression is given as label-free quantitative (LFQ) normalized by variance stabilizing transformation as described in Materials and Methods, significantly differentially expressed proteins were defined by a false discovery rate (FDR) cutoff of 0.05.

https://cdn.elifesciences.org/articles/79299/elife-79299-supp5-v2.xlsx
Transparent reporting form
https://cdn.elifesciences.org/articles/79299/elife-79299-transrepform1-v2.docx

Download links