Strain, strain background (Mus musculus) | C57BL/6J | Jackson Laboratory | Cat# 000664; RRID:IMSR_JAX:000664 | |
Strain, strain background (M. musculus) | C57BL/6J Ism1 whole-body knockout | Jiang et al., 2021 | Cat# 036776 | Generated from C57BL/6J-Ism1em1Kajs/J |
Cell line (M. musculus) | C2C12 | ATCC | CRL-1772; RRID:CVCL_0188 | |
Cell line (M. musculus) | 3T3-F442A | MilliporeSigma | Cat# 00070654; RRID:CVCL_0122 | |
Cell line (Homo sapiens) | Expi293F | Thermo Fisher | Cat#: A14527; RRID:CVCL_D615 | |
Antibody | Anti-p-AKT (Ser473) (rabbit monoclonal) | Cell Signaling Technology | Cat# 4060; RRID:AB_2315049 | (1:2000) |
Antibody | Anti-Akt (pan) (rabbit monoclonal) | Cell Signaling Technology | Cat# 4691; RRID:AB_915783 | (1:1000) |
Antibody | Anti-p-S6 ribosomal protein (Ser235/236) (rabbit polyclonal) | Cell Signaling Technology | Cat# 2211; RRID:AB_331679 | (1:1000) |
Antibody | Anti-S6 ribosomal protein (rabbit monoclonal) | Cell Signaling Technology | Cat# 2217, RRID:AB_331355 | (1:1000) |
Antibody | Anti-p-mTOR (Ser2448) (rabbit monoclonal) | Cell Signaling Technology | Cat# 5536; RRID:AB_10691552 | (1:1000) |
Antibody | Anti-mTOR (rabbit monoclonal) | Cell Signaling Technology | Cat# 2983; RRID:AB_2105622 | (1:1000) |
Antibody | Anti-beta actin [AC-15] (HRP) (mouse monoclonal) | Abcam | Cat# AB49900; RRID:AB_867494 | (1:25,000) |
Antibody | Antibody cocktail: OXPHOS Rodent WB Antibody Cocktail (mouse monoclonal) | Thermo Fisher | Cat# 45-8099; RRID:AB_2533835 | (1:1000) |
Antibody | Anti-phospho-IRS-1 (Ser307) antibody (rabbit polyclonal) | Cell Signaling Technology | Cat# 2381; RRID:AB_330342 | (1:1000) |
Antibody | Anti-IRS-1 antibody (rabbit monoclonal) | Cell Signaling Technology | Cat# 3407; RRID:AB_2127860 | (1:1000) |
Antibody | Anti-alpha tubulin antibody (rabbit polyclonal) | Abcam | Cat# ab4074; RRID:AB_2288001 | (1:1000) |
Antibody | Anti-p27 Kip1 antibody (SX53G8.5) (mouse monoclonal) | Cell Signaling Technology | Cat# 3698; RRID:AB_2077832 | (1:1000) |
Antibody | IgG HRP linked Ab (rabbit polyclonal) | MilliporeSigma | Cat# NA934; RRID:AB_2722659 | (1:1000) |
Antibody | IgG HRP linked Ab (mouse monoclonal) | MilliporeSigma | Cat# NA931; RRID:AB_772210 | (1:1000) |
Antibody | Anti-laminin B2 antibody, clone A5 (rat monoclonal) | MilliporeSigma | Cat# 05-206; RRID:AB_309655 | (1:200) |
Antibody | Anti-rat IgG secondary antibody, Alexa Fluor 594 (goat polyclonal) | Thermo Fisher Scientific | Cat# A11007; RRID:AB_10561522 | (1:1000) |
Sequence-based reagent | Myh1_F | This paper | PCR primer | GCGAATCGAGGCTCAGAACAA |
Sequence-based reagent | Myh1_R | This paper | PCR primer | GTAGTTCCGCCTTCGGTCTTG |
Sequence-based reagent | Myh2_F | This paper | PCR primer | AAGTGACTGTGAAAACAGAAGCA |
Sequence-based reagent | Myh2_R | This paper | PCR primer | GCAGCCATTTGTAAGGGTTGAC |
Sequence-based reagent | Myh4_F | This paper | PCR primer | TTGAAAAGACGAAGCAGCGAC |
Sequence-based reagent | Myh4_R | This paper | PCR primer | AGAGAGCGGGACTCCTTCTG |
Sequence-based reagent | Myh7_F | This paper | PCR primer | ACTGTCAACACTAAGAGGGTCA |
Sequence-based reagent | Myh7_R | This paper | PCR primer | TTGGATGATTTGATCTTCCAGGG |
Sequence-based reagent | Ppargc1a_F | This paper | PCR primer | TATGGAGTGACATAGAGTGTGCT |
Sequence-based reagent | Ppargc1a_R | This paper | PCR primer | CCACTTCAATCCACCCAGAAAG |
Sequence-based reagent | Foxo1_F | This paper | PCR primer | CCCAGGCCGGAGTTTAACC |
Sequence-based reagent | Foxo1_R | This paper | PCR primer | GTTGCTCATAAAGTCGGTGCT |
Sequence-based reagent | Foxo3_F | This paper | PCR primer | CTGGGGGAACCTGTCCTATG |
Sequence-based reagent | Foxo3_R | This paper | PCR primer | TCATTCTGAACGCGCATGAAG |
Sequence-based reagent | Foxo4_F | This paper | PCR primer | GGTGCCCTACTTCAAGGACA |
Sequence-based reagent | Foxo4_R | This paper | PCR primer | AGCTTGCTGCTGCTATCCAT |
Sequence-based reagent | Cdkn1b_F | This paper | PCR primer | TCAAACGTGAGAGTGTCTAACG |
Sequence-based reagent | Cdkn1b_R | This paper | PCR primer | CCGGGCCGAAGAGATTTCTG |
Sequence-based reagent | Eif4ebp1_F | This paper | PCR primer | GGGGACTACAGCACCACTC |
Sequence-based reagent | Eif4ebp1_R | This paper | PCR primer | CTCATCGCTGGTAGGGCTA |
Sequence-based reagent | Ctsl_F | This paper | PCR primer | TATCCCTCAGCAAGAGAAAGCCCT |
Sequence-based reagent | Ctsl_R | This paper | PCR primer | TCCTTCATAGCCATAGCCCACCAA |
Sequence-based reagent | Fbxo30_F | This paper | PCR primer | TCGTGGAATGGTAATCTTGC |
Sequence-based reagent | Fbxo30_R | This paper | PCR primer | CCTCCCGTTTCTCTATCACG |
Sequence-based reagent | UbC_F | This paper | PCR primer | CGTCGAGCCCAGTGTTACCACC |
Sequence-based reagent | UbC_R | This paper | PCR primer | ACCTCCCCCATCACACCCAAGA |
Peptide, recombinant protein | Mouse recombinant Ism1-his protein | This paper and PMID:34348115 | N/A | |
Peptide, recombinant protein | Recombinant mouse IGF-I/IGF-1 protein | R&D Systems | Cat# 791-MG-050 | |
Recombinant DNA reagent | Mouse Ism1 with C-terminal Myc-6X-his tag | Addgene and PMID:34348115 | Cat# 173046; RRID:Addgene_173046 | |
Commercial assay or kit | Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | Cat# 23225 | |
Commercial assay or kit | Nuclear Cytoplasmic Extraction Reagent kit | Pierce | Cat# 78833 | |
Chemical compound, drug | Bovine serum albumin | MilliporeSigma | Cat# A7906; CAS:9048-46-8 | |
Chemical compound, drug | Rapamycin | Cell Signaling Technology | Cat# 9904 | |
Chemical compound, drug | 2× SYBR Green qPCR master mix | Bimake | Cat# B21203 | |
Chemical compound, drug | Trizol | Thermo Fisher | Cat# 15-596-026 | |
Chemical compound, drug | High-capacity cDNA reverse transcription kit | Biosystems | Cat# 4368814 | |
Chemical compound, drug | DMEM/F12 + GlutaMAX | Thermo Fisher | Cat# 10565-042 | |
Chemical compound, drug | DMEM high glucose | Sigma | Cat# D6429 | |
Chemical compound, drug | Trypsin/EDTA 0.25% | Gibco | Cat# 25200-056 | |
Chemical compound, drug | Penicillin/streptomycin | Gibco | Cat# 15140-122 | |
Chemical compound, drug | PBS | Gibco | Cat# 10010-023 | |
Chemical compound, drug | Trypan Blue Stain (0.4%) | Invitrogen | Cat# T10282 | |
Chemical compound, drug | Hoechst | Thermo Fisher | Cat# 33342 | |
Chemical compound, drug | Immobilon Crescendo Western HRP substrate | MilliporeSigma | Catt# WBLUR0500 | |
Chemical compound, drug | SuperSignal West Femto HRP substrate | Thermo Scientific | Cat# 34095 | |
Chemical compound, drug | SeeBlue Plus2 prestained standard | Invitrogen | Cat# LC5925 | |
Chemical compound, drug | RIPA buffer (10×) | Cell Signaling | Cat# 9806S | |
Chemical compound, drug | NuPAGE LDS sample buffer (4×) | Invitrogen | Cat# NP0007 | |
Chemical compound, drug | 2-Mercaptoethanol | Fisher Chemical | Cat# O3446I | |
Chemical compound, drug | PhosSTOP | Roche | Cat# 04906837001 | |
Chemical compound, drug | cOmplete Tablets | Roche | Cat# 04693124001 | |
Chemical compound, drug | L-[35S]-Methionine | PerkinElmer | NEG009L005MC | |
Software, algorithm | ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/; RRID:SCR_003070 | |
Software, algorithm | GraphPad Prism version 8.0 | GraphPad Software, San Diego, CA | http://www.graphpad.com/; RRID:SCR_002798 | |
Software, algorithm | Adobe Illustrator | Adobe Systems | RRID:SCR_010279 | |
Software, algorithm | RStudio | https://rstudio.com/ | RRID:SCR_000432 | |