GJA1 depletion causes ciliary defects by affecting Rab11 trafficking to the ciliary base
- Department of Biological Sciences, Ulsan National Institute of Science and Technology, Republic of Korea
- Center for Genomic Integrity, Institute for Basic Science, Republic of Korea
- KNU-Center for Nonlinear Dynamics, CMRI, School of Life Sciences, BK21 Plus KNU Creative Bio Research Group, College of Natural Sciences, Kyungpook National University, Republic of Korea
- Department of Biomedical Engineering, Ulsan National Institute of Science and Technology, Republic of Korea
Figures
Figure 1 with 1 supplement
GJA1 is localized at the ciliary base and axonemes in addition to gap junctions in Xenopus multiciliated epithelial cells.
(A) The schematic structure of gap junction channels and GJA1. (B, C) Immunofluorescence analysis of the localization of GJA1 in Xenopus multiciliated epithelial cells. Xenopus embryos were …
Figure 1—figure supplement 1
GJA1 is localized to ciliary axonemes in Xenopus multiciliated cells and mouse tracheal tissues.
(A) Immunofluorescence analysis of GJA1 localization in Xenopus laevis multiciliated epithelial cells. Xenopus laevis embryos were microinjected with GJA1-Flag mRNA. The embryos were stained with …
Figure 2 with 1 supplement
GJA1 dysfunction causes ciliary defects in Xenopus multiciliated epithelial cells.
(A) Xenopus embryos were injected with the indicated dnGJA1 mRNAs, and the mucociliary epithelium was immunostained. The ciliary axonemes were stained with acetylated tubulin antibody (red). Basal …
-
Figure 2—source data 1
The number of multiciliated cells per unit area.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig2-data1-v2.xlsx
-
Figure 2—source data 2
The intensity of GJA1 signal as a ratio of that in the ciliary axoneme to that in the cytoplasm.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig2-data2-v2.xlsx
Figure 2—figure supplement 1
Dominant-negative GJA1 mutants cause ciliary defects and exhibit differential localization.
(A) The schematic structure of dominant-negative GJA1 mutants (dnGJA1). The T154A mutant contained a threonine (154)-to-alanine point mutation in transmembrane domain (TM) 3. The Δ130–136 mutant …
-
Figure 2—figure supplement 1—source data 1
The average lengths of ciliary axonemes.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig2-figsupp1-data1-v2.xlsx
Figure 3 with 2 supplements
Morpholino-mediated knockdown of GJA1 causes severe disruption of ciliogenesis in Xenopus multiciliated epithelial cells.
(A) Wild-type (WT) GJA1 (Wt-GJA1-Flag) mRNA or silent mutant mRNA (Mis-mGJA1-Flag; non-targetable by GJA1-MO), which was modified to be mismatched to the morpholino oligo (MO) sequence, was …
-
Figure 3—source data 1
The number of multiciliated cells per unit area.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig3-data1-v2.xlsx
-
Figure 3—source data 2
The uncropped images of Western blots.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig3-data2-v2.zip
Figure 3—figure supplement 1
Morpholino oligo (MO)-mediated knockdown of GJA1 does not affect the cell fate specification of multiciliated cells.
(A) Expression of a multiciliated cell fate marker, DNAH9, was not altered in GJA1 morphants. Scale bars: 1 mm. (B) Statistical analysis of DNAH9-positive cells in panel (A). GJA1 depletion resulted …
-
Figure 3—figure supplement 1—source data 1
The number of DNAH9-positive cells per unit area.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig3-figsupp1-data1-v2.xlsx
Figure 3—figure supplement 2
CRISPR/Cas9-mediated GJA1 knockout shows ciliary defect phenotypes similar to morpholino oligo (MO)-mediated knockdown.
(A) The sequencing results of GJA1 genomic DNA PCR products. CRISPR/Cas9-mediated GJA1 deletion mutagenesis effectively disrupted the GJA1 genomic DNA sequences of the GJA1 guide RNA target. (B) clas…
-
Figure 3—figure supplement 2—source data 1
The number of multiciliated cells per unit area.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig3-figsupp2-data1-v2.xlsx
-
Figure 3—figure supplement 2—source data 2
The uncropped images of DNA gel electrophoresis.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig3-figsupp2-data2-v2.zip
Figure 4 with 2 supplements
GJA1 depletion disrupts GRP cilium formation and left-right asymmetry.
(A) GJA1-MO was injected into the dorso-vegetal blastomeres to target gastrocoel roof plate (GRP) tissues. Nodal cilium in the GRP were stained with an anti-acetylated tubulin antibody (green), and …
-
Figure 4—source data 1
The average lengths of GRP ciliary axonemes.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig4-data1-v2.xlsx
-
Figure 4—source data 2
The numbers of embryos displaying reversed heart looping.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig4-data2-v2.xlsx
-
Figure 4—source data 3
The numbers of embryos displaying normal or abnormal PITX2 expression.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig4-data3-v2.xlsx
Figure 4—video 1
Heartbeat of a wildtype embryo.
Figure 4—video 2
Heartbeat of GJA1 a morphant embryo.
Figure 5 with 2 supplements
siRNA-mediated knockdown of GJA1 disrupts primary cilium formation in human RPE1 cells.
(A) RPE1 cells were serum-starved for 24 hr and labeled with an anti-GJA1 antibody (green), an anti-acetylated tubulin antibody (red), and DAPI (blue). siRNA-mediated knockdown of GJA1 inhibited …
-
Figure 5—source data 1
The percentage of ciliated cells.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Ciliation of RPE1 cells by serum starvation and the efficacy of GJA1 siRNA.
(A) Ciliogenesis of RPE1 was induced by serum starvation. Scale bars: 10 µm. (B) The percentage of ciliated cells in panel (A) was plotted. Error bars represent the mean ± SD. P values were …
-
Figure 5—figure supplement 1—source data 1
The percentage of ciliated cells.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig5-figsupp1-data1-v2.xlsx
-
Figure 5—figure supplement 1—source data 2
The uncropped images of Western blots.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig5-figsupp1-data2-v2.zip
Figure 5—figure supplement 2
GJA1 localizes to the Golgi complex but GJA1 depletion does not affect Golgi morphology.
(A) Serum-starved RPE1 cells were labeled with an anti-BBS4 or anti-TGN46 antibody (green), an anti-GJA1 antibody (red), and an anti-acetylated tubulin antibody (gray). GJA1 localized to the Golgi …
Figure 6 with 2 supplements
Knockdown of GJA1 results in the abnormal distribution of pericentriolar proteins involved in ciliogenesis.
(A) RPE1 cells were transfected with GJA1 siRNA and immunostained with an anti-CP110 antibody (green), an anti-acetylated tubulin antibody (red), and DAPI (blue). Two CP110 spots in both mother and …
-
Figure 6—source data 1
The percentage of CP110 dots per cell.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Subcellular localization of ciliary proteins near the pericentriolar region in GJA1-depleted RPE1 cells.
(A) Subcellular localization of ciliary proteins (Arl13B, IFT20, IFT88, and TTBK2) near the pericentriolar region during ciliogenesis. (B) RPE1 cells were transfected with GJA1 siRNA and …
Figure 6—figure supplement 2
CP110 localization in multiciliated cells in GJA1-MO-injected Xenopus embryos.
(A) Wild-type and GJA1-MO-injected embryos were stained with CP110 (red) and acetylated tubulin (green) antibodies at stage 30. Scale bars: 20 µm (upper, middle panel), 10 µm (lower panel). (B) The …
-
Figure 6—figure supplement 2—source data 1
The relative intensity of CP110 signals in the ciliated cells.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig6-figsupp2-data1-v2.xlsx
Figure 7 with 3 supplements
Knockdown of GJA1 disrupted Rab11 trafficking to the ciliary base.
(A) HA-tagged Rab11a was expressed in RPE1 cells, and the lysates were used for immunoprecipitation assays with GJA1 antibody-conjugated or IgG-conjugated beads. The immunoprecipitants were analyzed …
-
Figure 7—source data 1
The percentage of Rab11 accumulated cell.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig7-data1-v2.xlsx
-
Figure 7—source data 2
The uncropped images of western blots.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig7-data2-v2.zip
Figure 7—figure supplement 1
Identification of GJA1-interacting proteins by IP-MS.
In total, 232 proteins were detected by immunoprecipitation of GJA1 and mass spectrometry analysis. Gene ontology term analysis of the proteins identified two distinct groups of proteins involved in …
Figure 7—figure supplement 2
Basal Ca2+ levels and Ca2+ influx in GJA1-depleted RPE1 cells.
(A) Basal Ca2+ levels in RPE1 control (CTL), GJA1 siRNA-transfected, and GJA1 overexpressed cells were monitored by Fura-2 fluorescence ratios. Error bars represent the mean ± SD. P values were …
-
Figure 7—figure supplement 2—source data 1
Basal Ca2+ levels in RPE1 cells.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig7-figsupp2-data1-v2.xlsx
-
Figure 7—figure supplement 2—source data 2
Ca2+ influx in RPE1 cells.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig7-figsupp2-data2-v2.xlsx
Figure 7—figure supplement 3
GJA1 interacts with Rab8a.
(A) HA-tagged Rab8a protein was co-immunoprecipitated with GJA1. Immunoblotting (IB) was performed with anti-GJA1 and anti-HA antibodies. (B) Rab8a, Rab11, and GJA1 expression levels in GJA1 …
-
Figure 7—figure supplement 3—source data 1
The uncropped images of western blots.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig7-figsupp3-data1-v2.zip
-
Figure 7—figure supplement 3—source data 2
The uncropped images of western blots.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig7-figsupp3-data2-v2.zip
Figure 8
Dominant-negative mutant proteins of Xenopus laevis GJA1 fail to bind to Rab11.
(A) HA-tagged Rab11a and WT-GJA1-Flag or dnGJA1-Flag were co-expressed in RPE1 cells, and the lysates were used for immunoprecipitation assays with anti-flag antibody-conjugated beads. The …
-
Figure 8—source data 1
The relative Rab11a-HA binding affinity to WT-GJA1-Flag or dnGJA1-Flag mutant proteins.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig8-data1-v2.xlsx
-
Figure 8—source data 2
The uncropped images of western blots.
- https://cdn.elifesciences.org/articles/81016/elife-81016-fig8-data2-v2.zip
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Xenopus laevis) | Xenopus; Xenopus laevis | Korea National Research Resource Center (KNRRC) | KXRCR000001; KXRCR000002 | Materials and Methods 1. |
| Gene (Xenopus laevis) | GJA1 | Xenbase | XB-GENE-876609 | Materials and Methods 4. |
| Gene (Homo sapiens) | GJA1 | NCBI | Gene ID: 2697 | Materials and Methods 4. |
| Gene (Homo sapiens) | Rab11a | NCBI | Gene ID: 8766 | Materials and Methods 4. |
| Cell line (Homo sapiens) | hTERT-RPE1 | ATCC | Cat# CRL-4000; RRID:CVCL_4388 | Materials and Methods 2. |
| Sequence-based reagent | GJA1-MO | Gene Tools | XB-GENE-876609 | Materials and Methods 1.2. |
| Sequence-based reagent | GJA1-siRNA | Genolution | Gene ID: 2697 | Materials and Methods 2.1. |
| Antibody | Anti-CP110 (rabbit polyclonal) | Proteintech | 12780–1-AP; RRID:AB_10638480 | Materials and Methods 5. |
| Antibody | Anti-BBS4 (rabbit polyclonal) | Proteintech | 12766–1-AP; RRID:AB_10596774 | Materials and Methods 5. |
| Antibody | Anti-Rab11 (rabbit monoclonal) | Cell Signaling | #5589; RRID:AB_10693925 | Materials and Methods 5, 6. |
| Antibody | Anti-GJA1 (rabbit polyclonal) | ThermoFisher | PA1-25098; RRID:AB_779905 | Materials and Methods 5, 6, 7. |
| Antibody | Anti-GJA1 (mouse monoclonal) | ThermoFisher | 13–8300; RRID:AB_2533038 | Materials and Methods 5. |
Table 1
Primer information.
| Primer Name | Primer Sequences (5’ – 3’) |
|---|---|
| SalI-xlGJA1-Forward | aatgtcgacATGGGTGACTGGAGTGCCTTAGG |
| XbaI-xlGJA1-Backward | aattctagaGATCTCTAAATCATCAGGTCGTGGTCT |
| SalI-hGJA1-Forward | aatgtcgacATGGGTGACTGGAGCGCCT |
| XbaI-hGJA1-Backward | aattctagaGATCTCCAGGTCATCAGGCCG |
| point mut-xlGJA1-Forward | CGACATGGGGGATTGGAGCGCATTGGGAAGACTT |
| point mut-xlGJA1-Backward | AGTCTTCCCAATGCGCTCCAATCCCCCATGTCGA |
| point mut-hGJA1-Forward | TGAGATAAAGAAATTTAAATATGGAATAGAGGAGCATGGTAAGGTGAAA |
| point mut-hGJA1-Backward | CTTACCATGCTCCTCTATTCCATATTTAAATTTCTTTATCTCAATCTGC |
| SalI-hRab8a-Forward | aatgtcgacATGGCGAAGACCTACGATTACCTG |
| XbaI-hRab8a-Backward | aattctagaCAGAAGAACACATCGGAAAAAGCTG |
| SalI-hRab11a-Forward | aatgtcgacATGGGCACCCGCGACG |
| XbaI-hRab11a-Backward | aattctagaGATGTTCTGACAGCACTGCACCTT |
| xlGJA1-T154A-Forward | AAAGTCAAGATGCGAGGTGGACTGCTTCGCGCCTACATCATCAGCATTTTGTTTAAA |
| xlGJA1-T154A-Backward | TACTGATTTAAACAAAATGCTGATGATGTAGGCGCGAAGCAGTCCACCTCGCATCTT |
| xlGJA1-Δ130–136-Forward | ATGCACCTTAAACAATATGGCCTTGAAGAG |
| xlGJA1-Δ130–136-Backward | CTCTTCAAGGCCATATTGTTTAAGGTGCAT |
| xlGJA1-Δ234–243-Forward | TTCTATGTCACCTACAAAGACCCATTTTCT |
| xlGJA1-Δ234–243-Backward | AGAAAATGGGTCTTTGTAGGTGACATAGAA |
Additional files
-
Supplementary file 1
GJA1 IP-MS results.
Ciliogenesis genes (bold) and Ca2+ transport genes (italics) are indicated.
- https://cdn.elifesciences.org/articles/81016/elife-81016-supp1-v2.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/81016/elife-81016-mdarchecklist1-v2.docx
