Interdependent progression of bidirectional sister replisomes in E. coli
- Molecular Virology and Microbiology, Baylor College of Medicine, United States
- Graduate Program in Integrative Molecular and Biomedical Sciences, Baylor College of Medicine, United States
- Systems, Synthetic, and Physical Biology Program, Rice University, United States
- Molecular and Human Genetics, Baylor College of Medicine, United States
- Dan L Duncan Comprehensive Cancer Center, Baylor College of Medicine, United States
Figures
Figure 1
Replisome splitting.
Under slow growth conditions, E. coli bidirectional sister replisomes (yellow spheres) are initially colocalized, then separate part way through the replication period, marking a transition from …
Figure 2 with 2 supplements
Sister replisome association under slow and fast growth conditions.
(A) Three-dimensional (3D) replisome imaging. E. coli cells with an SSB-YPet tag were grown to mid-exponential phase in M9 minimal media at 37°C then imaged at 0.2 µm z-plane increments, …
Figure 2—figure supplement 1
Timeline and spatial dynamics of replication under the Splitting with cousins model.
Arrangement of replisomes and DNA in cell drawings are speculative and are based solely on measurements of genomic content and number of DnaN-YPet foci per cell (Figure 2H, I).
Figure 2—figure supplement 2
Replisome dynamics under fast growth conditions using a monomeric DnaN-mCherry fusion protein.
(A) Image of DnaN-mCherry-expressing wild-type cells (DB2962) under fast growth conditions. (B) Distribution of DnaN-mCherry foci per cell. (C) Fitness of replisome modeling as in Figure 2K. (D) …
Figure 3 with 4 supplements
Measuring the effect of replisome pairing on fork progression by whole-genome sequencing.
(A) Experimental approach. Strains carrying an inducible tetO array replication barrier (top) are roadblocked and progression of the unblocked orphaned replisome is quantified by sequencing. …
Figure 3—figure supplement 1
Individual sequencing profiles under slow growth conditions.
Profiles along the blocked chromosome arm are approximately flat between the tetO array and the most distal ter site, which terminates replication emanating from the unblocked arm. Profile noise is …
Figure 3—figure supplement 2
Individual sequencing profiles under fast growth conditions.
Slight slope on the blocked chromosome arm downstream of the tetO array indicates partial ‘read-through’ of opposite arm forks through the terminus region, eventually stopping at the tetO array. …
Figure 3—figure supplement 3
Time course of roadblocking under fast growth conditions.
(A) Sequencing profiles for +0.13 Mb roadblock (DB2185) every 30 min after TetR-YFP induction (n = 1). (B) Change in progression of the unblocked (left) replisome after roadblocking relative to time …
Figure 3—figure supplement 4
Imaging replisomes in roadblocked cells under fast growth conditions.
DB2972 cells were roadblocked at +0.13 Mb from oriC for 2 hr and imaged for replisomes (red, DnaN-mCherry) and the roadblock (yellow, TetR-YFP). Multiple dispersed replisome foci rarely colocalizing …
Figure 4 with 2 supplements
The effect of replisome pairing on replication fork velocity.
(A) Replication elongation measured as a change in cellular DNA content over time after inhibiting replication initiation with rifampicin (RIF) and cell division with cephalexin (CEP). (Top) …
Figure 4—figure supplement 1
DNA histograms for all samples.
DNA histograms are shown at 5-min intervals with 90-min time point overlayed (gray). Strains are MG1655 (No block), DB2146 (+1.10 Mb block), DB3195 (+0.63 Mb block), DB3216 (−0.35 Mb block), and …
Figure 4—figure supplement 2
Cumulative curve plots for all samples.
Cumulative curves of DNA histograms (Figure 4—figure supplement 1) with 90-min time point overlayed (gray).
Figure 5 with 1 supplement
The requirement of RecB-dependent fork restart in uncoupled replisomes.
(A) Raw sequencing profiles of the unblocked chromosome arm in recB+ and recB− cells after rifampicin runout. Strains contained either no block (wild-type MG1655 or its recB− derivative), an oriC-dis…
Figure 5—figure supplement 1
Individual sequencing profiles after rifampicin runout.
Data as described in Figure 5A. Strains are MG1655 (recB+, No block), DB2257 (recB−, No block), DB2185 (recB+, +0.13 Mb block), DB2403 (recB−, +0.13 Mb block), DB2193 (recB+, +0.34 Mb block), DB2722 …
Figure 6 with 3 supplements
Holiday junction frequency on DNA replicated by uncoupled replisomes.
(A) Genome binding of the Holliday junction protein RuvCDef-GFP (RDG) by chromatin immunoprecipitation and sequencing (ChIP-seq). RDG-expressing cells either contained no roadblock (DB2945) or were …
Figure 6—figure supplement 1
Distribution of RuvCDef-GFP (RDG) binding.
Frequency indicates the percentage of RDG chromatin immunoprecipitation and sequencing (ChIP-seq) IP/input values in 0.2-increment bins for wild-type DB2945 (No RB), DB3124 (+1.10 Mb blocked), …
Figure 6—figure supplement 2
RuvCDef-GFP (RDG)-binding peaks in oriC-proximal roadblocked cells.
Unblocked chromosome arm is shown between −2 Mb and oriC. Peaks (dashed lines) are locations of RDG signal ≥4 standard deviation (s.d.) above the 100 kb local median.
Figure 6—figure supplement 3
Genomic binding of RuvCDef-GFP (RDG) and major nucleoid proteins.
(A) Nucleoid protein-binding profiles (black) and consensus RDG-binding peaks (dashed lines). (B) Correlation plots of nucleoid protein and RDG binding (average +0.13 Mb, +0.34 Mb blocked cells). …
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | AB1157 dnaN-mCherry FRTKanFRT | Moolman et al., 2014 | BN1682 | |
| Strain, strain background (E. coli) | AB1157 dnaN-ypet FRT | This paper | DB1568 | RRL190 flipped to KmS w/pCP20 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ lac, pDM15 (+1.10 Mb block) | Joshi et al., 2011 | DB2146 | |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ glnA, pDM15 (+0.13 Mb block) | Joshi et al., 2011 | DB2185 | |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ dnaB, pDM15 (+0.34 Mb block) | Joshi et al., 2011 | DB2193 | |
| Strain, strain background (E. coli) | MG1655 ΔrecB FRTKanFRT | This paper | DB2257 | MG1655 × P1.JW2788 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ gln, ΔrecB FRTKanFRT, pDM15 (+0.13 Mb block) | This paper | DB2403 | DB2185 × P1.JW2788 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ dnaB, ΔrecB FRTKanFRT, pDM15 (+0.34 Mb block) | This paper | DB2722 | DB2193 × P1.JW2788 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ lac, ΔrecB FRTKanFRT, pDM15 (+1.10 Mb block) | This paper | DB2725 | DB2146 × P1.JW2788 |
| Strain, strain background (E. coli) | MG1655 dnaN-mCherry FRTKanFRT | This paper | DB2943 | MG1655 × P1.BN1682 |
| Strain, strain background (E. coli) | MG1655 λcIts857 PR::ruvCDef-gfp FRTKanFRT (42°C inducible RDG cassette) | This paper | DB2945 | SMR19379 recombineered with primers P1/P2; P3/P4 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ gln, λcIts857 PR::ruvCDef-gfp FRTKanFRT, pDM15 (+0.13 Mb block, RDG) | This paper | DB2954 | DB2185 × P1.DB2945 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ dnaB, λcIts857 PR::ruvCDef-gfp FRTKanFRT, pDM15 (+0.34 Mb block, RDG) | This paper | DB2956 | DB2193 × P1.DB2945 |
| Strain, strain background (E. coli) | MG1655 dnaN-mCherry FRT | This paper | DB2962 | DB2943 flipped to KmS w/pCP20 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ glnA, pDM15 (+0.13 Mb block) dnaN-mCherry FRTKanFRT | This paper | DB2970 | DB2185 × P1.BN1682 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ glnA, pDM15 (+0.13 Mb block) dnaN-mCherry FRT | This paper | DB2972 | DB2970 flipped to KmS w/pCP20 |
| Strain, strain background (E. coli) | BW25113 yjiC::141x tetO array FRT | This paper | DB3094 | JW4288 × pJZ087 & pCP20 |
| Strain, strain background (E. coli) | BW25113 yjbL::141x tetO array FRT | This paper | DB3096 | JW4007 × pJZ087 & pCP20 |
| Strain, strain background (E. coli) | MG1655 141x tetO array @ lac, λcIts857 PR::ruvCDef-gfp FRTKanFRT, pDM15 (+1.10 Mb block, RDG) | This paper | DB3124 | DB2146 × P1.DB2945 |
| Strain, strain background (E. coli) | MG1655 yjiC::141x tetO array FRT | This paper | DB3191 | MG16556 × P1.DB3094 |
| Strain, strain background (E. coli) | MG1655 yjbL::141x tetO array FRT | This paper | DB3193 | MG1655 × P1.DB3096 |
| Strain, strain background (E. coli) | MG1655 yjiC::141x tetO array FRT, pDM15 (+0.63 Mb block) | This paper | DB3195 | DB3191 × pDM15 |
| Strain, strain background (E. coli) | MG1655 yjbL::141x tetO array FRT pDM15 (+0.32 Mb block) | This paper | DB3198 | DB3193 × pDM15 |
| Strain, strain background (E. coli) | BW25113 yhgN::141x tetO array FRT | This paper | DB3212 | JW3397 × pJZ087 & pCP20 |
| Strain, strain background (E. coli) | MG1655 yhgN::141x tetO array FRT | This paper | DB3214 | MG1655 × P1.3212 |
| Strain, strain background (E. coli) | MG1655 yhgN::141x tetO array FRT, pDM15 (−0.35 Mb block) | This paper | DB3216 | DB3214 × pDM15 |
| Strain, strain background (E. coli) | BW25113 yjgZ::141x tetO array FRT | This paper | DB3258 | JW4236 × pJZ087 & pCP20 |
| Strain, strain background (E. coli) | MG1655 yjgZ::141x tetO array FRT | This paper | DB3262 | MG1655 × P1.DB3258 |
| Strain, strain background (E. coli) | MG1655 yjgZ::141x tetO array FRT, pDM15 (+0.58 Mb block) | This paper | DB3264 | DB3262 × pDM15 |
| Strain, strain background (E. coli) | BW25113 ΔrecB FRTKanFRT | Baba et al., 2006 | JW2788 | Keio collection |
| Strain, strain background (E. coli) | BW25113 ∆yhgN FRTKanFRT | Baba et al., 2006 | JW3397 | Keio collection |
| Strain, strain background (E. coli) | BW25113 ∆yjbL FRTKanFRT | Baba et al., 2006 | JW4007 | Keio collection |
| Strain, strain background (E. coli) | BW25113 ∆yjgZ FRTKanFRT | Baba et al., 2006 | JW4236 | Keio collection |
| Strain, strain background (E. coli) | BW25113 ∆yjiC FRTKanFRT | Baba et al., 2006 | JW4288 | Keio collection Baba et al., 2006 |
| Strain, strain background (E. coli) | AB1157dnaN-ypet FRTKanFRT | Reyes-Lamothe et al., 2010 | RRL190 | |
| Strain, strain background (E. coli) | AB1157 ssb-ypet::Kan | Reyes-Lamothe et al., 2008 | RRL32 | |
| Strain, strain background (E. coli) | MG1655 PN25tetO::ruvCDef-gfp FRT | Xia et al., 2016 | SMR19425 | Doxycycline-inducible RDG cassette |
| Antibody | anti-RuvC (mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-53437, RRID:AB_630213 | IP (1:1000) |
| Recombinant DNA reagent | pCP20 | Cherepanov and Wackernagel, 1995 | Flippase FLP ApR recombinase | |
| Recombinant DNA reagent | pJZ087 | Wang et al., 2019 | FRT-141x tetO GmR integration | |
| Recombinant DNA reagent | pKD46 | Datsenko and Wanner, 2000 | FRTKanFRT for RDG cassette | |
| Recombinant DNA reagent | pDM15 | Magnan and Bates, 2015a | PnahG::tetR-yfp CmR expression | |
| Sequence-based reagent | P1 | This paper | PCR primer | GGTATATCTCCTTCTTAAAGTTAAACAAAATTATTTCTAGAAGGGTTATGCGTTGTTCCA |
| Sequence-based reagent | P2 | This paper | PCR primer | GTTTCATGCTATGCCAAACGAGAATGATTATCAAATTCATGTGTAGGCTGGAGCTGCTTC |
| Sequence-based reagent | P3 | This paper | PCR primer | CCCTAATTCGATGAAGATTCTTGCTCAATTGTTATCAGCGTGTAGGCTGGAGCTGCTTC |
| Sequence-based reagent | P4 | This paper | PCR primer | AGACGTTTGGCTGATCGGCAAGGTGTTCTGGTCGGCGATTCCGGGGATCCGTCGACC |
| Commercial assay or kit | Nextera XT DNA Sample Preparation Kit | Illumina | Cat #: FC-131-1024 | |
| Commercial assay or kit | MiSeq Reagent Kit v3 (150-cycle) | Illumina | Cat #: MS-102-3001 | |
| Chemical compound, drug | Anhydrotetracycline hydrochloride | Sigma-Aldrich | Cat #: 37919 | |
| Chemical compound, drug | Sodium salicylate | Sigma-Aldrich | Cat #: S3007 | |
| Software, algorithm | FocusCounter | https://github.com/DavidBatesLab/Matlab-scripts.git; Joshi et al., 2013 | Matlab script | Counting replisome foci |
| Software, algorithm | FlowJo | FlowJo LLC | Quantifying flow cytometry histograms | |
| Software, algorithm | sequencingcompile.m | https://github.com/DavidBatesLab/Matlab-scripts.git | Matlab script | Extracting read coordinates from bam files |
| Software, algorithm | sequencingcompile2.m | https://github.com/DavidBatesLab/Matlab-scripts.git | Matlab script | Binning reads into 1 kb bins |
