The Arabidopsis SHORTROOT network coordinates shoot apical meristem development with auxin-dependent lateral organ initiation

  1. Elmehdi Bahafid
  2. Imke Bradtmöller
  3. Ann M Thies
  4. Thi TON Nguyen
  5. Crisanto Gutierrez
  6. Bénédicte Desvoyes
  7. Yvonne Stahl
  8. Ikram Blilou
  9. Rüdiger GW Simon  Is a corresponding author
  1. Institute for Developmental Genetics, Heinrich Heine University, Germany
  2. Centro de Biologia Molecular Severo Ochoa, CSIC-UAM, Cantoblanco, Spain
  3. Laboratory of Plant Cell and Developmental Biology, Division of Biological and Environmental Sciences and Engineering, 4700 King Abdullah University of Science and Technology, Saudi Arabia
6 figures, 9 tables and 1 additional file

Figures

Figure 1 with 1 supplement
SHR and SCR functions modulate meristem size and auxin signalling in the shoot apical meristem.

(A–C) Top view of 21-day-old rosettes from WT (col-0) (A), shr-2 mutant (B) and scr-4 mutant (C). Scale bar represents 1 cm. (D) Mean flower plastochron in WT (n=21), shr-2 mutant (n=20) and scr-4

Figure 1—figure supplement 1
The shr and scr mutants phenotypes.

(A–D) Plant phenotypes of 42-day-old WT (n>30) (A), shr-2 mutant (n>35) (B), scr-3 mutant (n>30) (C) and scr-4 mutant (n>30) (D). Scale bars represent 1 cm. (A’-D’) Top view of 31-day-old …

Figure 2 with 2 supplements
Expression patterns of SHR and SCR in the shoot apical meristem and In vivo FRET–FLIM quantification of SHR–SCR association in the shoot apical meristem.

(A) Representative 3D projection of shoot apical meristem at 5 weeks after germination expressing pSHR:YFP-SHR reporter (green) (n≥6). The lower right inset shows a longitudinal optical section …

Figure 2—figure supplement 1
The expression pattern of SHR and SCR in the shoot apical meristem.

(A) Representative 3D projection of shoot apical meristem at 5 weeks after germination expressing pSHR:ntdTomato reporter (green). Cell walls were stained with DAPI (red) (n≥5). Scale bar represents …

Figure 2—figure supplement 2
SHR regulates SCR expression in the shoot apical meristem.

(A and B) Representative 3D projection of shoot apical meristem at 5 weeks after germination coexpressing pSHR:YFP-SHR reporter (green) and pSCR:SCR-RFP reporter (red) (A) (the lower left inset …

Figure 3 with 2 supplements
JKD functions and expression pattern in the shoot apical meristem.

SHR regulates CYCD6;1 expression in the shoot apical meristem. (A) Representative 3D projection of shoot apical meristems at 5 weeks after germination expressing pJKD:JKD-YFP reporter (green) …

Figure 3—figure supplement 1
The expression pattern of JKD in lfy and clv3 mutant shoot apical meristems and colocalization of the expression of JKD and SCR in the shoot apical meristem.

(A) Quantification of the epidermal cell area in the meristem region of WT (n=10) and jkd-4 mutant (n=10). (BD) Representative 3D projection of shoot apical meristems at 5 weeks after germination …

Figure 3—figure supplement 2
The colocalization of the expression patterns of SHR, SCR, JKD and CYCD6;1 in the shoot apical meristem.

(AD) Representative 3D projection of shoot apical meristem at 5 weeks after germination expressing pCYCD1;1-GFP reporter (green) (A), pCYCD3;2-GFP reporter (green) (B), pCYCD3;3-GFP reporter …

Figure 4 with 9 supplements
MP Regulates SHR and SCR expression in the shoot apical meristem.

(A) Quantitative real-time PCR analysis showing the relative expression levels of SHR and SCR expression in response to auxin (10 µm IAA) in WT shoot apical meristems. The expression level in Col-0 …

Figure 4—figure supplement 1
The expression patterns of SHR, SCR, MP and PIN1 in the shoot apical meristem.

(A and B) Representative 3D projection of shoot apical meristems at 5 weeks after germination coexpressing pSCR:SCR-YFP reporter (green) and pSHR:ntdTomato reporter (red) (A) and the pMP:MP-GFP

Figure 4—figure supplement 2
CYCD6;1 expression responds to auxin.

(A and B) Representative 3D projection of shoot apical meristems at 5 weeks after germination expressing pSHR:SHR-YFP reporter (magenta) three days after mock (n≥6) (A) or 100 µM NPA treatment (n≥6) …

Figure 4—figure supplement 3
MP Regulates SHR and SCR expression in the shoot apical meristem.

(A and B) Representative 3D projection of shoot apical meristems at 7 days after germination expressing pSHR-ntdTomato reporter (magenta) in WT (n=4) (A) and mp-B4149 (n=4) (B) mutant vegetative …

Figure 4—figure supplement 4
shr mutant and shr mp-S319 double-mutant phenotypes.

(AD) Plant phenotypes of 42-day-old WT (A), mp-S319 mutant (B), shr-2 mutant (C) and mp-S319 shr-2 double mutant (D). Scale bars represent 1 cm. (A’–D ’) Top view of 31-day-old inflorescences of WT …

Figure 4—figure supplement 5
MP induces the expression of SHR in planta.

(A) Schematic representation of the SHR promoter. The positions of two auxin response elements are shown. Overview of mutated promoter versions of pSHR. AuxREs were mutated and multiple combinations …

Figure 4—figure supplement 6
MP Regulates SHR expression in the shoot apical meristem.

(A) Schematic representation of the SHR promoter. The positions of two auxin response elements are shown. Overview of mutated promoter versions of pSHR. AuxREs were mutated and multiple combinations …

Figure 4—figure supplement 7
MP induces the expression of SHR in planta.

(A-H) Representative images of leaves transformed with pSHR variants pSHR (A and B), mAuxRE1 (C and D), mAuxRE2 (E and F) and mAuxRE1+2 (G and H) driving the reporter gene firefly luciferase (FLUC) …

Figure 4—figure supplement 8
The expression pattern of the different promoter versions of SHR in the root apical meristem.

(AG) Representative images of root apical meristem at 5 days after germination expressing mVenus-NLS driven by the wild-type SHR promoter (A), and the SHR promoter with mutations in AuxRE motifs …

Figure 4—figure supplement 9
LFY act downstream of SHR in the shoot apical meristem.

(A) Representative 3D projection of shoot apical meristems at 5 weeks after germination coexpressing pLFY:LFY-GFP (green) and pSCR:SCR-RFP (red) reporters. Chlorophyll (blue). Scale bar represents …

Figure 5 with 4 supplements
Interplay of SCL23, SCR, SHR, SCL23-WUS Interaction in the Shoot Apical Meristem.

(A and B) Representative 3D projection of shoot apical meristems at 5 weeks after germination expressing pSCL23:H2B-YFP reporter (green) (n≥3) (A) and pSCL23:SCL23-YFP reporter (green) (n≥10) (B). …

Figure 5—figure supplement 1
SCL23 and WUS are negatively regulated by the CLV pathway in the shoot apical meristem.

(AC) Representative 3D projection of shoot apical meristems at 5 weeks after germination from WT (A), scl23-2 mutant (B) and scl23-2/pSCL23:SCL23-YFP (C). Cell walls were stained with PI (gray). …

Figure 5—figure supplement 2
Mutant combinations of shr, scr, and scl23.

(AH) Top view of 21-day-old rosettes of WT (A), scl23-2 mutant (B), shr-2 mutant (C), scr-3 mutant (D), scr-3 shr-2 double mutant (E), scl23-2 shr-2 double mutant (F), scl23-2 scr-3 double mutant (G

Figure 5—figure supplement 3
Overexpression of SHR, SCR, and SCL23 in the SAM.

(AD) Representative 3D projection of shoot apical meristems at 5 weeks after germination expressing p35S:SHR-GFP reporter (green) (A), p35S:SCR-GFP reporter (green) (B), pUBIQ10:SCL23-mVenus

Figure 5—figure supplement 4
WUS and SCL23 cooperatively control shoot stem cell homeostasis in the shoot apical meristem.

(A–D) Top view of 21-day-old rosettes of Col-0 (A), scl23-2 mutant (B), wus-am mutant (C) and scl23-2 wus-am double mutant (D). Scale bar represents 1 cm. (E–I) plant phenotypes of 36 old L.er (E), …

Figure 6 with 1 supplement
Proposed model for SHR-SCR-SCL23-JKD regulatory network function in the SAM and the RAM.

(A and B) Schematic representation of observed expression patterns of WUS, SCL23, CLV3, JKD, SCR, LFY, SHR, MP and CYCD6;1 in the SAM (A) and WOX5, SCL23, JKD, SCR, SHR MP and CYCD6;1 in the RAM (B).…

Figure 6—figure supplement 1
Overlapping expression patterns of PIN1, MP, SHR, SCR, CYCD6;1, SCL23 and JKD in the RAM.

(AD) Representative images of root apical meristem at 5 days after germination expressing, pPIN1:PIN1-GFP reporter (green) (A), pMP:MP-GFP reporter (green) (B), pSHR:YFP-SHR reporter (green) and pSC…

Tables

Table 1
Enzymes used in this study.
EnzymeProducer
BSA1 (ECORI)Thermo Fisher Scientific, Braunschweig, Germany
Pfuµltra High-Fidelity DNA polymeraseAgilent, Santa Clara, USA
Phusion High-Fidelity DNA PolymeraseThermo Fisher Scientific, Braunschweig, Germany
T4-LigaseThermo Fisher Scientific, Braunschweig, Germany
Taq-DNA-PolymeraseMade in the lab according to Pluthero, 1993
Universal SYBR Green SupermixBio-Rad
Table 2
Primers used for cloning.
PurposePrimerSequence
SHR promoter cloningEB-pSHR-FAAAGGTCTCAACCTGAAGCAGAGCGTGGGGTTTC
EB-pSHR-RTTTGGTCTCATGTTTTTTAATGAATAAGAAAATGAATAGAAGAAAGGGGG
EB-pSHR-BsaI-site-FGTTCAAAAGTGGTCCCTTCTCTCTC
EB-pSHR-BsaI-site-RGAGAGAGAAGGGACCACTTTTGAAC
SHR CDS cloningEB-SHR-CDS-FAAAGGTCTCAGGCTTAATGGATACTCTCTTTAGACTAGTCAG
EB-SHR-CDS-RTTTGGTCTCACTGACGTTGGCCGCCACGCACTAG
SCR CDS cloningEB-SCR-CDS-FAAAGGTCTCAGGCTTAATGGCGGAATCCGGCGATTTC
EB-SCR-CDS-RTTTGGTCTCACTGAAGAACGAGGCGTCCAAGCTGAAG
EB-SCR-CDS-BsaI-site-1-FGCCATTATCAGGGACCTTATCC
EB-SCR-CDS-BsaI-site-1-RGGATAAGGTCCCTGATAATGGC
EB-SCR-CDS-BsaI-site-2-FGAAAATGGTATCTGCGTTTCAG
EB-SCR-CDS-BsaI-site-2-RCTGAAACGCAGATACCATTTTC
JKD CDS cloningEB-JKD-CDS-FAAAGGTCTCAGGCTTAATGCAGATGATTCCAGGAGATCC
EB-JKD-CDS-RTTTGGTCTCACTGAACCCAATGGAGCAAACCTTGCG
EB-JKD-CDS-BsaI-site-FGCCCTTGGTGACCTCACTGG
EB-JKD-CDS-BsaI-site-RCCAGTGAGGTCACCAAGGGC
SCL23 CDS cloningEB-SCL23-FAAAGGTCTCAGGCTTAATGACTACAAAACGCATAGACAG
EB-SCL23-RTTTGGTCTCACTGAATCGAACGGCTGAGATTTCC
MP CDS cloningEB-MP-GG-FAAAGGTCTCAGGCTTAATGATGGCTTCATTGTCTT
EB-MP-GG-RTTTGGTCTCACTGATGAAACAGAAGTCTTAAGATC
pSHR site-directed mutagen-esisEB-pSHRΔmAuxRE1-FCTTTGTATCGAGCCAAACGAG
EB-pSHRΔmAuxRE1-RCTCGTTTGGCTCGATACAAAG
EB-pSHRΔmAuxRE2-FTTCACATGGCTCTATGTTACTATG
EB-pSHRΔmAuxRE1-RCATAGTAACATAGAGCCATGTGAA
EB-pSHRΔmAuxRE1-2-FCTTTGTATCGAGCCAAACGAG
EB-pSHRΔmAuxRE1-2-RCTCGTTGTGCTCGATACAAAG
EB-pSHRΔmAuxRE2-2-FATATTCACATGGGAGTATGTTACTATGTAAATG GTG ACC
EB-pSHRΔmAuxRE2-2-RGGTCACCATTTACATAGTAACATACTCCCATGTGAATAT
Table 3
Primers used for qRT-PCR.
Primer nameSequence
EB-RT-SHR-FGATATCGAGTTTCCGACGGT
EB-RT-SHR-RCGAAGCAAACCCTAAACCAT
EB-RT-SCR-FGTAACCCAAATCTCGGTGCT
EB-RT-SCR-RTTGCTGTTGTGGAGGAGAAG
EB-RT-JKD-FATCAACCTGGCACTCCAGA
EB-RT-JKD-RGCAGATCTCGCACACGAAT
EB-RT-LFY-FTGATGCTCTCTCCCAAGAAGA
EB-RT-LFY-RCTTGACCTGCGTCCCAGTA
EB-SAND-FAACTCTATGCAGCATTTGATCCACT
EB-SAND-RTGATTGCATATCTTTATCGCCATC
EB-TIP41-FGTGAAAACTGTTGGAGAGAAGCAA
EB-TIP41-RTCAACTGGATACCCTTTCGCA
Table 4
Primers used for genotyping.
Primer nameSequence
EB-scl23-2-LPATGACTACAAAACGCATAGACAG
EB-scl23-2-RPTTTGGTCTCACTGAATCGAACGGC
LBb1.3ATTTTGCCGATTTCGGAAC
mp-S319-LPCCTGGAAACTGATGAGCTGAC
mp-S319-RPCCTTCTTCACTCATCTGCTGG
LBb1.3ATTTTGCCGATTTCGGAAC
jkd-4-FGGATGAAAGCAATGCAAAACA
jkd-4-RAATGTCGGGATGATGAACTCC
RBTCAAACAGGATTTTCGCCTGCT
scr-4FCTGCTTCACCTACTGTATGGG
scr-4RGGGTCAGAGGAAGAGGAAGG
Restriction enzyme: Eco57M which should not cut in the mutant
shr-2-RAAATCGAACTTGCGAATTCCT
shr-2-LCGCTCAACGAGCTCTCTTCT
shr-2insCAGCAAGACAAGATGGGTCA
wus-7-FCCGACCAAGAAAGCGGCAACA
wus-7-RAGACGTTCTTGCCCTGAATCTTT
Restriction enzyme: XmNI which should cut in the mutant
Table 5
Entry plasmids used in this study.
NameDescriptionBackboneReference
pSHRSHR promoter 2.5 Kb upstream from transcription startpBluntThis study
SHR CDSSHR coding sequencepGGC000This study
SCL23 CDSSCL23 coding sequencepGGC000This study
linker NLS (pGGD007)NUCLEAR LOCALIZATION SIGNALpGGD000Lampropoulos et al., 2013
mVenus (pRD43)mVenuspGGD000Rebecca Burkhart
FLUCFirefly luciferasepGGC000Greg Denay
mVenus (pRD42)mVenuspGGC000Rebecca Burkhart
GUS (pGGC051)coli ß-GLUCURONIDASEpGGC000Lampropoulos et al., 2013
MP CDSMP coding sequencepGGC000This study
35 S promoter (pGGA004)Cauliflower mosaic virus 35 S promoterpGGA000Lampropoulos et al., 2013
RPS5A promoter (pGGA012)RIBOSOMAL PROTEIN 5 A promoterpGGA000Lampropoulos et al., 2013
UBIQ10 promoter (pGGA006)UBIQUITIN10 promoterpGGA000Lampropoulos et al., 2013
d-dummy (pGGD002)d-dummypGGD000Lampropoulos et al., 2013
tCLV3CLV3 terminator 1257 bp downstream of transcription stoppGGE000Jenia Schlegel
UBQ10 terminator (pGGE009)UBQ10 terminatorpGGE000Lampropoulos et
BastaR (pGGF008)pNOS:BastaR:tNOSpGGF000Lampropoulos et al., 2013
GR (pRD64)Hormone-binding domain of the glucocorticoid receptorpGGD000Rebecca Burkhart
pCLV3CLV3 promoter 1480 bp upstream from transcription startpGGA000Jenia Schlegel
mega-element (pGGB002)Omega- elementpGGB000Lampropoulos et al., 2013
Table 6
Destination plasmids used in this study.
Name of constructPromoterN-TagCDSC-TagTerminatorResistance
pCLV3:SCL23-mVenuspCLV3Ω- element (pGGB002)SCL23 CDSmVenustCLV3BastaR (pGGF008)
pRPS5A:SCL23-mVenuspRPS5AΩ- element (pGGB002)SCL23 CDSmVenustUBQ10 (pGGE009)BastaR (pGGF008)
pUBIQ10:SCL23-mVenuspUBIQ10Ω- element (pGGB002)SCL23 CDSmVenustUBQ10 (pGGE009)BastaR (pGGF008)
pUBIQ10:MP-GRpUBIQ10Ω- element (pGGB002)MP CDSGRtUBQ10 (pGGE009)BastaR (pGGF008)
p35S:GUSp35SΩ- element (pGGB002)GUSd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
p35S:MPp35SΩ- element (pGGB002)MP CDSd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHR:mV-NLSpSHRΩ- element (pGGB002)mVenuslinker NLS (pGGD007)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE1:mV-NLSpSHRΔmAuxRE1Ω- element (pGGB002)mVenuslinker NLS (pGGD007)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE2:mV-NLSpSHRΔmAuxRE2Ω- element (pGGB002)mVenuslinker NLS (pGGD007)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE1+2:mV-NLSpSHRΔmAuxRE1+2Ω- element (pGGB002)mVenuslinker NLS (pGGD007)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE1-2:mV-NLSpSHRΔmAuxRE1-2Ω- element (pGGB002)mVenuslinker NLS (pGGD007)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE2-2:mV-NLSpSHRΔmAuxRE2-2Ω- element (pGGB002)mVenuslinker NLS (pGGD007)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE1−2+2–2:mV-NLSpSHRΔmAuxRE1−2+2–2Ω- element (pGGB002)mVenuslinker NLS (pGGD007)tUBQ10 (pGGE009)BastaR (pGGF008)
Table 7
Destination plasmids used for luciferase assay.
Name of constructPromoterN-TagCDSC-TagTerminatorResistance
pSHR:FLUCpSHRΩ- element (pGGB002)FLUCd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE1:FLUCpSHRΔmAuxRE1Ω- element (pGGB002)FLUCd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE2:FLUCpSHRΔmAuxRE2Ω- element (pGGB002)FLUCd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE1+2:FLUCpSHRΔmAuxRE1+2Ω- element (pGGB002)FLUCd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE1-2:FLUCpSHRΔmAuxRE1-2Ω- element (pGGB002)FLUCd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE2-2:FLUCpSHRΔmAuxRE2-2Ω- element (pGGB002)FLUCd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
pSHRΔmAuxRE1−2+2–2:FLUCpSHRΔmAuxRE1−2+2–2Ω- element (pGGB002)FLUCd-dummy (pGGD002)tUBQ10 (pGGE009)BastaR (pGGF008)
Table 8
Mutants used in this study.
Table 9
Transgenic lines used in this study.
LinesPlant ResistanceReference
pSHR:mV-NLSBastaThis study
pSHRΔmAuxRE1:mV-NLSBastaThis study
pSHRΔmAuxRE2:mV-NLSBastaThis study
pSHRΔmAuxRE1+2:mV-NLSBastaThis study
pSHRΔmAuxRE1-2:mV-NLSBastaThis study
pSHRΔmAuxRE2-2:mV-NLSBastaThis study
pSHRΔmAuxRE1−2+2–2:mV-NLSBastaThis study
pCLV3:SCL23-mVenusBastaThis study
pRPS5A:SCL23-mVenusBastaThis study
pUBIQ10:SCL23-mVenusBastaThis study
pUBIQ10:MP-GRBastaThis study
PlaCCIKanamycinDesvoyes et al., 2020
pSHR:mScarlet-SHR-This study
pSHR:YFP-SHRBastaLong et al., 2017
pSCR:SCR-RFPhygLong et al., 2017
pSCR:SCR-YFPbastaLong et al., 2017
pSHR:SHR-YFPBastaLong et al., 2017
pJKD:mRFP-YFPnorfLong et al., 2017
pJKD:JKD-YFPBastaLong et al., 2017
pSCL23:SCL23-YFPKanamycinLong et al., 2015a
pSCL23:H2B-YFPKanamycinLong et al., 2015a
pCYCD6;1:GFPBastaSozzani et al., 2010
pSCR:H2B-YFPKanamycinHeidstra et al., 2004
pPIN1:PIN1-GFPKanamycinBenková et al., 2003
pSHR:nTdTOMATO-Möller et al., 2017
pMP:MP-GFPKanamycinSchlereth et al., 2010
pLFY:LFY-GFPkanamycinWu et al., 2003
R2D2kanamycinLiao et al., 2015
pDR5v2:3xYFP-N7BastaHeisler et al., 2005
pWUS:3xVenus-NLS/pCLV3-mCherry-NLSKanamycinPfeiffer et al., 2016
pCYCD1,1-GFP-Forzani et al., 2014
pCYCD3,2-GFP-This study
pCYCD3,1-GFP-This study
pCYCD5,1-GFP-This study
pCYCD7,1-GFP-This study
pCYCD2,1-GFP-This study
pCYCD3,3-GFP-Forzani et al., 2014
pCYCB1;1:CYCB1;1-GFPKanamycinUbeda-Tomás et al., 2009

Additional files

Download links