Zbtb14 regulates monocyte and macrophage development through inhibiting pu.1 expression in zebrafish
- Shanghai Institute of Hematology, State Key Laboratory of Medical Genomics, National Research Center for Translational Medicine at Shanghai, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, China
- CNRS-LIA Hematology and Cancer, Sino-French Research Center for Life Sciences and Genomics, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, China
- Laboratory of Immunology and Regeneration, School of Medicine, South China University of Technology, China
- Université de Paris 7/INSERM/CNRS UMR 944/7212, Equipe Labellisée Ligue Nationale Contre le Cancer, Hôpital St. Louis, France
Figures
Figure 1
The establishment of a zebrafish zbtb14 knockout line.
(A) Sequence alignment of. ZBTB14 and Zbtb14 proteins. Hs: Homo sapiens, Dr: Danio rerio. The conserved BTB domain and C2H2 zinc finger domains are boxed. *: The mutated serine identified in an acute myeloid leukemia (AML) patient. The putative SUMOylated lysine K40 and the nuclear localization signal (NLS) are underlined, respectively. (B) Schematic representation of Cas9 target site in the first exon of zebrafish zbtb14. The deleted nucleotides in the mutant gene are marked by hyphens. (C) Schematic representation of wild type (442 amino acids) and mutant Zbtb14 proteins (80 amino acids). (D) Western blot analysis of HA-tagged wild type and mutant Zbtb14 proteins expressed in HEK293 cells. * indicates the adduct band.
-
Figure 1—source data 1
Source data for Figure 1D.
- https://cdn.elifesciences.org/articles/80760/elife-80760-fig1-data1-v3.zip
Figure 2 with 1 supplement
Deficiency of zbtb14 specifically impairs monocyte and macrophage development in embryonic and adult zebrafish.
(A–G’) Whole-mount in situ hybridization (WISH) analyses of macrophage markers mfap4 (A–D’), csf1ra (E–F’), mpeg1.1 (G, G’) from 19.5 hr post-fertilization (hpf) to 3 days post-fertilization (dpf) in wild type (WT) and zbtb14-deficient embryos and larvae. Red arrows indicate the main positions of positive cells for each marker. n/n, number of embryos/larvae showing representative phenotype/total number of embryos/larvae examined. (H) Statistical results for A–G’ (Student’s t test, N=3, 14–28 embryos were used for each probe. Each dot represents the mean value of one experiment, which was obtained from the counts of all of the embryos/larvae in the same group. Error bars represent mean ± standard error of the mean (SEM). **p<0.01, ***p<0.001, ****p<0.0001). (I–J’) GFP positive cells were increased in zbtb14-/-//Tg(mpeg1.1:eGFP) embryos at 2 and 3 dpf. (K) Statistical results for I–J’ (Student’s t test, N=3, 14–22 larvae were used for each experiment. Each dot represents the mean value of one experiment. Error bars represent mean ± SEM. **p<0.01, ***p<0.001). (L–M’) GFP positive cells in both Tg(mpeg1.1:eGFP) and zbtb14-/-//Tg(mpeg1.1:eGFP) larvae can migrate to the wound. (N–Q’) apoeb and neutral red positive cells were both increased in zbtb14-deficient larvae at 2 and 3 dpf. (R) Statistical results for N–Q’ (Student’s t test, N=3, 15–22 larvae were used for each experiment. Each dot represents the mean value of one experiment. Error bars represent mean ± SEM. ***p<0.001, ****p<0.0001). (S–T’) Representative scatterplot generated by FACS analysis of WKM samples collected from WT Tg(mpeg1.1:eGFP) (up panel) and zbtb14-/-//Tg(mpeg1.1:eGFP) (bottom panel) zebrafish lines in 4-month-old adults. M: myeloid gate. (U) Statistical results for S–T’ in WT Tg(mpeg1.1:eGFP) and zbtb14-/-//Tg(mpeg1.1:eGFP) zebrafish. (Student’s t test, N=4, each time one male and one female were used in the WT and mutant groups. Error bars represent mean ± SEM. **p<0.01).
Figure 2—figure supplement 1
Expression of lineage-specific markers during primitive and definitive hematopoiesis stages in zbtb14-deficient embryos.
Whole-mount in situ hybridization (WISH) analyses of neutrophil markers c/ebp1, mpx, lyz, and erythroid marker hbae1 at 22 hr post-fertilization (hpf) (A–D’). WISH analyses of myeloid marker c/ebpα from 14 to 22 hpf (E–H’). WISH analyses of HSPCs (hematopoietic stem and progenitor cells) marker c-myb, erythroid marker hbae1, neutrophil markers mpx, lyz, and lymphoid marker rag1 at 5 days post-fertilization (dpf) (I–M’). (N) Statistical results for A–C’, H–H’, I–I’, K–L’ (Student’s t test, N=3, 10–25 embryos or larvae were used for each probe. Each dot represents the mean value of one experiment, which was obtained from the counts of all of the embryos or larvae in the same group. ns: not statistically significant).
Figure 3
Overproliferation of macrophage progenitor is the main cause of macrophage lineage expansion in zbtb14 mutants.
(A–C’, E–G’) pH3 and transferase dUTP nick end labeling (TUNEL) assays in zbtb14-/-//Tg(mpeg1.1:eGFP) and Tg(mpeg1:EGFP) control larvae. Triangles indicate positive signals. (D, H) Statistical result for A–C’ and E–G’. Data shown are the means ± standard error of the mean (SEM) of at least 15 larvae. ns: not statistically significant, **p<0.01. (I) Classification of zebrafish monocytes/macrophages is based on their morphology. (J) Quantification of mpeg1.1 + cells at each differentiation stage. Sorted macrophage lineage cells from 10-month-old zbtb14-/-//Tg(mpeg1.1:eGFP) and Tg(mpeg1.1:eGFP) larvae were subjected to May-Grünwald-Giemsa staining and separated into immature, intermediate, and mature groups according to their morphology. Scale bar: 10 µm. Error bars represent mean ± SEM of three independent experiments. *p<0.05 (Student’s t-test).
Figure 4 with 5 supplements
Zbtb14 regulates monocyte and macrophage development through inhibiting the expression of pu.1.
(A–E) mRNA rescue assays in zbtb14-/- larvae. mfap4 probe was used in whole-mount in situ hybridization (WISH) to examine rescue effect with wild zbtb14 (C), ZBTB14 (D), DAXX-ZBTB14 (E) mRNA injections. (F) Statistical result for A–E and O–Q. The statistical significance was calculated by using one-way analysis of variance (ANOVA). The statistical significance was calculated using one-way ANOVA followed by Dunnett T3 correction. The asterisk indicates a statistical difference. (N=3, 10–32 larvae were used for each experiment. Each dot represents the mean value of one experiment. Error bars represent mean ± standard error of the mean (SEM). ****p<0.0001.) (G) Quantitative reverse transcriptase polymerase chain reaction analysis of zbtb14 and pu.1 in GFP positive cells enriched from Tg(mpeg1.1:eGFP) and zbtb14-/-//Tg(mpx:eGFP) larvae at 2 days post-fertilization (dpf). To determine the relative expression rate, data were normalized to the expression level of wild type (WT) groups (which were set to 1.0) after normalized to the internal control of β-actin (Student’s t test, N=3. Error bars represent mean ± SEM. *p<0.05, **p<0.01). (H–K’) Serial WISH analyses of pu.1 in WT and zbtb14-/- embryos. (L) Statistical results for H–K’ (Student’s t test, N=3, 10–16 embryos were used. Each dot represents the mean value of one experiment, which was obtained from the counts of all of the embryos in the same group. Error bars represent mean ± SEM. **p<0.01, ****p<0.0001). (M) Luciferase reporter assay of Zbtb14 on the pu.1 promoter. Bars showed the relative luciferase activity on the zebrafish pu.1 promoter (–0.6 kb). (Student’s t test, N=3. Error bars represent mean ± SEM. **p<0.01.) (N) Chromatin immunoprecipitation polymerase chain reaction (ChIP-PCR) analysis of pu.1 promoter in zebrafish larvae expressing GFP or Zbtb14-GFP using an anti-GFP antibody. Positive: the location of the positive primers. NC: the location of the negative control primers. The statistical significance was calculated by using one-way ANOVA. The asterisk indicates a statistical difference. (N=3. Error bars represent mean ± SEM. ns: not statistically significant, ****p<0.0001.) (O–Q) WISH assay of mfap4 in zbtb14-/- mutants injected with TOL2 mpeg1.1:Pu.1 DBD, pu.1Δ371/Δ371 mutants, and zbtb14-/-//pu.1Δ371/Δ371 double mutants.
Figure 4—figure supplement 1
Heat map of genes associated with monocyte/macrophage development in mpeg1.1+ cells isolated from Tg(mpeg1.1:eGFP) and zbtb14-/-//Tg(mpeg1.1:eGFP) larvae at 2 days post-fertilization (dpf).
The scale of color intensity was positively correlated to the fold change.
Figure 4—figure supplement 2
The role of zbtb14 in macrophage proliferation is lineage specific.
(A–A’’) Whole-mount in situ hybridization (WISH) assays of mpx in wild type, zbtb14-/-, and TOL2-mpeg1.1:pu.1-DBD injected zbtb14 mutants at 2 days post-fertilization (dpf). (B) Statistical results for A–A’’. (Student’s t test, N=3, 16–26 larvae were used. Each dot represents the mean value of one experiment, which was obtained from the counts of all of the larvae in the same group. ns: not statistically significant.) (C–D’) WISH assays of mpx and mfap4 in wild type, and TOL2-mpeg1.1:pu.1 injected wild type embryos at 2 dpf. (E) Statistical results for C–D’. (Student’s t test, N=3, 19–46 larvae were used for each probe. Each dot represents the mean value of one experiment, which was obtained from the counts of all of the larvae in the same group. ns: not statistically significant, **p<0.01.)
Figure 4—figure supplement 3
Expression of zbtb14 transcript in mpx+ and mpeg1.1+ cells at different developmental stages.
Quantitative reverse transcriptase polymerase chain reaction analysis of zbtb14 in GFP positive cells enriched from Tg(mpx:eGFP) and Tg(mpeg1.1:eGFP) larvae at 2 and 5 days post-fertilization (dpf). To determine the relative expression rate, data were normalized to the expression level of wild type (WT) Tg(mpx:eGFP) group at 2 dpf (which were set to 1.0) after normalized to the internal control of β-actin. (Student’s t test, N=3. Error bars represent mean ± standard error of the mean (SEM). **p<0.01, ****p<0.0001.)
Figure 4—figure supplement 4
Luciferase reporter assay of Pu.1 on the zbtb14 promoter.
Bars showed the relative luciferase activity on the zebrafish zbtb14 promoter (–1.1 kb). (Student’s t test, N=3. Error bars represent mean ± standard error of the mean (SEM). **p<0.01.)
Figure 4—figure supplement 5
Expression of c-myc transcript in mpeg1.1+ cells.
Quantitative reverse transcriptase polymerase chain reaction analysis of c-myc in GFP positive cells enriched from Tg(mpeg1.1:eGFP) and zbtb14-/-//Tg(mpx:eGFP) embryos at 2 days post-fertilization (dpf). To determine the relative expression rate, data were normalized to the expression level of wild type (WT) groups (which were set to 1.0) after normalized to the internal control of β-actin. (Student’s t test, N=3. Error bars represent mean ± standard error of the mean (SEM). *p<0.05.)
Figure 5
SUMOylation is indispensable for transcription repression of Zbtb14.
(A) Western blot analysis (anti-HA) of HA-tagged wild type (WT), Zbtb14K40R, and Zbtb14K259R mutant proteins expressed in HEK293T cells in the absence or presence with the SUMO (Small Ubiquitin-like MOdifier) conjugating enzyme UBC9 and SUMO1. (B) HA-tagged WT or Zbtb14K40R mutant protein was immunoprecipitated with an anti-HA antibody from HEK293T cells co-expressing GFP-SUMO1, and SUMOylated Zbtb14 protein was detected by western blot with an anti-GFP antibody. (C) Immunofluorescence analysis of WT (left panel) and Zbtb14K40R mutant protein (right panel). (D) The structure of variant forms of Zbtb14, including WT, Zbtb14K40R, and SUMO1-Zbtb14K40R mutants (top panel). Repression of luciferase expression from the zebrafish pu.1 promoter (–0.6 kb) by Zbtb14 mutants (bottom panel). Bars showed the relative luciferase activity on the zebrafish pu.1 promoter (–0.6 kb). (Student’s t test, N=3. Error bars represent mean ± standard error of the mean (SEM). ns: not statistically significant, ***p<0.001.) (E) mRNA rescue assays in zbtb14-/- mutant larvae. mfap4 probe was used in whole-mount in situ hybridization (WISH) to examine rescue effects of injections of zbtb14, zbtb14K40R, and SUMO1-zbtb14K40R mRNA. (F) Statistical result for E. The statistical significance was calculated by using one-way analysis of variance (ANOVA). The asterisk indicates a statistical difference. (N=3, 10–17 embryos were used for each experiment. Each dot represents the mean value of one experiment. Error bars represent mean ± SEM. ns: not statistically significant, ****p<0.0001.)
-
Figure 5—source data 1
Source data for Figure 5A.
- https://cdn.elifesciences.org/articles/80760/elife-80760-fig5-data1-v3.zip
-
Figure 5—source data 2
Source data for Figure 5B.
- https://cdn.elifesciences.org/articles/80760/elife-80760-fig5-data2-v3.zip
Figure 6
Human ZBTB14S8F mutant is a loss-of-function transcription factor.
(A) mRNA rescue assays in zbtb14-/- mutant larvae. mfap4 probe was used in whole-mount in situ hybridization (WISH) to examine rescue effects of injections of ZBTB14 and ZBTB14S8F mRNA. (B) Statistical result for A. The statistical significance was calculated by using one-way analysis of variance (ANOVA). The asterisk indicates a statistical difference. (N=3, 10–16 embryos were used for each experiment. Each dot represents the mean value of one experiment. Error bars represent mean ± standard error of the mean (SEM). ns: not statistically significant, ****p<0.0001.) (C) Quantitative reverse transcriptase polymerase chain reaction analysis of ZBTB14 and ZBTB14S8F transfected in HEK293T cells. To determine the relative expression rate, data were normalized to the expression level of wild type (WT) groups (which were set to 1.0) after normalized to the internal control of β-actin. (Student’s t test, N=3. Error bars represent mean ± SEM. ns: not statistically significant.) (D) Western blot analysis (anti-HA) of HA-tagged WT, ZBTB14S8A, ZBTB14S8D, ZBTB14S8F, ZBTB14S8W, and ZBTB14S8Y mutant proteins expressed in HEK293T cells in the absence or presence with baf A1 or MG132. GAPDH served as internal control.
-
Figure 6—source data 1
Source data for Figure 6D.
- https://cdn.elifesciences.org/articles/80760/elife-80760-fig6-data1-v3.zip
Author response image 1
wt: Tg(mpeg1.1:eGFP); homo: zbtb14-/-//Tg(mpeg1.1:eGFP).
Author response image 2
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HEK293T | ATCC | ||
| Antibody | Anti-HA (Rabbit monoclonal) | CST | Cat# 3724 | WB(1:1000) IP(1:50) |
| Antibody | Anti-p-Histone H3 (Ser10)(Rabbit polyclonal) | Santa Cruz | Cat# sc-8656-R | IF(1:200) |
| Antibody | Anti-Digoxigenin-AP Fab fragments(Sheep polyclonal) | Roche | Cat# 11093274910 | WISH(1:5000) |
| Sequence-based reagent | zbtb14_F | This paper | qPCR primers | CTCGTGTGTTCGGCAGTAATTG |
| Sequence-based reagent | zbtb14_R | This paper | qPCR primers | CTGGAGCGAAATCCTTACTGG |
| Sequence-based reagent | pu.1_F | This paper | qPCR primers | TCCCAGCAGTCGTAGTCCTC |
| Sequence-based reagent | pu.1_R | This paper | qPCR primers | CCATTTCGCAGAAGGTCAA |
| Sequence-based reagent | c-myc_F | This paper | qPCR primers | CAATTCTGGAACGGCATTCG |
| Sequence-based reagent | c-myc_R | This paper | qPCR primers | GAAGTAGAAGTAGGGCTGGATG |
| Commercial assay or kit | In Situ Cell Death Detection Kit, TMR red | Roche | Cat# 12156792910 | |
| Commercial assay or kit | SimpleChIP Plus Sonication Chromatin IP Kit | CST | Cat# 56383S | |
| Chemical compound, drug | MG-132 | MCE | Cat# HY-13259 | |
| Chemical compound, drug | Bafilomycin A1 | MCE | Cat# HY-100558 |
Table 1
Primers for plasmid generation, luciferase assays, qPCR, and ChIP-qPCR.
| Primers for plasmid generation | |
|---|---|
| zf zbtb14 | Forward 5'-CCGGAATTCTCCGAAACTGTGAAGTATGTG-3' |
| Reverse 5'-CCGCTCGAG TTATGAGCAGGCGATGGACTC-3' | |
| zf zbtb14K40R | Forward 5'-GTGGAGGATGTGAGGTTCAGGGCGCAT-3' |
| Reverse 5'ATGCGCCCTGAACCTCACATCCTCCAC-3' | |
| zf zbtb14K259R | Forward 5'-GCCACCGCTGACATGAGGTTTGAGTATCTGCTG-3' |
| Reverse 5'-CAGCAGATACTCAAACCTCATGTCAGCGGTGGC-3' | |
| tol2-mpeg1.1-pu.1 DBD | Forward 5'-CGGGGTACCATGAATTCGCTTGTATCAGTTCCTGC-3' |
| Reverse 5'-CCGCAATTGTTAGAGAACCTCTCCACTGAACTGG-3' | |
| hs ZBTB14 | Forward 5'-CCGGAATTCATGGAGTTTTTCATCAGTATG-3' |
| Reverse 5'-CCGCTCGAGCTAGCTACAGGCTATCGTCTC-3' | |
| hs ZBTB14S8F | Forward 5'-GGAGACGTCAAAGTAAGAAAGGAGAGAGACCCTTGA-3' |
| Reverse 5'-TCAAGGGTCTCTCTCCTTTCTTACTTTGACGTCTCC-3' | |
| hs ZBTB14S8A | Forward 5'-TTCATCAGTATGGCTGAAACCATTAAA-3' |
| Reverse 5'-TTTAATGGTTTCAGCCATACTGATGAA-3' | |
| hs ZBTB14S8D | Forward 5'-TTCATCAGTATGGATGAAACCATTAAA-3' |
| Reverse 5'-TTTAATGGTTTCATCCATACTGATGAA-3' | |
| hs ZBTB14S8W | Forward 5'-TTTTTCATCAGTATGTGGGAAACCATTAAATAT-3' |
| Reverse 5'-ATATTTAATGGTTTCCCACATACTGATGAAAAA-3' | |
| hs ZBTB14S8Y | Forward 5'-CCGGAATTCATGGAGTTTTTCATCAGTATGTAT-3' |
| Reverse 5'-CCGCTCGAGCTAGCTACAGGCTATCGTCTCCAG-3' | |
| Primers for luciferase assays | |
| zf zbtb14-Promoter | Forward 5'-CGGGGTACCCATCAGTTGTATCTTAGGTACAG-3' |
| Reverse 5'-CCGCTCGAGTGGACTCCTCATGTTTGCTCT-3' | |
| zf pu.1-Promoter | Forward 5'-CGGGGTACCACTAGTACACCTAAATTTATG-3' |
| Reverse 5'-CCGCTCGAGATTTGGCAGACCAACAACTGC-3' | |
| Primers for quantitative PCR | |
| zf β-actin | Forward 5’-TGCTGTTTTCCCCTCCATTG-3’ |
| Reverse 5’-TTCTGTCCCATGCCAACCA-3’ | |
| zf zbtb14 | Forward 5’-CTCGTGTGTTCGGCAGTAATTG-3’ |
| Reverse 5’-CTGGAGCGAAATCCTTACTGG-3’ | |
| zf pu.1 | Forward 5’-TCCCAGCAGTCGTAGTCCTC-3’ |
| Reverse 5’-CCATTTCGCAGAAGGTCAA-3’ | |
| zf c-myc | Forward 5’-CAATTCTGGAACGGCATTCG-3’ |
| Reverse 5’-GAAGTAGAAGTAGGGCTGGATG –3’ | |
| hs β-ACTIN | Forward 5’-CCAACCGCGAGAAGATGA-3’ |
| Reverse 5’-CCAGAGGCGTACAGGGATAG-3’ | |
| hs ZBTB14 | Forward 5’-CAGGATATGGGTCTGCAGGA-3’ |
| Reverse 5’-TCTTAATGCCTTGAACGCCA-3’ | |
| Primers for ChIP-qPCR | |
| Negative control primer | Forward 5’-GCTGAAATTTTGTAGTCTGTC-3’ |
| Reverse 5’-ATAAGATTTTAGTCATCAAAC-3’ | |
| Positive primer | Forward 5’-ACTAGTACACCTAAATTTATG-3’ |
| Reverse 5’-GACAGACTACAAAATTTCAGC-3’ |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Zbtb14 regulates monocyte and macrophage development through inhibiting pu.1 expression in zebrafish
eLife 11:e80760.
https://doi.org/10.7554/eLife.80760
