Recruitment of Polo-like kinase couples synapsis to meiotic progression via inactivation of CHK-2
- Department of Molecular and Cell Biology, University of California, Berkeley, United States
- California Institute for Quantitative Biosciences, United States
- Howard Hughes Medical Institute, United States
- Biological Systems and Engineering Division, Lawrence Berkeley National Laboratory, United States
- Department of Integrative Biology, University of California, Berkeley, United States
Figures
Figure 1
Temporal profile of CHK-2 activity and crossover designation during meiotic prophase in C. elegans.
(A) Schematic of meiotic prophase in the C. elegans hermaphrodite germline. The distal tip of the gonad is oriented on the left side in this schematic and in all other figures. Meiotic progression …
Figure 2 with 1 supplement
CHK-2 inhibits crossover (CO) designation.
(A) Representative hermaphrodite gonads stained for GFP::COSA-1 (green), SYP-1 (magenta), and DNA (blue). Nuclei with bright COSA-1 foci are observed at a more distal position following CHK-2 …
Figure 2—figure supplement 1
Depletion of CHK-2 activity results in earlier crossover designation.
(A) Representative leptotene/zygotene and mid-pachytene nuclei stained for HA::AID::CHK-2 (anti-HA) and DNA, showing efficient depletion of CHK-2 following auxin treatment. Worms were incubated with …
Figure 3 with 2 supplements
Inactivation of CHK-2 by Polo-like kinase promotes timely crossover (CO) designation.
(A) Sequence alignment of CHK-2 orthologs from various eukaryotes generated with T-Coffee (Notredame et al., 2000), showing the conservation of Ser116 and Thr120 (asterisks). Thr120 is a direct …
Figure 3—figure supplement 1
Phosphorylation of CHK-2 by PLK-2.
(A) Recombinant kinase-dead CHK-2 protein (CHK-2KD) was phosphorylated in vitro by PLK-2 kinase and then subjected to mass spectrometry analysis for phosphorylation site identification. CHK-2 Thr120 …
-
Figure 3—figure supplement 1—source data 1
Western blotting raw images in Figure 3—figure supplement 1.
- https://cdn.elifesciences.org/articles/84492/elife-84492-fig3-figsupp1-data1-v2.zip
Figure 3—figure supplement 2
Characterization of CHK-2 phospho-mutants.
(A) Worm strains expressing the indicated HA-tagged wild-type and mutant CHK-2 proteins were compared by western blot: HA::CHK-2 WT, S116A, S116D, T120A, and T120D were all measured in heterozygotes …
-
Figure 3—figure supplement 2—source data 1
Western blotting raw images in Figure 3—figure supplement 2.
- https://cdn.elifesciences.org/articles/84492/elife-84492-fig3-figsupp2-data1-v2.zip
Figure 4 with 2 supplements
CHK-2 inactivation requires recruitment of Polo-like kinases to the synaptonemal complex (SC).
(A) Representative leptotene/zygotene or late pachytene nuclei in wild-type or syp-1T452A hermaphrodite gonads stained for PLK-2::mRuby (red), DNA (cyan), GFP::COSA-1 (green), and SYP-2 (blue). A …
Figure 4—figure supplement 1
PLK-1 is not required to override the crossover assurance checkpoint in the absence of PLK-2.
(A) Representative nuclei at different stages showing efficient co-depletion of PLK-1 and PLK-2 in the germline. One hour of auxin treatment was sufficient to eliminate detectable PLK-1/PLK-2 in the …
Figure 4—figure supplement 2
MPK-1 does not silence the crossover assurance checkpoint.
(A) Representative hermaphrodite gonads showing efficient, germline-specific depletion of MPK-1. Asterisks indicate the somatic distal tip and seam cells, where MPK-1 persists following degradation …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Caenorhabditis elegans) | chk-2 | WormBase | Wormbase ID: WBGene00000499 | |
| Gene (Caenorhabditis elegans) | plk-2 | WormBase | Wormbase ID: WBGene00004043 | |
| Gene (Caenorhabditis elegans) | plk-1 | WormBase | WormBase ID: WBGene00004042 | |
| Gene (Caenorhabditis elegans) | mpk-1 | WormBase | WormBase ID: WBGene00003401 | |
| Gene (Caenorhabditis elegans) | cosa-1 | WormBase | WormBase ID: WBGene00022172 | |
| Gene (Caenorhabditis elegans) | syp-1 | WormBase | WormBase ID: WBGene00006375 | |
| Strain, strain background (Escherichia coli) | OP50 | Caenorhabditis Genetics Center (CGC) | N/A | |
| Strain, strain background (Escherichia coli) | DH10Bac | Thermo Fisher Scientific | Cat. #10361012 | Competent E. coli |
| Strain, strain background (Caenorhabditis elegans) | For C. elegans allele and strain information, see Supplementary file 1b, d | This paper | N/A | Strains are available in Abby Dernburg’s lab |
| Genetic reagent (Caenorhabditis elegans) | For C. elegans mutations, see Supplementary file 1b, d | This paper | N/A | Mutations are available in Abby Dernburg’s lab |
| Cell line (Spodoptera frugiperda) | Sf9 insect cells | Thermo Fisher Scientific | Cat. #11496015 | |
| Antibody | anti-SYP-1 (Goat polyclonal) | (Harper et al., 2011) PMID: 22018922 | N/A | IF (1:300) |
| Antibody | anti-RAD-51 (Rabbit polyclonal) | Novus Biologicals | Cat. #29480002; RRID:AB_2284913 | IF (1:5000) |
| Antibody | anti-pHIM-8/ZIMs (Rabbit polyclonal) | (Kim et al., 2015) PMID: 26506311 | N/A | IF (1:500) |
| Antibody | anti-SYP-2 (Rabbit polyclonal) | (Colaiácovo et al., 2003) PMID: 12967565 | N/A | IF (1:500) |
| Antibody | anti-β-tubulin (Rabbit polyclonal) | Abcam | Cat. #ab6046; RRID:AB_2210370 | WB (1:2000) |
| Antibody | anti-HTP-3 (Chicken polyclonal) | (MacQueen et al., 2005) PMID: 16360034 | N/A | IF (1:500) |
| Antibody | anti-HTP-3 (Guinea pig polyclonal) | (MacQueen et al., 2005) PMID: 16360034 | N/A | WB (1:500) |
| Antibody | anti-α-tubulin (Mouse monoclonal) | Millipore Sigma | Cat. #05-829; RRID:AB_310035 | WB (1:5000) |
| Antibody | anti-HA (Mouse monoclonal) | Thermo Fisher Scientific | Cat. #26183; RRID:AB_10978021 | IF (1:400), WB (1:1000) |
| Antibody | anti-GFP (Mouse monoclonal) | Millipore Sigma | Cat. #11814460001; RRID:AB_390913 | IF (1:500) |
| Antibody | anti-FLAG (Mouse monoclonal) | Millipore Sigma | Cat. #F1804; RRID:AB_262044 | IF (1:500) |
| Antibody | anti-ALFA-At647N (Alpaca monoclonal, Nanobody clone 1G5 produced in E. coli) | Nanotag Biotechnologies | Cat. #N1502-At647N | IF (1:500) |
| Antibody | HRP-conjugated anti-ALFA sdAb (Alpaca monoclonal, Nanobody clone 1G5 produced in E. coli) | Nanotag Biotechnologies | Cat. #N1505-HRP | WB (1:1000) |
| Recombinant DNA reagent | pFastBac1 GST-CHK-2KD (plasmid) | (Kim et al., 2015) PMID: 26506311; This paper | N/A | Generously provided by Yumi Kim |
| Recombinant DNA reagent | pFastBac1 GST-PLK-2 (plasmid) | This paper | N/A | Generously provided by Yumi Kim |
| Sequence-based reagent | CRISPR tracrRNA | Integrated DNA Technologies | Cat. #1072534 | |
| Sequence-based reagent | dpy-10 crRNA | (Arribere et al., 2014) PMID: 25161212; Integrated DNA Technologies | N/A | 5′-GCUACCAUAGGCACCACGAG-3′ |
| Sequence-based reagent | dpy-10 (cn64) repair template | (Arribere et al., 2014) PMID: 25161212; Integrated DNA Technologies | N/A | Oligo: 5′-CACTTGAACTTCAATACGGCAAGATGAGAATGACTGGAAACCGTACCGCATGCGGTGCCTATGGTAGCGGAGCTTCACATGGCTTCAGACCAACAGCCTAT-3′ |
| Sequence-based reagent | crRNAs, repair templates and genotyping primers | This paper | N/A | Supplementary file 1c |
| Peptide, recombinant protein | S. pyogenes Cas9-NLS purified protein | QB3 MacroLab at UC Berkeley | N/A | |
| Peptide, recombinant protein | ALFA selector | Nanotag Biotechnologies | Cat. #N1511 | |
| Peptide, recombinant protein | Glutathione Sepharose | GE Life Sciences | Cat. #17-5132-01 | |
| Commercial assay or kit | SuperSignal West Femto Maximum Sensitivity Substrate kit | Thermo Fisher Scientific | Cat. #34095 | |
| Chemical compound, drug | Auxin, indole-3-acetic acid | Acros Organics | Cat. #122160250 | |
| Chemical compound, drug | DAPI (4′,6-Diamidino-2-phenylindole dihydrochloride) | Thermo Fisher Scientific | Cat. #62247 | |
| Software, algorithm | SoftWorx package | Applied Precision; GE Healthcare Bio-Sciences | http://www.sussex.ac.uk/gdsc/intranet/pdfs/softWoRx%20user%20manual | |
| Software, algorithm | ImageJ | NIH | https://imagej.nih.gov/ij | |
| Software, algorithm | Adobe Photoshop 2021 | Adobe Systems | https://www.adobe.com | |
| Software, algorithm | Adobe Illustrator 2021 | Adobe Systems | https://www.adobe.com | |
| Software, algorithm | T-COFFEE | Swiss Institute of Bioinformatics (Notredame et al., 2000) PMID:10964570 | http://tcoffee.vital-it.ch/apps/tcoffee | |
| Software, algorithm | IBS_1.0.1 | (Liu et al., 2015) PMID: 26069263 | http://ibs.biocuckoo.org/download.php | |
| Software, algorithm | GraphPad Prism | GraphPad Software, Inc | http://www.graphpad.com | |
| Software, algorithm | Protein Lynx Global Server (PLGS) version 3.0.3 | Waters | https://www.waters.com/waters/en_US/ProteinLynx-Global-SERVER-(PLGS)/nav.htm?cid = 513,821 | |
| Other | Polyacrylamide gels (10 wells) | Genscript | Cat. #M00652 | Protein electrophoresis, see ‘Materials and methods’ section in the paper for details |
| Other | Polyacrylamide gels (15 wells) | Genscript | Cat. #M00654 | Protein electrophoresis, see ‘Materials and methods’ section in the paper for details |
| Other | SlowFade Glass Antifade Mountant | Thermo Fisher Scientific | Cat. #S36917 | See ‘Materials and methods’ section in the paper for details |
Additional files
-
Supplementary file 1
This file includes four tables (Supplementary file 1a-d).
Supplementary file 1a reports the viability and fertility of representative transgenic worm strains used in this study, which indicates that all epitope- and degron-tagged alleles support normal meiosis and development. Supplementary file 1b lists the worm alleles generated in this study. Supplementary file 1c lists the crRNA, repair templates, and genotyping primers generated in this study. Supplementary file 1d lists the worm strains used in this study.
- https://cdn.elifesciences.org/articles/84492/elife-84492-supp1-v2.docx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/84492/elife-84492-mdarchecklist1-v2.docx
