(A) Immunoblot of mouse embryonic fibroblast (MEF) lysates from wild-type and Pcm1−/− MEFs for PCM1 and GAPDH (loading control). Gel stained with Coomassie blue. (B) Immunostaining of PCM1 (yellow) …
Full uncropped immunoblots for Figure 1A and Figure 1—figure supplement 1C, labeled and unlabeled.
(A) Schematics of two CRISPR/Cas9-generated indels in Pcm1, Pcm1Δ5-14 and Pcm1Δ796-800. Both Pcm1Δ5-14 and Pcm1Δ796-800 create frameshifts. Schematic of PCM1 protein, indicating predicted …
(A, B) Observed number of wild-type, Pcm1+/Δ5-14, Pcm1Δ5-14/Δ5-14, Pcm1+/Δ796-800, and Pcm1Δ796-800/Δ796-800 mice as a percentage of the expected number. Chi-squared: ***p < 0.01, *p < 0.05. (C, D) …
(A, C, E) Sagittal sections of wild-type and Pcm1−/− E18.5 embryos immunostained for cilia (polyglutamylated tubulin: TUBPolyE, magenta and ARL13B, yellow). Nuclear stain …
(A) Pcm1−/− mouse displaying a domed skull indicative of hydrocephaly. (B) Coronal sections of 5-week-old wild-type and Pcm1−/− brains. (C) Percentages of wild-type and Pcm1−/− mice exhibiting …
(A) Coronal (6 weeks, top images) and sagittal (8 months, bottom images) optical projection tomography (OPT) images of brains of wild-type and Pcm1−/− mice. Dilated ventricle is marked by an arrow. …
Sperm were isolated from wild-type testes and imaged in dilute methyl cellulose.
Sperm were isolated from Pcm1−/− testes and imaged in dilute methyl cellulose.
Sperm were isolated from Pcm1−/− testes and imaged in media without methyl cellulose.
(A) Wild-type and Pcm1−/− P3 wholemount brain ventricles immunostained for basal bodies (FOP, yellow), actin (phalloidin, cyan) and cilia (TUBAc, magenta). Inset depicts area of ventricle imaged …
Ependymal cells from P5 (A) and P16 (B) wild-type and Pcm1−/− ventricles immunostained for basal bodies (FOP, yellow), cilia (TUBAc, magenta) and, at P5, actin (phalloidin, cyan). (C) Cultured …
(A) Ependymal cells from P3 wild-type and Pcm1−/− ventricles immunostained for FOP (yellow), actin (phalloidin, cyan), and nuclei (DAPI, blue). A single optical section basal to most basal bodies is …
(A) Wild-type and Pcm1−/− mTECs immunostained for basal bodies (FOP, yellow), cilia (TUBAc, magenta), and nuclei (DAPI, blue) 4, 7, or 12 days after placement at air–liquid interface (ALI). Below: …
(A) Immunoblot of wild-type and PCM1−/− retinal pigmented epithelial 1 (RPE1) cell lysates for PCM1 and GAPDH (loading control). Gel stained with Coomassie blue. (B) Wild-type and PCM1−/− RPE1 cells …
Full uncropped immunoblots for Figure 4G, labeled and unlabeled.
(A) Wild-type and Pcm1−/− MEFs serum starved for 36 hr and immunostained for ARL13B (yellow), TUBAc (magenta), and nuclei (DAPI, blue). Scale bar: 10 µm. (B) Percentage of wild-type and Pcm1−/− MEFs …
Endogenous PCM1-SNAP labeled with tetramethylrhodamine (TMR)-SNAP (yellow) in Pcm1SNAP mouse embryonic fibroblasts (MEFs) reveals that centriolar satellites show saltatory movement, coalescing and …
(A) 3D-SIM images of Myosin-Va (MyoVa, yellow), centrioles (γ-TUB, cyan) and cilia (TUBAc, magenta) in wild-type and PCM1−/− RPE cells 1 hr after serum starvation. Scale bars: 1 and 0.5 μm for main …
(A) Wild-type and PCM1−/− retinal pigmented epithelial 1 (RPE1) cells immunostained for TALPID3 (yellow), centrioles (γ-TUB, cyan), and cilia (ARL13B, magenta). (B) Quantification of TALPID3 levels …
Serial-section transmission electron microscopy (TEM) images of wild-type (A) and PCM1−/− (B) retinal pigmented epithelial 1 (RPE1) cells 1 hr after serum starvation. Subdistal appendages (SDA) are …
(A) Wild-type and PCM1−/− RPE1 cells serum starved for 24 hr immunostained for CP110 (yellow), centrioles (FOP, cyan), and distal appendages (CEP164, magenta). (B) Wild-type and PCM1−/− RPE1 cells …
(A) Wild-type and Pcm1−/− wholemount trachea from P45 mice immunostained for basal bodies (FOP, magenta) and CP110 (yellow). (B) Quantification of CP110 intensity at basal bodies of wild-type and Pcm…
(A) Wild-type and PCM1−/− RPE1 cells immunostained for IFT88 (yellow), centrioles (γ-TUB, cyan), and cilia (ARL13B, magenta). (B) Quantification of IFT88 intensity at basal bodies. (C) …
(A) Wild-type and Pcm1−/− MEFs immunostained for IFT88 (yellow), cilia (TUBAc, magenta), and nuclei (DAPI, blue). (B) Quantification of IFT88 intensity along the cilia, calculated from line plots of …
(A) Wild-type and PCM1−/− RPE1 cells immunostained for CP110 (yellow), centriolar satellites (PCM1, magenta), and nuclei (DAPI, blue) in cells with serum (cycling) or 1 or 24 hr after withdrawing …
Full uncropped immunoblots for Figure 8C, I and Figure 8—figure supplement 1E, labeled and unlabeled.
(A, B) Cycling wild-type and PCM1−/− RPE1 cells immunostained for CEP290 (yellow), PCM1 (cyan), and CP110 (magenta). (C) Cycling wild-type RPE1 cell stained for Centrin2 (centrioles, CETN2, yellow), …
(A) PCM1 (cyan) scaffolds centriolar satellites, dynamic and heterogeneous condensates of centriolar proteins. During ciliogenesis, we propose that centriolar satellites remove, or wick away, CP110 …
Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
---|---|---|---|---|
Genetic reagent (M. musculus) | Pcm1∆5-14Pcm1em1Pmi MGI:6865681 | This paper | Allele symbol: Pcm1em1Pmi Allele synonym: Pcm1∆5-14; Accession ID: MGI:6865681 | |
Genetic reagent (M. musculus) | Pcm1∆796-800Pcm1em2Pmi MGI:6865682 | This paper | Allele symbol: Pcm1em2Pmi Allele synonym: Pcm1∆796-800; Accession ID: MGI:6865681 | |
Genetic reagent (M. musculus) | Pcm1SNAPPcm1em3Pmi MGI:6865681 | This paper | Allele symbol: Pcm1em3Pmi Allele synonym: Pcm1SNAP; Accession ID: MGI:6865681 | |
Biological sample (M. musculus) | Mouse embryonic fibroblasts (MEFs) | This paper | N/A | |
Biological sample (M. musculus) | Mouse tracheal epithelial cells (mTECs) | This paper | N/A | See Vladar and Brody, 2013 for protocol. |
Biological sample (M. musculus) | PCM1−/− RPE 1 | Kumar et al., 2021 | All Figures except Figure 8—figure supplement 1 | |
Biological sample (M. musculus) | PCM1−/− RPE 1 | Gheiratmand et al., 2019 | In Figure 8—figure supplement 1 | |
Sequence-based reagent | Pcm1 Exon 2 | Dharmacon | 5′-ATTAAAGGCAACATGGCCAC-3′ | RISPR guide for generation of Pcm15-14 and Pcm1SNAP mouse |
Sequence-based reagent | Pcm1 Exon 6 | Dharmacon | 5′-TCAGGCCAGAGATCCTCAGC-3′ | CRISPR guide for generation of Pcm1 796–800 mouse |
Sequence-based reagent | SNAP repair | IDT | 5′- aaaaataattctgaagccaaaaaccgctgcaaggaggatttatgagtttggcagacttcagggagattgacacaacactatgagagacagtaagcactcattgaaatgtgtttagtgcatttgttctgttttatttggaacaaactttattttaaatagcttactataagctcaggctggtctagaacacctgattctcatacttacctcctagtactgcgattataagcatgtgctaccatctccattatataatgtgtatatcatgtagatcaatttatctgtgatacgtgtttgatagtgtattcttttatatttttggttgtgagcctagcctttaacagctgagccatctctccagctcgatagtgtattctttaagataagtgtttgaaagattcctttatattaataagtttgatagaatgctttaaaatctgaagatggttcagcatatgaaagtgcttgccatacaaacctgatgacctcagatcacacagtggcaggagagaactgactccagatagttgctctgacctctgcacacatgctatggtacatacatgtctgcacttacatacaaaaacatgcatatacacaatataattattagtacattttataataaaataaagtttgtctttctgtgttaaaaattaatttttacttattttgcagAGAATTAATTAAAGGCAACATGGACAAAGACTGCGAAATGAAGCGCACCACCCTGGATAGCCCTCTGGGCAAGCTGGAACTGTCTGGGTGCGAACAGGGCCTGCACCGTATCATCTTCCTGGGCAAAGGAACATCTGCCGCCGACGCCGTGGAAGTGCCTGCCCCAGCCGCCGTGCTGGGCGGACCAGAGCCACTGATGCAGGCCACCGCCTGGCTCAACGCCTACTTTCACCAGCCTGAGGCCATCGAGGAGTTCCCTGTGCCAGCCCTGCACCACCCAGTGTTCCAGCAGGAGAGCTTTACCCGCCAGGTGCTGTGGAAACTGCTGAAAGTGGTGAAGTTCGGAGAGGTCATCAGCTACAGCCACCTGGCCGCCCTGGCCGGCAATCCCGCCGCCACCGCCGCCGTGAAAACCGCCCTGAGCGGAAATCCCGTGCCCATTCTGATCCCCTGCCACCGGGTGGTGCAGGGCGACCTGGACGTGGGGGGCTACGAGGGCGGGCTCGCCGTGAAAGAGTGGCTGCTGGCCCACGAGGGCCACAGACTGGGCAAGCCTGGGCTGGGTGGCGGAAGCGGAGCCACAGGAGGAGGTCCTTTTGAAGAAGTCATGCATGATCAGGACTTACCAAACTGGAGCAATGACAGTGTGGATGACCGACTCAACAATATGGTATGATGTTttactctgggtggtatattgttgaccactaatgttcagtgaggctctcccatcgattgtatttactgaaactctgtaaaaactgtaggcagatagactaagggactcttggttgaagacactttagctgtagttaatagaaagcatgaattagcttaaacaaaaaatgatttattaaaaggaggtgaaagtgctttatggaagccatgttaaagagtatagctcagttttaggaaaggaaaaagaaacagcagagttgttcgaaattgcttttcacctctgtgcctgtgcttctaagaccttttccctaaccgagctttcccttctagatctgccttctttctctctctgctttgtgtcatatattgagatggcctttttaaagatttgcagccatggaggaacttatataatgactaatttaacattatgattatctagctaaatttgtttagatctccttttttcacttatcaggatcatgaaagggatgaattaaataatataaaaggttcacaggactacccatacatggaacagttcctcgaggggcaaaatttcctagaagtgatgacagtactaagcagttttattatag- 3′ | Repair template for generation of Pcm1SNAP mouse |
Sequence-based reagent | PCM1 Exon 3 | Synthego | 5′-GAAAAGAAUAAGAAAAAGUU-3′ | CRISPR guide for generation of PCM1−/− RPE cells |
Sequence-based reagent | PCM1 Exon 3 | Synthego | 5′-CGACUCCGGAGAAAUAUCA-3′ | CRISPR guide for generation of PCM1−/− RPE cells |
Sequence-based reagent | Luciferase GL2 Duplex siRNA | Dharmacon | 5′-CGUACGCGGAAUACUUCGA-3′ | Control siRNA |
Sequence-based reagent | CEP290 ID: s37024 Silencer Select siRNA | Ambion/Thermo Fisher | 5′-GAUACUCGGUUUUUACGUA-3′ | CEP290 siRNA |
Sequence-based reagent | CEP290 ID: s37025 Silencer Select siRNA | Ambion/Thermo Fisher | 5′-CACUUACGGACUUCGUUAA-3′ | CEP290 siRNA |
Sequence-based reagent | Pcm1 2F | Sigma | 5′ CTCTGACCTCTGCACACATG 3′ | Genotyping Pcm1∆5-14 mouse. PCR followed by Sanger sequencing. Product size: 332 bp |
Sequence-based reagent | Pcm1 2R | Sigma | 5′ ACAATCGATGGGAGAGCCTC 3′ | Genotyping Pcm1∆5-14 mouse. PCR followed by Sanger sequencing. Product size: 332 bp |
Sequence-based reagent | Pcm1 6F | Sigma | 5′ AGTATCGCTGTACTTTGCCA 3′ | Genotyping Pcm1∆796-800 mouse. PCR followed by Dde1 digestion. Product size: 266 bp |
Sequence-based reagent | Pcm1 6R | Sigma | 5′ CAGAGTCATCCATCACAGCTAT 3′ | Genotyping Pcm1∆796-800 mouse. PCR followed by Dde1 digestion. Product size: 266 bp |
Sequence-based reagent | Pcm1 2F | Sigma | 5′ CTCTGACCTCTGCACACATG 3′ | Genotyping Pcm1SNAP mouse. PCR. Product size: 332 bp, only amplifies in WT |
Sequence-based reagent | Pcm1 2R | Sigma | 5′ ACAATCGATGGGAGAGCCTC 3′ | Genotyping Pcm1SNAP mouse. PCR. Product size: 332 bp, only amplifies in WT |
Sequence-based reagent | SNAP F | Sigma | 5′ GGCCTGCACCGTATCATCTT 3′ | Genotyping Pcm1SNAP mouse. PCR. Product size: 132 bp, only amplifies in mutant |
Sequence-based reagent | SNAP R | Sigma | 5′ AAAGTAGGCGTTGAGCCAGG 3′ | Genotyping Pcm1SNAP mouse. PCR. Product size: 132 bp, only amplifies in mutant |
Chemical compound, drug | SNAP-Cell 647-SiR | New England Biolabs | ||
Chemical compound, drug | nocodozole | Sigma | SML1665 | 20 μM |
Antibody | Acetylated Alpha Tubulin | Sigma | 6-11B-1 T6793 | IF (1:1000–1:2000) |
Antibody | ANKRD26 | GeneTex | GTX128255 | IF(1:100 MeOH) |
Antibody | ARL13B | Proteintech Group | 17711-1-AP | IF (1:1000, PFA) |
Antibody | α-tubulin | Sigma | DM1A | WB (1:1000) |
Antibody | α-tubulin | Abcam | ab4074 | WB (1:1000) |
Antibody | CENTRIN | Merck | 20 H5 04-1624 | IF (1:300 MeOH w. PE) |
Antibody | CENTRIOLIN | Santa Cruz | sc-365521 | IF (1:100 MeOH w PE) |
Antibody | CENTROBIN | Abcam | Ab70448 | IF (1:100 MeOH) |
Antibody | CEP131 | Proteintech Group | 25735-1-AP | IF (1:75 MeOH w PE) |
Antibody | CEP162 | Sigma Prestige | HPA030170 | IF(1:100 MeOH) |
Antibody | CEP164 | Santa Cruz | sc-240226 | IF(1:100 MeOH) |
Antibody | CEP290 | Santa Cruz | B-7 sc-390462 | IF (1:500 MeOH) |
Antibody | CEP97 | Proteintech Group | 22050-1-AP | IF(1:100 MeOH) |
Antibody | CP110 | Proteintech Group | 12780-1-AP | IF/WB (1:1000) |
Antibody | CP110 | Millipore | MABT1354 | IF (1:100 MeOH w. PE) |
Antibody | FBF1 | Proteintech Group | 11531-1-AP | IF(1:100 MeOH) |
Antibody | FOP | Proteintech Group | 11343-1-AP | IF (1:100 PFA or MeOH) |
Antibody | Gamma Tubulin | Sigma | GTU88 T6557 | IF (1:500, MeOH w PE) |
Antibody | GAPDH | Proteintech Group | 6008-1-Ig | WB (1:100,000) |
Antibody | IFT81 | Proteintech Group | 11744-1-AP | IF (1:100 PFA) |
Antibody | IFT88 | Proteintech Group | 13967-1-AP | IF (1:100 PFA) |
Antibody | MIB1 | Sigma | M5948 | IF (1:1000 MeOH w. PE) |
Antibody | MYOVA | Cell Signaling Technology | 3402S | IF(1:100 MeOH) |
Antibody | NINEIN | Michel Bornens | L79 | IF(1:200 MeOH) |
Antibody | PCM1 | Proteintech Group | 19856-1-AP | IF (1:100, MeOH w PE) |
Antibody | PCM1 C | Novus Biologicals | NBP1-87196 | WB (1:1000) |
Antibody | PCM1 N | Novus Biologicals | H0005108-B01P | WB (1:1000) |
Antibody | PCM1 | Santa Cruz | D-19 sc-50164 | (Figure 7—figure supplement 1) IF (1:1000 MeOH) |
Antibody | PCNT | Abcam | ab4448 | IF (1:1000, MeOH) |
Antibody | Polyglutamylated tubulin | Adipogen HPA030170 | AG-20B-0020-C100/GT335 | IF (1:500) |
Antibody | RAB34 | Proteintech Group | 27435-1-AP | IF (1:500) |
Antibody | RPGRIP1L | Proteintech Group | 29778-1-AP | IF (1:100 PFA w 1% SDS) |
Antibody | TALPID3 | Proteintech Group | 24421-1-AP | IF(1:100 MeOH) |
Antibody | TTBK2 | Sigma | HPA018113 | IF(I:100) |
Antibody | ECL -Mouse IgG, HRP-conjugated Host: Sheep | GE Healthcare UK Ltd | WB (1:7500) | |
Antibody | ECL -Rabbit IgG, HRP-conjugated Host: Sheep | GE Healthcare UK Ltd | WB (1:7500) | |
Antibody | HRP-conjugated –Rabbit IgG H+L Host: Goat | Bio-Rad | WB (1:5000) | |
Antibody | HRP-conjugated –Mouse IgG H+L Host: Goat | Bio-Rad | WB (1:5000) | |
Antibody | Alexa 488-conjugated – Mouse Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
Antibody | Alexa 594-conjugated – Rabbit Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
Antibody | Alexa 488-conjugated – Rabbit Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
Antibody | Alexa 594-conjugated – Mouse Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
Antibody | Alexa 647-conjugated – Rabbit Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
Antibody | Alexa 647-conjugated – Mouse Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
Antibody | Alexa 647-conjugated – Goat Host: Donkey | Invitrogen Molecular Probes | IF (1:500) | |
Software algorithm | QuPath | PMID:29203879 | https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper | |
Software algorithm | Nis-Elements AR V4.6 | Nikon Instruments | ||
Software algorithm | FIJI | Schindelin et al., 2012 | https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper | |
Software algorithm | CellProfiler | Stirling et al., 2021 | https://github.com/IGC-Advanced-Imaging-Resource/Hall2022_Paper | |
Software algorithm | Imaris | Oxford Instruments |
gRNAs, repair template and siRNA sequences.
Genotyping primer sequences.
Primary antibodies.
Secondary antibodies.
Differentially expressed proteins between wild-type and Pcm1−/− mouse tracheal epithelial cells (mTECs) on at least one timepoint (ALI1, ALI7, and/or ALI21).
Expression is given as label-free quantitative (LFQ) normalized by variance stabilizing transformation as described in Materials and Methods, significantly differentially expressed proteins were defined by a false discovery rate (FDR) cutoff of 0.05.