Embryo-derive TNF promotes decidualization via fibroblast activation
Figures
The protein localization and levels of markers of fibroblast activation in mouse uteri during early pregnancy.
(A) Immunofluorescence of SPARC and immunohistochemistry of TNC and S100A4 in mouse uteri on D4 (n=5), D4.5 (n=5), D5 (n=5), and D5.5 (n=5) of pregnancy. LE, luminal epithelium; St, stroma; * Embryo. Scale bar, 50 μm. (B) Western blot analysis of α-SMA, SPARC, TNC protein level under in vitro decidualization (EP) for 24 hr. *, p<0.05; **, p<0.01; ***, p<0.001.
-
Figure 1—source data 1
Raw data of all western blots from Figure 1.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig1-data1-v3.zip
-
Figure 1—source data 2
Complete and uncropped membranes of all western blots from Figure 1.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig1-data2-v3.zip
Fibroblast activation promotes decidualization by secreting ACTIVIN A.
(A) Western blot analysis on the effects of TNC on decidualization markers (BMP2, WNT4, E2F8 and CYCLIN D3) after stromal cells were treatment with TNC for 72 hr. (B) QPCR analysis of Prl8a2 mRNA level after mouse stromal cells were treated with TNC for 72 hr. (C) Western blot analysisof the effects of S100A4 on decidualization markers after stromal cells were treated with S100A4 for 72 hr. (D) QPCR analysis of Prl8a2 mRNA level after mouse stromal cells were treated with S100A4 for 72 hr. (E) Western blot analysis on the effects after stromal cells were treated with SPARC for 72 hr. (F) QPCR analysis of Prl8a2 mRNA level after mouse stromal cells were treated SPARC for 72 hr. (G) Western blot analysis on ACTIVIN A protein levels in mouse uteri on D4, D4.5, PD4, and PD4.5, respectively. (H) Western blot analysis on the effects of ACTIVIN A on decidualization markers after stromal cells were treated with ACTIVIN A for 72 hr. (I) QPCR analysis of Prl8a2 mRNA level after mouse stromal cells were treated with ACTIVIN A for 72 hr. (J) Western blot analysis on the effects of ACTIVIN A on decidualization markers after stromal cells were treated with ACTIVIN A for 48 hr under in vitro decidualization. EP, 17β-estradiol+progesterone. All data were is presented as means ± SD. *, p<0.05; **, p<0.01; ***, p<0.001. CYC D3: CYCLIN D3; ACT-A: ACTIVIN A.
-
Figure 2—source data 1
Raw data of all western blots from Figure 2.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig2-data1-v3.zip
-
Figure 2—source data 2
Complete and uncropped membranes of all western blots from Figure 2.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig2-data2-v3.zip
Western blot analysis on effects of prostaglandins on fibroblast activation and decidualization in mouse stromal cells.
(A) The effects of PGE2 on markers of fibroblast activation. (B) The effects of ILOPROST, PGI2 analog, on markers of fibroblast activation after stromal cells was treated with ILOPROST for 12 hr. (C) The effects of GW501516, PPARδ agonist, on markers of fibroblast activation. (D) The effects of SELEXIPA, IP analog, on markers of fibroblast activation. (E) The effects of ILOPROST on decidualization markers. (F) QPCR analysis of Prl8a2 mRNA level after mouse stromal cells were treated with ILOPROST for 48 hr. (G) The effects of GW501516 on decidualization markers. (H) QPCR analysis of Prl8a2 mRNA level after mouse stromal cells were treated with GW501516 for 48 h. (I) The effects of ILOPROST on ACTIVIN A protein levels after stromal cells were treated with ILOPROST for 24 hr. CYC D3: CYCLIN D3; ACT-A: ACTIVIN A. *, p<0.05; **, p<0.01; ***, p<0.001.
-
Figure 3—source data 1
Raw data of all western blots from Figure 3.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig3-data1-v3.zip
-
Figure 3—source data 2
Complete and uncropped membranes of all western blots from Figure 3.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig3-data2-v3.zip
Effects of AA on fibroblast activation and decidualization through PGI-PPARδ-ACTIVIN A pathway.
(A) Western blot analysis on effects of AA on markers of fibroblast activation after stromal cells were treated with AA for 6 hr. (B) Western blot analysis on effects of AA on decidualization markers after stromal cells were treated with AA for 48 hr. (C) Western blot analysis on effects of AA on decidualization markers after stromal cells were treated with AA for 48 hr under in vitro decidualization. EP, 17β-estradiol+progesterone. (D) QPCR analysis of Prl8a2 mRNA level after stromal cells were treated with AA for 72 hr. (E) Western blot analysis on effects of AA on COX2, PGES, PGIS, IP and PPARδ protein levels after stromal cells were treated with AA for 6 hr. (F) Western blot analysis on effects of NS398 (COX-2 inhibitor) on AA induction of COX2, PGES, PGIS, IP and PPARδ protein levels after stromal cells were treated with AA for 48 hr in the absence or presence of NS398. (G) QPCR analysis of Inhba mRNA level after stromal cells were treated with AA for 72 hr. (H) QPCR analysis of on effects of NS398 on AA induction of Prl8a2 mRNA level after stromal cells were treated with AA for 72 hr. (I) QPCR analysis of on effects of GSK0660 on AA induction of Prl8a2 mRNA level after stromal cells were treated with AA for 72 hr. (J) Western blot analysis on effects of AA on ACTIVIN A protein level after stromal cells were treated with AA for 24 hr. (K) QPCR analysis on effects of SB431542 (ACTIVIN A inhibitor) on AA induction of Prl8a2 mRNA levels. (L) QPCR analysis on the interference efficiency of Inhba. (M) QPCR analysis on effects of Inhba siRNAs on AA induction on Inhba mRNA level after stromal cells were treated with AA for 72 hr. Data were presented as means ± SD from at least three biological replicates. *, p<0.05; **, p<0.01; ***, p<0.001. CYC D3: CYCLIN D3; ACT-A: ACTIVIN A.
-
Figure 4—source data 1
Raw data of all western blots from Figure 4.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig4-data1-v3.zip
-
Figure 4—source data 2
Complete and uncropped membranes of all western blots from Figure 4.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig4-data2-v3.zip
The involvement of blastocysts in fibroblast activation during early pregnancy.
(A) AA concentration in uterine luminal fluid flushed on D3 (n=20 mice), D4 (n=20 mice), and D4.5 (n=20 mice) of pregnancy. (B) P-CPLA2α immunofluorescence in mouse uteri on D4 (n=6) and D4.5 (n=6). * Embryo. Scale bar = 50 μm. (C) P-CPLA2α immunofluorescence in mouse uteri at implantation sites and inter-implantation sites on D5 (n=6 mice). * Embryo. NI, inter-implantation site; IS, implantation site. Scale bar = 50 μm. (D) p-CPLA2α immunofluorescence of in mouse uteri 12 and 24 h after delayed implantation was activated by estrogen treatment, respectively (n=4 mice). * Embryo. Scale bar = 0 μm. (E) Western blot analysis of CPLA2α and P-CPLA2α protein levels in mouse uteri on D4, D4.5 PD4 and PD4.5 (n=4 mice), respectively. (F) Western blot analysis of CPLA2α and P-CPLA2α protein levels in mouse uteri 12 and 24 hr after delayed implantation was activated by estrogen treatment (n=4 mice). (G) Immunostaining of TNC and S100A4 in mouse uteri 12, 24, 36, and 48 hr after delayed implantation was activated by estrogen treatment (n=4 mice). * Embryo. (H) Western blot analysis α-SMA, TNC, and SPARC protein levels in mouse uteri on D4 and PD4 (n=4 mice). *, p<0.05; **, p<0.01; ***, p<0.001.
-
Figure 5—source data 1
Raw data of all western blots from Figure 5.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig5-data1-v3.zip
-
Figure 5—source data 2
Complete and uncropped membranes of all western blots from Figure 5.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig5-data2-v3.zip
Effects of TNF on CPLA2α phosphorylation and AA secretion.
(A) Immunostaining of TNC and S100A4 in mouse uteri after S100A9-soaked blue beads were transferred into uterine lumen of PD4 mice for 24 hr (n=6 mice). (B) Immunostaining of TNC and S100A4 in mouse uteri after HB-EGF-soaked blue beads were transferred into uterine lumen of PD4 mice for 24 hr (n=6 mice). (C) Immunostaining of TNC and S100A4 in mouse uteri after TNF-soaked blue beads were transferred into uterine lumen of PD4 mice for 24 hr (n=6 mice).* Bead; LE, luminal epithelium; M, muscular layer; St, stroma. Scale bar = 100 μm. (D) P-CPLA2α immunofluorescence in mouse uteri after 0.1 and 1 μg/ml TNF-soaked blue beads were transferred into PD4 uterine lumen (n=3 mice). Scale bar = 50 μm. (E) Western blot analysis of CPLA2α and P-CPLA2α protein levels after cultured epithelial cells were treated with TNF for 3 hr. (F) Western blot analysis of CPLA2α and P-CPLA2α protein levels after cultured epithelial organoids were treated with TNF for 3 hr. (G) ELISA analysis of AA concentration in the cultured medium after cultured epithelial organoids were treated with TNF for 6 hr. *, p<0.05; **, p<0.01; ***, p<0.001.
-
Figure 6—source data 1
Raw data of all western blots from Figure 6.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig6-data1-v3.zip
-
Figure 6—source data 2
Complete and uncropped membranes of all western blots from Figure 6.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig6-data2-v3.zip
TNF regulation of fibroblast activation through AA-PGI-ACTIVIN A pathway in human endometrium.
(A) Western blot analysis of α-SMA, TNC, SPARC, and ACTIVIN A protein levels after human stromal cells were induced for decidualization for 24 hr. ACT-A: ACTIVIN A. (B) Western blot analysis of CPLA2α and P-CPLA2α protein levels in Ishikawa cells after the co-culture of Ishikawa cells and 4003 cells were treated with TNF for 3 hr. (C) Western blot analysis of TNC, α-SMA, and SPARC protein levels in stromal 4003 cells after the co-culture of Ishikawa cells and 4003 cells were treated with TNF for 3 hr. Ish: Ishikawa. (D) Western blot analysis of TNC, α-SMA and SPARC protein levels after stromal 4003 cells were treated with AA for 6 hr. (E) Western blot analysis of COX-2, PGES, PGIS, and PPARδ protein levels after stromal 4003 cells were treated with AA for 3 hr. (F) Western blot analysis of PPARδ, TNC, α-SMA and SPARC protein levels after stromal 4003 cells were treated with ILOPROST for 12 hr. (G) Western blot analysis of TNC, α-SMA, and SPARC protein levels after stromal cells 4003 cells were treated with GW501516 for 6 hr. (H) QPCR analysis of INHBA mRNA levels after stromal 4003 cells were treated with AA. (I) QPCR analysis on effects of NS398 on AA stimulation of INHBA mRNA levels after stromal 4003 cells were treated with AA. *, p<0.05; **, p<0.01; ***, p<0.001.
-
Figure 7—source data 1
Raw data of all western blots from Figure 7.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig7-data1-v3.zip
-
Figure 7—source data 2
Complete and uncropped membranes of all western blots from Figure 7.
- https://cdn.elifesciences.org/articles/82970/elife-82970-fig7-data2-v3.zip
AA-PGI2-PPARδ-ACTIVIN A regulation on human decidualization.
(A) QPCR analysis of IGFBP1 and PRL mRNA levels after stromal 4003 cells were treated with AA. (B) QPCR analysis of IGFBP1 and PRL mRNA levels after stromal 4003 cells were treated with ILOPROST under in vitro decidualization for 4 days. (C) QPCR analysis of IGFBP1 and PRL mRNA levels after stromal 4003 cells were treated with GW501516 under in vitro decidualization for 4 days. (D) QPCR analysis on effects of NS398 or GSK0660 on AA induction of IGFBP1 and PRL mRNA levels after stromal 4003 cells were treated with AA for 4 days. (E) QPCR analysis of IGFBP1 and PRL mRNA levels after stromal 4003 cells were treated with ACTIVIN A for 2 days under in vitro decidualization. ACT-A: ACTIVIN A. (F) QPCR analysis on the interference efficiency of INHBA. (G) QPCR analysis on effects of INHBA siRNAs on AA induction of IGFBP1 and PRL mRNA levels in stromal 4003 cells for 4 days. (H) AA concentration in the cultured medium after mouse stromal cells were induced for in vitro decidualization with estrogen (E2) and progesterone (P4) for 24 h. (I) AA concentration in the cultured medium after human endometrial stromal 4003 cells were induced for in vitro decidualization with MPA and cAMP for 4 days. (J) The model of fibroblast activation action in the blastocyst-endometrial interaction. *, p<0.05; **, p<0.01; ***, p<0.001.
Tables
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-SPARC (rabbit monoclonal) | Cells Signaling Technology | Cat. #: 8725 S RRID:AB_2617210 | 1:200(IF) 1:1000(WB) |
| Antibody | Anti-Phospho-cPLA2 (rabbit polyclonal) | Cells Signaling Technology | Cat. #: 2831 S RRID:AB_2164445 | 1:100(IF) 1:1000(WB) |
| Antibody | Anti- Tenascin C (rabbit monoclonal) | Abcam | Cat. #: ab108930 RRID:AB_10865908 | 1:200(IHC) 1:1000(WB) |
| Antibody | Anti- S100A4 (rabbit monoclonal) | Cells Signaling Technology | Cat. #: 13018 S RRID:AB_10865908 | 1:200(IHC) 1:1000(WB) |
| Antibody | Anti- CPLA2α(rabbit polyclonal) | Santa Cruz Biotechnology | Cat. #: SC-438 RRID:AB_2164442 | 1:1000 |
| Antibody | Anti-α-SMA (rabbit monoclonal) | Cells Signaling Technology | Cat. #: 19,245T RRID:AB_476977 | 1:1000 |
| Antibody | Anti- COX-2 (rabbit monoclonal) | Cells Signaling Technology | Cat. #: 12,282T RRID:AB_1149420 | 1:1000 |
| Antibody | Anti- PGIS (rabbit polyclonal) | Cayman Chemical | Cat. #: 100023 RRID:AB_10816097 | 1:1000 |
| Antibody | Anti- PPAR delta (rabbit monoclonal) | Abcam | Cat. #: ab178866 RRID:AB_2165907 | 1:1000 |
| Antibody | Anti- BMP2 (rabbit polyclonal) | Abclonal | Cat. #: A0231 RRID:AB_2313822 | 1:1000 |
| Antibody | Anti- WNT4 (mouse monoclonal) | Santa Cruz Biotechnology | Cat. #: sc-376279 RRID:AB_787604 | 1:1000 |
| Antibody | Anti- E2F8 (rabbit polyclonal) | Abclonal | Cat. #: sc-376279 RRID:AB_10639701 | 1:1000 |
| Antibody | Anti- CYCLIN D3 (mouse monoclonal) | Cells Signaling Technology | Cat. #: 2936T RRID:AB_397675 | 1:1000 |
| Antibody | Anti-α- TUBULIN (mouse monoclonal) | Cells Signaling Technology | Cat. #: 2144 S RRID:AB_2716367 | 1:1000 |
| Antibody | Anti- GAPDH (mouse monoclonal) | Santa Cruz Biotechnology | Cat. #: sc-32233 RRID:AB_307275 | 1:1000 |
| Antibody | Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, HRP (Goat polyclonal) | inventrogen | Cat. #: G21234 RRID:AB_2534776 | 1:5000 |
| Antibody | Alexa Fluor 488-AffiniPure Goat Anti-Rabbit IgG (H+L) (Goat polyclonal) | Jackson ImmunoResearch | Cat. #: 111-545-144 RRID:AB_2338046 | 1:200 |
| Chemical compound, drug | Recombinant Mouse TNF-alpha (aa 80–235) Protein | R&D systems | Cat. #: 410-MT-010 | 1–100 ng/ml(recombinant protein) |
| Chemical compound, drug | TNC | R&D systems | Cat. #: 410-MT-010 | 5–500 ng/ml(recombinant protein) |
| Chemical compound, drug | S100A4 | MedChemExpress | Cat. #: HY-P71084 | 50 and 500 ng/ml(recombinant protein) |
| Chemical compound, drug | SPARC | MedChemExpress | Cat. #: HY-P71086 | 1 and 10 μM (recombinant protein) |
| Chemical compound, drug | AA | Sigma | Cat. #: A3611 | 0.2 and 20 μM (recombinant protein) |
| Chemical compound, drug | ILOPROST | MedChemExpress | Cat. #: HY-A0096 | 0.1 and 10 μM (recombinant protein) |
| Chemical compound, drug | SELEXIPAG | MedChemExpress | Cat. #: HY-14870 | 0.1 and 10 μM (recombinant protein) |
| Chemical compound, drug | GW501516 | Cayman Chemical | Cat. #: 317318-70-0 | 0.1 and 10 μM (recombinant protein) |
| Chemical compound, drug | NS 398 | Selleck | Cat. #: S8433 | 20 and 40 μM(recombinant protein) |
| Chemical compound, drug | GSK0660 | Selleck | Cat. #: S5817 | 40 μMμM(recombinant protein) |
| Chemical compound, drug | ACTIVIN A | MedChemExpress | Cat. #: HY-P70311 | 1–100 ng/ml(recombinant protein) |
| Cell line (Homo-sapiens) | T HESCs | ATCC | CRL-4003 | |
| Cell line (Homo-sapiens) | Ishikawa | Chinese Academy of Science | CRL-2923 | |
| Commercial assay or kit | AA ELISA kit | Elabscience | Cat. #: E-EL-0051c | |
| Other | PI stain | Sigma | Cat. #: P4170 | 5 μg/ml |
| Other | DAPI stain | Sigma | Cat. #: D9542 | 20 μg/ml |
| Software, algorithm | SPSS | SPSS | RRID:SCR_002865 | |
| Software, algorithm | Image J | ImageJ (http://imagej.nih.gov/ij/) | RRID:SCR_003070 | |
| Software, algorithm | GraphPad Prism software | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 | Version 8.0.0 |
Primers and siRNA sequences used in this study.
| Gene | Species | Sequence (5’–3’) | Application | Accession Number | Product size |
|---|---|---|---|---|---|
| Rpl7 | Mouse | GCAGATGTACCGCACTGAGATTC ACCTTTGGGCTTACTCCATTGATA | RT-QPCR | NM_011291.5 | 129 bp |
| Prl8a2 | Mouse | AGCCAGAAATCACTGCCACT TGATCCATGCACCCATAAAA | RT-QPCR | NM_010088 | 119 bp |
| Inaba | Mouse | CCAGTCTAGTGCTTCTGGGC GATGAGGGTGGTCTTCGGAC | RT-QPCR | NM_008380.2 | 156 bp |
| RPL7 | Human | CTGCTGTGCCAGAAACCCTT TCTTGCCATCCTCGCCAT | RT-QPCR | NM_000971 | 194 bp |
| IGFBP1 | Human | CCAAACTGCAACAAGAATG GTAGACGCACCAGCAGAG | RT-QPCR | NM_001013029 | 87 bp |
| PRL | Human | AAGCTGTAGAGATTGAGGAGCAAA TCAGGATGAACCTGGCTGACTA | RT-QPCR | NM_000948 | 76 bp |
| INHBA | Human | TCATCACGTTTGCCGAGTCA TGTTGGCCTTGGGGACTTTT | RT-QPCR | NM_002192 | 129 bp |
| NC | - | CTCCGAACGTGTCACGT | siRNA | ||
| Activin a | Mouse | GAACAGTCACATAGACCTT | siRNA | ||
| ACTIVIN A | Human | CCAUGUCCAUGUUGUACUATT | siRNA |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/82970/elife-82970-mdarchecklist1-v3.docx
-
Source data 1
Uncropped western blot images used in this study.
- https://cdn.elifesciences.org/articles/82970/elife-82970-data1-v3.docx