Research Article

Orai3 and Orai1 mediate CRAC channel function and metabolic reprogramming in B cells

Department of Cellular and Molecular Physiology, Pennsylvania State University College of Medicine, United States
Department of Microbiology and Immunology, Pennsylvania State University College of Medicine, United States
Department of Pathology, New York University School of Medicine, United States
Department of Pharmacology and Chemical Biology, University of Pittsburgh School of Medicine, United States
Vascular Medicine Institute, University of Pittsburgh School of Medicine, United States
Department of Public Health Sciences, Pennsylvania State University College of Medicine, United States

Feb 21, 2023

https://doi.org/10.7554/eLife.84708

Open access
Copyright information

Figures
Tables
Additional files

10 figures, 1 table and 5 additional files

Figures

Figure 1

Download asset Open asset

B cell activation dynamically regulates Orai channel expression.

(A) Measurement of oxygen consumption rate (OCR) in primary B lymphocytes following 24 hr stimulation with anti-IgM (20 μg/mL), anti-CD40 (10 μg/mL), anti-IgM +anti-CD40, or LPS (10 μg/mL) using the Seahorse Mito Stress Test (n=3 biological replicates). (B) Energy map of maximal OCR and extracellular acidification rate (ECAR) following the addition of the protonophore carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP). (**C, D**) Quantification of basal (C) and maximal (D) respiration from Seahorse traces in (A) (One-way ANOVA with multiple comparisons to Unstimulated). (**E, F**) Measurement of (E) total mitochondrial content with the fluorescent dye MitoTracker Green and (F) mitochondrial membrane potential with TMRE following 24 hr stimulation (n=3 biological replicates; One-way ANOVA with multiple comparisons to Unstimulated). (**G–I**) Quantitative RT-PCR of (G) *Orai1*, (H) *Orai2*, and (I) *Orai3* mRNA following 24 hr of stimulation with the stimuli indicated (n=3 biological replicates; one-way ANOVA with multiple comparisons to Unstimulated). All scatter plots and Seahorse traces are presented as mean ± SEM. For all figures, *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001; ns, not significant.

Figure 1—source data 1 Source data for Figure 1.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig1-data1-v2.xlsx
Download elife-84708-fig1-data1-v2.xlsx

Figure 2

Download asset Open asset

Orai1 and Orai3 mediate the bulk of store-operated Ca2+ entry (SOCE) in A20 B lymphoblasts.

(A) Cartoon schematic of the two gRNA CRISPR strategies we used to excise mouse *Orai1* and *Orai3* genes. (**B–D**) Quantitative RT-PCR of (B) *Orai1*, (C) *Orai2*, and (D) *Orai3* mRNA in A20 Orai CRISPR clones (n=3 biological replicates). (E) Measurement of SOCE with Fura2 upon store depletion with 2 µM thapsigargin in 0 mM Ca²⁺ followed by re-addition of 2 mM Ca²⁺ to the external bath solution. (F) Quantification of peak SOCE in (E) (from left to right n=99, 100, 89, and 98 cells; Kruskal-Wallis test with multiple comparisons to WT A20). (**G–J**) Representative Ca²⁺ oscillation traces from 5 cells/condition measured with Fura2 upon stimulation with 10 μg/mL anti-IgG antibodies at 60 s (indicated by arrows) in the presence of 2 mM external Ca²⁺. (K) Quantification of total oscillations in 9 min from (**G–J**) (from left to right n=76, 79, 79, and 78 cells; Kruskal-Wallis test with multiple comparisons to WT A20). All scatter plots are presented as mean ± SEM. For all figures, *p<0.05; **p<0.01; ****p<0.0001; ns, not significant.

Figure 2—source data 1 Source data for Figure 2.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig2-data1-v2.xlsx
Download elife-84708-fig2-data1-v2.xlsx

Figure 3 with 1 supplement

Download asset Open asset

Orai1 is dispensable for BCR-induced Ca²⁺ oscillations in primary B cells.

(A) Representative flow cytometry histogram of B cells isolated from *Orai1^fl/fl* and *Orai1^fl/fl* Mb1-Cre^/+ mice. Splenocytes from naïve *Orai1^fl/fl* and *Orai1^fl/fl* Mb1-Cre^/+ mice were fixed, permeabilized, and stained with rabbit anti-Orai1 polyclonal antibody (YZ6856, epitope: human ORAI1#275–291 intra-cellular C-terminal, cross-reacts with the mouse). The numbers inside the panel represent the mean fluorescence intensity (MFI) for the Orai1 antibody staining for each sample. (B) Quantification of Orai1 MFI minus fluorescence minus one (FMO) in B cells is shown. (n=4 biological replicates; unpaired T-test). (**C–E**) Quantitative RT-PCR of (C) *Orai1*, (D) *Orai2*, and (E) *Orai3* mRNA in isolated B cells (n=6 biological replicates for each; Mann-Whitney test). (F) Measurement of SOCE with Fura2 upon store depletion with 2 µM thapsigargin in 0 mM Ca²⁺ followed by re-addition of 1 mM Ca²⁺ to the external bath solution. (G) Quantification of peak store-operated Ca2+ entry (SOCE) in (F) n=169 and 178 cells; Mann-Whitney test. (**H–I**) Representative Ca²⁺ oscillation traces from 5 cells/condition measured with Fura2 upon stimulation with 20 μg/mL anti-IgM antibodies at 1 min (indicated by arrows) in the presence of 1 mM external Ca²⁺. (J) Quantification of total oscillations in 9 min from (**I, J**) (n=97 and 111 cells; Mann-Whitney test). All scatter plots are presented as mean ± SEM. For all figures, **p<0.01; ****p<0.0001; ns, not significant.

Figure 3—source data 1 Source Data for Figure 3.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig3-data1-v2.xlsx
Download elife-84708-fig3-data1-v2.xlsx

Figure 3—figure supplement 1

Download asset Open asset

Loss of Orai1 does not overtly affect B cell activation.

(A) Representative histograms of Orai1 fluorescence gated on B220⁺ B cells, CD3⁺CD4⁺ T cells, and CD3⁺CD8⁺ T cells from Mb1-Cre^/+ mice. (B) Quantification of Orai1 mean fluorescence intensity (MFI) from each condition shown in (A) (n=8 biological replicates for each; one-way ANOVA). (**C–D**) Flow cytometry histograms of MHC-II expression on isolated B cells from (C) Mb1-Cre^/+ and (D) *Orai1^fl/fl* Mb1-Cre^/+ mice following 24 hr stimulation. (E) Quantification of MHC-II MFI from (**C–D**) (n=3 biological replicates for each; Mann-Whitney test). (**F–G**) Histograms of CD86 expression following 24 hr stimulation. (H) Quantification of CD86 MFI from (**F–G**) (n=3 biological replicates for each; Mann-Whitney test). All scatter plots are presented as mean ± SEM. For all figures, *p<0.05; **p<0.01; ***p<0.001; ns, not significant.

Figure 3—figure supplement 1—source data 1 Source data for Figure 3—figure supplement 1.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig3-figsupp1-data1-v2.xlsx
Download elife-84708-fig3-figsupp1-data1-v2.xlsx

Figure 4

Download asset Open asset

Orai1 is dispensable for B cell development.

(**A–B**) Flow cytometric analysis of bone marrow populations for B cell fractions A (B220⁺CD43⁺HSA⁻BP-1⁻), B (B220⁺CD43⁺HSA⁺BP-1⁻), C (B220⁺CD43⁺HSA⁺BP-1⁺), D (B220⁺CD43⁻IgM⁻CD93⁺), E (B220⁺CD43⁻IgM⁺CD93⁺), and F (B220⁺CD43⁻IgM⁺CD93⁻). (C) Quantification of bone marrow populations in (**A, B**) (n=7 and six biological replicates; Mann-Whitney test). (D) Flow cytometric analysis of isolated populations in the spleen for B cell developmental stages T1 (B220⁺AA4.1⁺CD23⁻IgM⁺), T2 (B220⁺AA4.1⁺CD23⁺IgM⁺), and T3 (B220⁺AA4.1⁺CD23⁺IgM⁻). (E) Flow cytometric analysis of isolated populations in the spleen for marginal zone (MZ) B cells (B220⁺CD93⁻CD23⁻IgM⁺) and follicular (FO) B cells (B220⁺CD93⁻CD23⁺IgM⁺). (F) Quantification of splenic populations in (**D, E**) (n=7 and six biological replicates; Mann-Whitney test). All scatter plots are presented as mean ± SEM.

Figure 4—source data 1 Source data for Figure 4.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig4-data1-v2.xlsx
Download elife-84708-fig4-data1-v2.xlsx

Figure 5 with 1 supplement

Download asset Open asset

Orai1 and Orai3 synergistically mediate store-operated Ca2+ entry (SOCE) in primary B cells.

(A) Quantitative RT-PCR of *Orai1*, *Orai2*, and *Orai3* mRNA in negatively isolated B cells from B cell-specific Orai knockout mice (n=3 biological replicates per genotype). (B) Measurement of SOCE in naïve B cells with Fura2 upon store depletion with 2 µM thapsigargin in 0 mM Ca²⁺ followed by re-addition of 1 mM Ca²⁺ to the external bath solution. Subsequently, SOCE was inhibited with the addition of 50 µM 2-APB at 13 min followed by 5 µM Gd³⁺ at 18 min. (C) Quantification of peak SOCE in (B) (from left to right n=200, 200, 199, and 149 cells; Kruskal-Wallis test with multiple comparisons to Mb1-Cre^/+). (D) Quantification of the rate of 2-APB inhibition from 13 to 18 min. (E) Quantitative RT-PCR of *Orai1*, *Orai2*, and *Orai3* mRNA in negatively isolated B cells from wild-type and Orai2^-/- mice (n=3 and six biological replicates). (F) Measurement of SOCE in naïve B cells with Fura2 from wild-type and *Orai2^-/-* mice. (G) Quantification of peak SOCE in (F) (n=147 and 240 cells; Mann-Whitney test). All scatter plots are presented as mean ± SEM. For all figures, ***p<0.001; ****p<0.0001; ns, not significant.

Figure 5—source data 1 Source data for Figure 5.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig5-data1-v2.xlsx
Download elife-84708-fig5-data1-v2.xlsx

Figure 5—figure supplement 1

Download asset Open asset

Store-operated Ca2+ entry (SOCE) in B cells activated for 48 hr with Anti-IgM +Anti CD40.

(A) Measurement of SOCE in B cells stimulated for 48 hr with anti-IgM +anti-CD40. (B) Quantification of peak SOCE in (A) (from left to right n=287, 288, 290, and 172 cells; Kruskal-Wallis test with multiple comparisons to Mb1-Cre^/+). (C) Quantification of the rate of 2-APB inhibition from (A). All scatter plots are presented as mean ± SEM. For all figures, ***p<0.001; ****p<0.0001; ns, not significant.

Figure 5—figure supplement 1—source data 1 Source data for Figure 5—figure supplement 1.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig5-figsupp1-data1-v2.xlsx
Download elife-84708-fig5-figsupp1-data1-v2.xlsx

Figure 6 with 1 supplement

Download asset Open asset

Orai1 is a regulator of nuclear factor of activated T cells (NFAT) activation in naïve and activated B cells.

(A) Representative Imagestream images following intracellular staining for NFAT1 and DAPI in naïve B cells from Mb1-Cre^/+ mice before and after 20 μg/mL anti-IgM stimulation for 15 min. Merge image indicates similarity score co-localization between NFAT1/DAPI. (B) Histograms of NFAT1/DAPI similarity scores before (black trace) and after (red trace) anti-IgM stimulation in naïve B cells from Mb1-Cre^/+ and *Orai1^fl/fl* Mb1-Cre^/+ mice. (C) Quantification of similarity scores following anti-IgM stimulation in (B) (n=3 biological replicates for each; unpaired T-test). (D) Western blot analysis of NFAT1 and α-tubulin in naïve B cells isolated from Mb1-Cre^/+ and *Orai1^fl/fl* Mb1-Cre^/+ mice. B cells were left unstimulated or treated with 2 µM thapsigargin (Tg) for 15 min before harvesting. (E) Quantification of NFAT1 dephosphorylation in (D) (n=4 biological replicates for each; Mann-Whitney test). (F) Western blot analysis of NFAT1 and α-tubulin in B cells stimulated for 48 hr with anti-IgM +anti-CD40. (G) Quantification of NFAT1 dephosphorylation in (F) (n=3 biological replicates for each; Mann-Whitney test). All scatter plots are presented as mean ± SEM. For all figures, *p<0.05; **p<0.01; ****p<0.0001.

Figure 6—source data 1 Source data for Figure 6 including labeled blots for NFAT1 and α-tubulin from Figure 6D and Figure 6F.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig6-data1-v2.xlsx
Download elife-84708-fig6-data1-v2.xlsx
Figure 6—source data 2 Panel D and F-Raw unedited uncropped blots for NFAT1 and α-tubulin from Figure 6.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig6-data2-v2.zip
Download elife-84708-fig6-data2-v2.zip

Figure 6—figure supplement 1

Download asset Open asset

Nuclear factor of activated T cells (NFAT) activation in primary Orai1/Orai3-deficient B cells.

(A) Western blot analysis of NFAT1, NFAT2, and α-tubulin in naïve B cells isolated from Mb1-Cre^/+ and *Orai1^fl/fl* Mb1-Cre^/+ mice. B cells were either unstimulated or treated with 20 μg/mL anti-IgM or 2 µM thapsigargin (Tg) for 15 min before harvesting. (B) Western blot analysis of NFAT1 in naïve B cells isolated from Mb1-Cre^/+, *Orai1^fl/fl* Mb1-Cre^/+, *Orai3^fl/fl* Mb1-Cre^/+, and *Orai1/Orai3^fl/fl* Mb1-Cre^/+ mice following thapsigargin treatment. (C) Same as in (B) but with B cells stimulated for 48 hr with anti-IgM +anti-CD40.

Figure 6—figure supplement 1—source data 1 Labeled western blots for NFAT1, NFAT2, and α-tubulin from Figure 6—figure supplement 1.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig6-figsupp1-data1-v2.xlsx
Download elife-84708-fig6-figsupp1-data1-v2.xlsx
Figure 6—figure supplement 1—source data 2 Raw unedited uncropped blots for NFAT1, NFAT2, and α-tubulin from Figure 6—figure supplement 1.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig6-figsupp1-data2-v2.zip
Download elife-84708-fig6-figsupp1-data2-v2.zip

Figure 7 with 1 supplement

Download asset Open asset

Orai1 and Orai3 regulate B cell proliferation and survival.

(A) Measurement of B cell proliferation by tracking cabroxyfluorescein diacetate succinimidyl ester (CFSE) dilution. B lymphocytes from control, Orai1, Orai3, and Orai1/Orai3 knockout mice were loaded with CFSE (3 μM) and stimulated with anti-IgM (20 μg/mL), anti-CD40 (10 μg/mL), anti-IgM +anti-CD40, or LPS (10 μg/mL). CFSE dilution was determined 72 hr after stimulation for all conditions. (B) Quantification of the percentage of proliferating cells for each condition in (A) (from left to right n=9, 8, 4, and 4 biological replicates; one-way ANOVA with multiple comparisons to Mb1-Cre^/+). CFSE dilution gate is drawn relative to unstimulated controls. (C) Quantification of the percentage of viable cells for each condition in (A) as determined by a Live/Dead viability dye (from left to right n=9, 8, 4, and 4 biological replicates; one-way ANOVA with multiple comparisons to Mb1-Cre^/+). (D) Top KEGG pathways showing differential expression from RNA-sequencing analysis of B cells from Mb1-Cre^/+ vs *Orai1/Orai3^fl/fl* Mb1-Cre^/+ mice stimulated for 24 hr with anti-IgM (20 μg/mL) (n=3 biological replicates for each). (E) Gene set enrichment analysis (GSEA) plots show enrichment statistics (ES) in the Hallmark G2M Checkpoint, E2F Targets, and Cell Cycle gene sets. Large positive ES values suggest activation of these pathways. Normalized enrichment score (NES) values are used to assess statistical significance, and the results for these gene sets are highly significant. All scatter plots are presented as mean ± SEM. For all figures, **p<0.01; ***p<0.001; ****p<0.0001; ns, not significant.

Figure 7—source data 1 Source data for Figure 7.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig7-data1-v2.xlsx
Download elife-84708-fig7-data1-v2.xlsx

Figure 7—figure supplement 1

Download asset Open asset

Loss of Orai2 does not alter primary B cell proliferation or viability.

(A) Quantification of B cell proliferation by tracking cabroxyfluorescein diacetate succinimidyl ester (CFSE) dilution. B lymphocytes from wild-type and *Orai2^-/-* mice were loaded with CFSE (3 μM) and stimulated with a titration of anti-IgM antibodies, anti-CD40 (10 μg/mL), anti-IgM +anti-CD40, or LPS (10 μg/mL). CFSE dilution was determined 72 hr after stimulation for all conditions (n=3 biological replicates for each; unpaired T-test). (B) Quantification of the percentage of viable cells for each condition in (A) as determined by a Live/Dead viability dye (n=3 biological replicates for each; unpaired T-test). All scatter plots are presented as mean ± SEM. For all figures, *p<0.05; **p<0.01; ***p<0.001; ns, not significant.

Figure 7—figure supplement 1—source data 1 Source data for Figure 7—figure supplement 1.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig7-figsupp1-data1-v2.xlsx
Download elife-84708-fig7-figsupp1-data1-v2.xlsx

Figure 8 with 1 supplement

Download asset Open asset

Orai1 and Orai3 regulate B cell mitochondrial respiration.

(A) Gene set enrichment analysis (GSEA) of the KEGG Oxidative Phosphorylation gene set in B cells stimulated for 24 hr with anti-IgM (20 μg/mL) relative to unstimulated controls. (B) Representative transmission electron microscopy (TEM) images of B cells from Mb1-Cre^/+ mice. Shown are naïve, unstimulated B cells (top) and B cells stimulated for 24 hr with anti-IgM (bottom). (C) Quantification of total mitochondria per cell in unstimulated B cells and B cells stimulated for 24 hr with anti-IgM (n=25 for each; Mann-Whitney test). (D) Measurement of total mitochondrial content with MitoTracker Green in B cells from Mb1-Cre^/+ and *Orai1^fl/fl* Mb1-Cre^/+ mice following 24 hr stimulation (n=3 biological replicates for each; Mann-Whitney test). (E) Measurement of oxygen consumption rate (OCR) in primary B lymphocytes following 24 hr stimulation with anti-IgM (20 μg/mL) using the Seahorse Mito Stress Test. (F) Energy map of maximal oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) following carbonyl cyanide p-trifluoromethoxyphenylhydrazone (FCCP) addition. (**G, H**) Quantification of basal (G) and maximal (H) respiration from Seahorse traces in (E) (n=4 biological replicates for each genotype; one-way ANOVA with multiple comparisons to Mb1-Cre^/+). All scatter plots and Seahorse traces are presented as mean ± SEM. For all figures, **p<0.01; ****p<0.0001; ns, not significant.

Figure 8—source data 1 Source data for GSEA summary statistics for Figure 8.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-data1-v2.xlsx
Download elife-84708-fig8-data1-v2.xlsx
Figure 8—source data 2 Source data for Figure 8.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-data2-v2.xlsx
Download elife-84708-fig8-data2-v2.xlsx

Figure 8—figure supplement 1

Download asset Open asset

Loss of Orai1 does not alter CREB phosphorylation, MCU expression, or expression of electron transport chain proteins.

(A) Western blot analysis of total and phosphorylated CREB (S133), MCU, and GAPDH in isolated B cells from Mb1-Cre^/+ and *Orai1^fl/fl* Mb1-Cre^/+ mice. B cells were either unstimulated or stimulated with anti-IgM (20 μg/mL) for 10, 20, or 30 min before harvesting. (B) Western blot analysis of MCU and GAPDH protein in single Orai1, and Orai3 knockout and double Orai1/Orai3 knockout A20 cell clones. (**C, D**) Western blot analysis of electron transport chain components in B cells from Mb1-Cre^/+ and *Orai1^fl/fl* Mb1-Cre^/+ mice either (C) unstimulated or (D) stimulated with anti-IgM for 24 hr.

Figure 8—figure supplement 1—source data 1 Labeled western blots for Figure 8—figure supplement 1.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-figsupp1-data1-v2.xlsx
Download elife-84708-fig8-figsupp1-data1-v2.xlsx
Figure 8—figure supplement 1—source data 2 Raw unedited uncropped blots for GAPDH and MCU from Figure 8—figure supplement 1A.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-figsupp1-data2-v2.zip
Download elife-84708-fig8-figsupp1-data2-v2.zip
Figure 8—figure supplement 1—source data 3 Raw unedited uncropped blots for Phospho-CREB (pCREB) from Figure 8—figure supplement 1A.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-figsupp1-data3-v2.zip
Download elife-84708-fig8-figsupp1-data3-v2.zip
Figure 8—figure supplement 1—source data 4 Raw unedited uncropped blots for MCU and GAPDH from Figure 8—figure supplement 1B.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-figsupp1-data4-v2.zip
Download elife-84708-fig8-figsupp1-data4-v2.zip
Figure 8—figure supplement 1—source data 5 Raw unedited uncropped blots for electron transport chain (ETC) proteins from Figure 8—figure supplement 1C.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-figsupp1-data5-v2.zip
Download elife-84708-fig8-figsupp1-data5-v2.zip
Figure 8—figure supplement 1—source data 6 Raw unedited uncropped blots for GAPDH from Figure 8—figure supplement 1C.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-figsupp1-data6-v2.zip
Download elife-84708-fig8-figsupp1-data6-v2.zip
Figure 8—figure supplement 1—source data 7 Raw unedited uncropped blots for electron transport chain (ETC) proteins and GAPDH from Figure 8—figure supplement 1D.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig8-figsupp1-data7-v2.zip
Download elife-84708-fig8-figsupp1-data7-v2.zip

Figure 9 with 1 supplement

Download asset Open asset

Orai1/Orai3-mediated SOCE-calcineurin-NFAT pathway regulates B cell metabolism.

(A) Analysis of polar metabolites in B cells from Mb1-Cre^/+ mice utilizing liquid chromatography followed by mass spectrometry. B cells were either unstimulated or stimulated for 24 hr with anti-IgM, anti-IgM +anti-CD40, anti-IgM with 1 µM FK506, or anti-IgM with 10 µM GSK-7975A. (**B, C**). Heat maps of statistically significant polar metabolites in B cells from Mb1-Cre^/+ and *Orai1/Orai3^fl/fl* Mb1-Cre^/+ mice following (B) 24 hr anti-IgM stimulation or (C) 24 hr anti-IgM +anti-CD40 stimulation. (n=3 biological replicates for each condition).

Figure 9—source data 1 Source data for Figure 9.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig9-data1-v2.xlsx
Download elife-84708-fig9-data1-v2.xlsx

Figure 9—figure supplement 1

Download asset Open asset

Polar metabolite analysis in Orai1/Orai3 deficient-B cells.

(A) Analysis of polar metabolites in B cells from Mb1-Cre^/+ and *Orai1/Orai3^fl/fl* Mb1-Cre^/+. B cells were either unstimulated or stimulated for 24 hr with anti-IgM, anti-IgM +anti-CD40, anti-IgM +1 µM FK506, or anti-IgM +10 µM GSK-7975A. Profiling was performed on B cells from 3 mice per group. (B) Heat maps of statistically significant amino acids and nucleotide precursors in B cells from Mb1-Cre^/+ and *Orai1/Orai3^fl/fl* Mb1-Cre^/+ mice following anti-IgM stimulation for 24 hr.

Figure 9—figure supplement 1—source data 1 Source data for Figure 9—figure supplement 1.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig9-figsupp1-data1-v2.xlsx
Download elife-84708-fig9-figsupp1-data1-v2.xlsx

Figure 10 with 1 supplement

Download asset Open asset

Deletion of *Orai1* and *Orai3* in B cells does not compromise immunity to influenza A virus (IAV).

(A) Experimental outline. Littermate controls and *Orai1^fl/flOrai3^fl/fl* Mb1-Cre^/+ mice have infected intranasally with 1x10⁵ TCID₅₀ of the x31 H3N2 strain of influenza A virus. Serum was collected on days 9 and 14, and mice were sacrificed on day 14 for analysis. (B) Representative H&E stains of lung sections. Scale bar: 500 µm. (C) Alveolar volume fraction of 10 mice per cohort. (D) Representative flow cytometry plots of B cells isolated from mediastinal lymph nodes (med LN). (E) Summary of the frequencies (%) and total cell numbers of B220^–CD138⁺ plasma cells and Fas⁺GL-7⁺ GC B cells shown in panel D from 10 mice per cohort. (F) Representative flow cytometry plots of plasma cells isolated from the bone marrow of five IAV-infected mice per cohort. (G) Representative flow cytometry plots (left) and summary (right) of the frequencies of class-switched IgG1⁺ GC B cells in med LN of five IAV-infected mice per cohort. (H) IAV-specific IgM and IgG levels in the serum of 10 mice per cohort were measured on days 9 and 14. Panels B-H show the results of two independent experiments. Statistical analysis by unpaired Student’s t-test: ***p<0.001, **p<0.01, *p<0.05.

Figure 10—source data 1 Source data for Figure 10.: https://cdn.elifesciences.org/articles/84708/elife-84708-fig10-data1-v2.xlsx
Download elife-84708-fig10-data1-v2.xlsx

Figure 10—figure supplement 1

Download asset Open asset

Cytokine profiling of B cells from *Orai1/Orai3^fl/fl* Mb1-Cre^/+ mice.

(**A–D**) Heatmap display of genes comprising the KEGG Cytokine/Cytokine Receptor Interaction gene set from 24 hr anti-IgM stimulated B cells isolated from Mb1-Cre^/+ and *Orai1/Orai3^fl/fl* Mb1-Cre^/+ mice. Each column represents B cells isolated from an individual mouse from the respective genotype.

Tables

Appendix 1—key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Antibody	Total OXPHOS Rodent WB Antibody Cocktail (Mouse monoclonal)	Abcam	Cat# ab110413, RRID:AB_2629281	(1:1000)
Antibody	anti-GAPDH (Mouse monoclonal)	Millipore Sigma	Cat# MAB374, RRID:AB_2107445	(1:5000)
Antibody	MCU (D2Z3B) (Rabbit monoclonal)	Cell Signaling Technologies	Cat# 14997, RRID:AB_2721812	(1:2000)
Antibody	α-Tubulin (DM1A) (Mouse monoclonal)	Cell Signaling Technologies	Cat# 3873, RRID:AB_1904178	(1:5000)
Antibody	NFAT1 Antibody (Rabbit polyclonal)	Cell Signaling Technologies	Cat# 4389, RRID:AB_1950418	(1:1000)
Antibody	NFAT1 (D43B1) XP (Rabbit monoclonal) (Alexa Fluor 488 Conjugate)	Cell Signaling Technologies	Cat# 14324, RRID:AB_2798450	(1:50)
Antibody	NFAT2 (D15F1) (Rabbit monoclonal)	Cell Signaling Technologies	Cat# 8032, RRID:AB_10829466	(1:1000)
Antibody	Phospho-CREB (Ser133) (87G3) (Rabbit monoclonal)	Cell Signaling Technologies	Cat# 9198, RRID:AB_2561044	(1:1000)
Antibody	CREB (86B10) (Mouse monoclonal)	Cell Signaling Technologies	Cat# 9104, RRID:AB_490881	(1:1000)
Antibody	IRDye 680RD Goat anti-Mouse IgG antibody	LI-COR Biosciences	Cat# 925–68070, RRID:AB_2651128	(1:10,000)
Antibody	IRDye 800CW Donkey anti-Rabbit IgG antibody	LI-COR Biosciences	Cat# 926–32213, RRID:AB_621848	(1:5000)
Antibody	anti-Orai1 (Rabbit polyclonal)	Feske Lab		(1:200)
Antibody	Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 647	Thermo Fisher Scientific	Cat# A-21244, RRID:AB_2535812	(1:1000)
Antibody	AffiniPure F(ab')₂ Fragment Goat Anti-Mouse IgM, µ chain specific (Goat polyclonal)	Jackson ImmunoResearch	Cat# 115-006-020	(20 ug/mL)
Antibody	Rabbit anti-Mouse IgG (H&L) - Affinity Pure	Tonbo Biosciences	Cat# 70–8076 M002	(10 ug/mL)
Antibody	InVivoMAb anti-mouse CD40 FGK4.5/FGK45 (Rat monoclonal)	Bio X Cell	Cat# BE0016-2	(10 ug/mL)
Antibody	Brilliant Violet 605 anti-mouse/human CD45R/B220 Antibody (Rat monoclonal)	Biolegend	Cat# 103243	(1:200)
Antibody	PE/Cyanine5 anti-mouse CD86 Antibody (Rat monoclonal)	Biolegend	Cat# 105015	(1:100)
Antibody	PE/Cyanine7 anti-mouse I-A/I-E Antibody (Rat monoclonal)	Biolegend	Cat# 107629	(1:800)
Antibody	CD3e Monoclonal Antibody (145–2 C11), PE (Hamster monoclonal)	Thermo Fisher Scientific	Cat# 12-0031-82	(1:200)
Antibody	V500 Rat anti-Mouse CD8a (Rat monoclonal)	BD Biosciences	Cat# 560776	(1:200)
Antibody	BB700 Rat Anti-Mouse CD4 (Rat monoclonal)	BD Biosciences	Cat# 566408	(1:200)
Antibody	APC Rat Anti-Mouse CD24 (Rat monoclonal)	BD Biosciences	Cat# 562349	(1:200)
Antibody	FITC Rat Anti-Mouse CD23 (Rat monoclonal)	BD Biosciences	Cat# 553138	(1:200)
Antibody	IgM Monoclonal Antibody (eB121-15F9) (Rat monoclonal)	Thermo Fisher Scientific	Cat# 12-5890-82	(1:200)
Antibody	CD93 (AA4.1) Monoclonal Antibody (AA4.1), APC (Rat monoclonal)	Thermo Fisher Scientific	Cat# 17-5892-82	(1:200)
Antibody	PE/Cyanine5 Streptavidin	Biolegend	Cat# 405205	(1:200)
Antibody	Pacific Blue anti-mouse/human CD45R/B220 Antibody (Rat monoclonal)	Biolegend	Cat# 103230	(1:200)
Cell line (Mus musculus)	A20	ATCC	ATCC Cat# TIB-208, RRID:CVCL_1940
Chemical compound, drug	FK506	STEMCELL Technologies	Cat# 74152
Chemical compound, drug	CRAC Channel Inhibitor IV, GSK-7975A	Sigma Aldrich	Cat# 5343510001
Chemical compound, drug	2-APB	Tocris Bioscience	Cat# 1224
Chemical compound, drug	Thapsigargin	Thermo Fisher Scientific	Cat# T7458
Chemical compound, drug	5 (6)-CFDA, SE; CFSE (5-(and-6)-Carboxyfluorescein Diacetate, Succinimidyl Ester), mixed isomers	Thermo Fisher Scientific	Cat# C1157
Chemical compound, drug	Gadolinium(III) Chloride	ACROS Organics	Cat# AC383560050
Commercial assay or kit	cDNA Reverse Transcription Kit	Applied Biosystems	Cat# 4368814
Commercial assay or kit	Seahorse XF Cell Mito Stress Test Kit	Agilent Technologies	Cat# 103015–100
Commercial assay or kit	Pierce Rapid Gold BCA Protein Assay Kit	Thermo Fisher Scientific	Cat# A53225
Commercial assay or kit	Tetramethylrhodamine, Ethyl Ester, Perchlorate (TMRE)	Thermo Fisher Scientific	Cat# T669
Commercial assay or kit	MitoTracker Green FM - Special Packaging	Thermo Fisher Scientific	Cat# M7514
Commercial assay or kit	Cell Line Nucleofector Kit V	Lonza	Cat# VCA-1003
Commercial assay or kit	StrataClone Blunt PCR Cloning Kit	Agilent Technologies	Cat# 240207
Commercial assay or kit	EasySep Mouse B Cell Isolation Kit	STEMCELL Technologies	Cat# 19854
Commercial assay or kit	eBioscience Foxp3 /Transcription Factor Staining Buffer Set	Thermo Fisher Scientific	Cat# 00-5523-00
Commercial assay or kit	RNeasy Mini Kit	Qiagen	Cat# 74106
Commercial assay or kit	LIVE/DEAD Fixable Near-IR Dead Cell Stain Kit	Thermo Fisher Scientific	Cat# L34975
Recombinant DNA reagent	pSpCas9(BB)–2A-GFP (PX458)	Addgene	Cat# 48138
Recombinant DNA reagent	pU6-(BbsI)_CBh-Cas9-T2A-mCherry	Addgene	Cat# 64324
Genetic Reagent (Mus musculus)	B6.C(Cg)-Cd79atm1(cre)Reth/EhobJ	Jackson Laboratory	Strain #:020505 RRID:IMSR_JAX:020505	Mb1-Cre on C57BL/6
Genetic Reagent (Mus musculus)	Orai1fl/fl	Ahuja et al., 2017 PMID:28273482
Genetic Reagent (Mus musculus)	Orai3fl/fl	Gammons et al., 2021 PMID:33849280
Genetic Reagent (Mus musculus)	Orai1fl/fl Mb1cre/+	This paper		Orai1fl/fl mice crossed with Mb1-Cre on C57BL/6
Genetic Reagent (Mus musculus)	Orai3fl/fl Mb1cre/+	This paper		Orai3fl/fl mice crossed with Mb1-Cre on C57BL/6
Genetic Reagent (Mus musculus)	Orai1/Orai3fl/fl Mb1cre/+	This paper		Orai1/Orai3fl/fl mice crossed with Mb1-Cre on C57BL/6
Chemical compound, drug	Fura-2, AM, cell permeant	Thermo Fisher Scientific	Cat# F1221
Other	SYBR Select Master Mix	Thermo Fisher Scientific	Cat# 4472920	Master mix for qRT-PCR
Other	Lipopolysaccharides from Escherichia coli O111:B4	Sigma Aldrich	Cat# L2630-10MG	Stimulation of primary B lymphocytes
Other	Intercept (TBS) Blocking Buffer	LI-COR Biosciences	Cat# 927–60001	Western blot blocking buffer
Other	Halt Protease and Phosphatase Inhibitor	Thermo Fisher Scientific	Cat# PI78443	Western blot lysis buffer component
Other	RIPA Buffer	Sigma Aldrich	Cat# R0278-50ML	Western blot lysis buffer component
Other	DAPI	Sigma Aldrich	Cat# D9542	Nuclear localization staining for ImageStream
Other	EasySep Buffer	STEMCELL Technologies	Cat# 20144	B cell isolation kit buffer
Other	NuPAGE 4 to 12%, Bis-Tris, 1.0–1.5 mm, Mini Protein Gels	Thermo Fisher Scientific	Cat# NP0321BOX	Western blot denaturing gels
Other	Poly-L-lysine solution	Sigma Aldrich	Cat# P4832-50ML	Attachment of suspension cells to coverslips
Sequence-based Reagent	mOrai1n	This paper	gRNA primers for mouse Orai1 CRISPR knockout	GCCTTCGGATCCGGTGCGTC
Sequence-based Reagent	mOrai1c	This paper	gRNA primers for mouse Orai1 CRISPR knockout	CACAGGCCGTCCTCCGGACT
Sequence-based Reagent	mOrai3n	This paper	gRNA primers for mouse Orai3 CRISPR knockout	GCGTCCGTAACTGTTCCCGC
Sequence-based Reagent	mOrai3c	This paper	gRNA primers for mouse Orai3 CRISPR knockout	GAAGGAGGTCTGTCGATCCC
Sequence-based Reagent	Mb1 Cre Common Primer	This paper	PCR primers for genotyping Mb1 Cre	ACT GAG GCA GGA GGA TTG G
Sequence-based Reagent	Wild Type Forward Primer	This paper	PCR primers for genotyping Mb1 Cre	CTC TTT ACC TTC CAA GCA CTG A
Sequence-based Reagent	Mutant Forward Primer	This paper	PCR primers for genotyping Mb1 Cre	CAT TTT CGA GGG AGC TTC A
Sequence-based Reagent	Orai1 fl/fl Forward	This paper	PCR primers for genotyping Orai1 flox	ACC CAT GTG GTG GAA AGA AA
Sequence-based Reagent	Orai1 fl/fl Reverse	This paper	PCR primers for genotyping Orai1 flox	TGC AGG CAC TAA AGA CGA TG
Sequence-based Reagent	Orai3 fl/fl Forward	This paper	PCR primers for genotyping Orai3 flox	GAG CTG GGA TTA AAG GTG TAT GCC
Sequence-based Reagent	Orai3 fl/fl Reverse	This paper	PCR primers for genotyping Orai3 flox	TGA CTT CAC CTC AGT CTC AAA GGG G
Sequence-based Reagent	mOrai1 F	This paper	RT-PCR primers	CCA AGC TCA AAG CTT CCA GC
Sequence-based Reagent	mOrai1 R	This paper	RT-PCR primers	GCA CTA AAG ACG ATG AGC AAC C
Sequence-based Reagent	mOrai2 F	This paper	RT-PCR primers	GCAGCTACCTGGAACTCGTC
Sequence-based Reagent	mOrai2 R	This paper	RT-PCR primers	GTTGTGGATGTTGCTCACCG
Sequence-based Reagent	mOrai3 F	This paper	RT-PCR primers	ACC AAC GAC TGC ACA GAT AC
Sequence-based Reagent	mOrai3 R	This paper	RT-PCR primers	CCA ATG GGC ACA AAC TTG AC
Sequence-based Reagent	mGAPDH F	This paper	RT-PCR primers	GTG GCA AAG TGG AGA TTG TTG
Sequence-based Reagent	mGAPDH R	This paper	RT-PCR primers	CGT TGA ATT TGC CGT GAG TG
Software, algorithm	Image J	https://imagej.net/	RRID:SCR_003070
Software, algorithm	Graphpad Prism	http://www.graphpad.com/	RRID:SCR_002798
Software, algorithm	Leica Application Suite X	https://www.leica-microsystems.com/	RRID:SCR_016555
Software, algorithm	Image Studio Lite	https://www.licor.com/bio/image-studio-lite/download	RRID:SCR_013715
Software, algorithm	FlowJo 9.9.6	https://www.flowjo.com/solutions/flowjo	RRID:SCR_008520