Integrated transcriptome and proteome analysis reveals posttranscriptional regulation of ribosomal genes in human brain organoids
- Institute of Molecular Biotechnology of the Austrian Academy of Sciences (IMBA), Vienna BioCenter (VBC), Austria
- Gregor Mendel Institute, Vienna Biocenter, Austria
- Department of Neurology, Medical University of Vienna, Austria
Figures
Figure 1 with 7 supplements
RNA-protein multiomics of progenitors and neurons in human brain organoids.
(A) Schematic representation of the experimental design. A dual reporter line was generated in H9 human embryonic stem cell (hESC) background. Cells from brain organoids grown using this reporter …
-
Figure 1—source data 1
RNA-seq gene expression results.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-data1-v1.xlsx
-
Figure 1—source data 2
Mass spectrometry protein expression results.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-data2-v1.xlsx
-
Figure 1—source data 3
Combined RNA and protein gene expression results and module assignment of genes.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-data3-v1.xlsx
Figure 1—figure supplement 1
Generation of a dual reporter human embryonic stem cell (hESC) line to differentially label neural progenitors and neurons.
(A) Results of genotyping PCR for H9 WT hESCs, dual reporter H9 hESC clones and negative control samples to test integration of the P2A-EGFP fragment in the SOX2 genomic locus. Integration of EGFP …
-
Figure 1—figure supplement 1—source data 1
Original unlabelled files (.scn and .tif) of gel picture for PCR confirming insertion of SOX2-P2A-EGFP casette (see Figure 1—figure supplement 1A) and Puro-hSyn1::dTomato-WPRE-pA casette (see Figure 1—figure supplement 2Bii).
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-figsupp1-data1-v1.zip
-
Figure 1—figure supplement 1—source data 2
Labelled file of gel picture for PCR confirming insertion of SOX2-P2A-EGFP casette (see Figure 1—figure supplement 1A) and Puro-hSyn1::dTomato-WPRE-pA casette (see Figure 1—figure supplement 2Bii).
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-figsupp1-data2-v1.zip
-
Figure 1—figure supplement 1—source data 3
Original unlabelled files (.scn and .tif) of gel picture for PCR confirming insertion of Puro-hSyn1::dTomato-WPRE-pA casette (see Figure 1—figure supplement 2Bi).
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-figsupp1-data3-v1.zip
-
Figure 1—figure supplement 1—source data 4
Labelled file of gel picture for PCR confirming insertion of Puro-hSyn1::dTomato-WPRE-pA casette (see Figure 1—figure supplement 2Bi).
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-figsupp1-data4-v1.zip
-
Figure 1—figure supplement 1—source data 5
Original unlabelled files (.scn and .tif) of gel picture for PCR confirming insertion in AAVS1 locus (see Figure 1—figure supplement 2Biii).
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-figsupp1-data5-v1.zip
-
Figure 1—figure supplement 1—source data 6
Labelled file of gel picture for PCR confirming insertion in AAVS1 locus (see Figure 1—figure supplement 2Biii).
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig1-figsupp1-data6-v1.zip
Figure 1—figure supplement 2
Characterization of the dual reporter using sparse labeling strategy.
(A) Schematic representation of sparse labeling in organoid culture using 95% unlabeled control H9 human embryonic stem cells (hESCs) and 5% dual reporter hESCs for embryoid body formation. (B,C) …
Figure 1—figure supplement 3
Fluorescent activated cell sorting (FACS) from the dual reporter organoids.
(A) Gating criteria for FACS to sort different cell populations from dual reporter organoids at different organoid development stages. Negative (black), EGFP+ (green), dTomato+ (magenta), …
Figure 1—figure supplement 4
Principal component analysis (PCA) of transcriptome and proteome of progenitors and neurons sorted from dual reporter organoids.
(A) PCA of transcriptome of EGFP+ (dark green) and dTomato+ (red) cells at 40, 60, 90, and 120 days of organoid development (B) with loading scores for PC1, PC2, and PC3 showing top contributing …
Figure 1—figure supplement 5
Characterization of cell populations fluorescent activated cell sorted from the dual reporter organoids.
(A) Plots showing RNA (top) and protein (bottom) abundance of key neurodevelopmental markers in EGFP+ (green), dTomato+ positive (red) and EGFP+, dTomato+ double positive (gray) cells at different …
Figure 1—figure supplement 6
Comparison of proteome of intact organoids and cells sorted using the dual reporter strategy.
(A) Volcano plot of protein fold change between intact organoids and sorted cells versus negative logarithmized p-values. Threshold line at 1% FDR is indicated; 140 proteins are enriched in intact …
Figure 1—figure supplement 7
Integration and clustering of the RNA-protein multiomics data.
(A) Plots showing correlation between protein and RNA abundance in progenitors (EGFP+, green) and neurons (dTomato+, red) at different stages of organoid development. (B) Principal component …
Figure 2 with 2 supplements
Clustering of genes based on relative RNA-protein expression patterns in progenitors and neurons in human brain organoids.
(A) Heatmap showing clustering results for the nine gene expression modules. Z-score normalized abundance of RNA (R) and protein (P) in progenitors (EGFP+, green) and neurons (dTomato+, red) at …
Figure 2—figure supplement 1
Gene ontology (GO) analysis of gene expression modules.
(A,B) Enrichment analysis of genes in the nine modules for (A) GO biological process (BP) and (B) GO molecular function (MF). Shown are the top five enriched terms per module and the number of genes …
Figure 2—figure supplement 2
Analysis of gene expression modules and correlation between relative RNA-protein abundance.
(A) Absolute RNA (transcript per million [TPM]) and protein (intensity) expression in progenitors (EGFP+, green) and neurons (dTomato+, red) of five manually selected member genes per module. (B) …
Figure 3 with 1 supplement
Analysis of module-specific RNA regulatory features.
(A) Schematic showing trans-regulation of mRNA translation by RBPs and miRNAs and cis-regulation by mRNA sequence features and secondary structure. (B) Barplot showing number of RBP motifs with …
-
Figure 3—source data 1
RNA-binding protein motifs in the 3' and 5'UTRs of module genes.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig3-data1-v1.xlsx
-
Figure 3—source data 2
Transcript feature analysis for the modules.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig3-data2-v1.xlsx
-
Figure 3—source data 3
Classical and predicted 5'TOP genes.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig3-data3-v1.xlsx
Figure 3—figure supplement 1
Analysis of module-specific trans- and cis-regulatory features.
(A) Barplot showing number of RBP motifs with significant over/under representation in 5’UTR of member genes of each gene module. Significance threshold: adjusted p-value <0.05. (B) Barplot showing …
Figure 4 with 6 supplements
Translation of 5' terminal oligopyrimidine (5'TOP) mRNAs is partially inhibited in early progenitors compared to early born neurons.
(A) RNA-FISH for the 5’TOP transcripts RPL5 and RPL11 in 40-day-old organoids (H9 background). Images show a typical ventricular zone (VZ)-like structure in the brain organoid with a zoomed-in image …
Figure 4—figure supplement 1
Relative protein yield of 5' terminal oligopyrimidine (5’TOP) mRNAs is lower in early progenitors compared to early born neurons.
(A,B) RNA-FISH for (A) DCX transcripts and (B) no probe control in 40-day-old organoids (H9 background). Image shows a typical ventricular zone (VZ)-like structure in the brain organoid with a …
Figure 4—figure supplement 2
Doxycycline (Dox)-inducible 5' terminal oligopyrimidine (5’TOP)-reporter hPSC lines.
(A) Schematic representation of the Dox-inducible reporter assay in hPSCs. (B) Flow cytometry analysis of tagBFP expression in hPSCs carrying 5’TOP (blue) and non-5’TOP (orange) sequences in 5’UTR …
Figure 4—figure supplement 3
5' Terminal oligopyrimidine (5’TOP) reporter assay in 40-day-old brain organoids.
(A) Schematic representation of the doxycycline (Dox)-inducible reporter assay. hPSCs carrying 5’TOP (blue) and non-5’TOP (orange) sequences in 5’UTR of tagBFP were used to grow brain organoids. …
Figure 4—figure supplement 4
Early ventricular radial glia exhibit stress granule-like structures.
(A) Confocal scan of ventricular zone (VZ) in control and sodium arsenite-treated organoids (H9 background) stained with anti-G3BP1 antibody and DAPI. Zoomed-in image of the inlay shows G3BP1 …
Figure 4—figure supplement 5
Stress granule-like structures in early ventricular radial glia of G3BP1-mScarlet report line organoids.
(A) Results of genotyping PCR to check insertion of the G3BP1-mScarlet transgene in the G3BP1 locus. Samples include G3BP1 reporter human embryonic stem cells (hESCs), control H9 hEScs, and negative …
-
Figure 4—figure supplement 5—source data 1
Genotyping PCR of G3BP1-mScarlet cell line.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig4-figsupp5-data1-v1.zip
Figure 4—figure supplement 6
Analysis of relative mRNA stability.
(A) Paired relative stability of mRNAs in progenitors and neurons of 40-day-old organoids measured by estimating exonic versus intronic reads from the RNA-seq data. Black dash marks the mean …
-
Figure 4—figure supplement 6—source data 1
Relative RNA stability.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig4-figsupp6-data1-v1.xlsx
Figure 5 with 4 supplements
mTOR overactivation causes increased translation of 5' terminal oligopyrimidine (5’TOP) transcripts leading to precocious differentiation.
(A) Immunostaining of 40-day-old TSC2+/+ and TSC2-/- organoid sections (Rozh-5 background) with anti-TSC2 antibody. Scale bar = 100 µm. (B) Immunostaining of 40-day-old TSC2+/+ and TSC2-/- organoid …
-
Figure 5—source data 1
Differential gene association analysis from polysome profiling results.
- https://cdn.elifesciences.org/articles/85135/elife-85135-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Analysis and perturbation of mTOR activity.
(A) Confocal scan of a 40-day-old organoid (H9 background) stained with anti-phospho-4EBP1 (cyan) and anti-SOX2 (red) antibodies. Zoomed-in image of the inlay shows a ventricular zone (VZ). Scale …
Figure 5—figure supplement 2
Polysome profiling in mTOR overactivated organoids.
(A) Representative traces of polysome profiling of TSC2+/+ and TSC2-/- organoids. (B) Hierarchical clustered heatmap of genes differentially associated with monosome fractions of TSC2+/+ and TSC2-/- …
Figure 5—figure supplement 3
Effect of mTOR overactivation on 5' terminal oligopyrimidine (5’TOP) RNA and protein levels.
(A) RNA-FISH for the 5’TOP transcripts RPL5 and RPL11, in 40-day-old TSC2+/+ and TSC2-/- organoids (Rozh-5 background). Images show a typical ventricular zone (VZ)-like structure in the brain …
Figure 5—figure supplement 4
Effect of mTOR overactivation on tissue development.
(A) Dot plot showing overrepresentation analysis of genes differentially associated with ribosome fractions of TSC2-/- and TSC2+/+ organoids across the nine gene modules. Significance threshold: …
Author response image 1
Analysis of developing mouse brain tissue.
(A) Confocal scans of ventricular zones in E12. 5 Mouse developing cortex stained with anti-EGFP, anti-G3BP1, anti-SOX1 and anti-MAP2 antibodies and DAPI. Zoomed-in images of the boxed areas are …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Chicken anti-GFP, polyclonal | Aves Labs | Aves Labs Cat# GFP-1020; RRID:AB_10000240 | 1:500 |
| Antibody | Goat anti-SOX1, polyclonal | R&D Systems | R&D Systems Cat# AF3369; RRID:AB_2239879 | 1:200 |
| Antibody | Goat anti-Sox2, polyclonal | R&D Systems | R&D Systems Cat# AF2018; RRID:AB_355110 | 1:200 |
| Antibody | Mouse anti-G3BP1, monoclonal | Abcam | Abcam Cat# ab56574; RRID:AB_941699 | 1:200 |
| Antibody | Mouse anti-NeuN, monoclonal | Millipore | Millipore Cat# MAB377; RRID:AB_2298772 | 1:600 |
| Antibody | Rabbit anti-dsred, polyclonal | Takara Bio | Takara Bio Cat# 632496; RRID:AB_10013483 | 1:250 |
| Antibody | Rabbit anti-p4EBP1 (Thr37/46), monoclonal | Cell Signaling Technology | Cell Signaling Technology Cat# 2855; RRID:AB_560835 | 1:200 |
| Antibody | Rabbit anti-pS6 (Ser235/236), monoclonal | Cell Signaling Technology | Cell Signaling Technology Cat# 4858; RRID:AB_916156 | 1:200 |
| Antibody | Rabbit anti-RPL11, polyclonal | Abcam | Abcam Cat# ab79352; RRID:AB_2042832 | 1:200 |
| Antibody | Rabbit anti-RPL5, polyclonal | Abcam | Abcam Cat#ab137617; RRID:AB_2924679 | 1:200 |
| Antibody | Rabbit anti-phospho-EIF2a (Ser51) D9G8, monoclonal | Cell Signaling Technology | Cell Signaling Technology Cat#3398; RRID:AB_2096481 | 1:200 |
| Antibody | Rabbit anti-S100B, monoclonal | Abcam | Abcam Cat# ab52642; RRID:AB_882426 | 1:200 |
| Antibody | Sheep anti-Human EOMES, polyclonal | R&D Systems | R&D Systems Cat#AF6166-SP; RRID:AB_10569705 | 1:200 |
| Antibody | Alexa Fluor 488 Donkey anti-chicken, polyclonal | Jackson ImmunoResearch | Jackson ImmunoResearch Labs Cat# 703-545-155; RRID:AB_2340375 | 1:500 |
| Antibody | Alexa Fluor 488 Donkey anti-goat, polyclonal | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# A-11055; RRID:AB_2534102 | 1:500 |
| Antibody | Alexa Fluor 568 Donkey anti-rabbit, polyclonal | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# A10042; RRID:AB_2534017 | 1:500 |
| Antibody | Alexa Fluor 647 Donkey anti-goat, polyclonal | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# A-21447; RRID:AB_2535864 | 1:500 |
| Antibody | Alexa Fluor 647 Donkey anti-mouse, polyclonal | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# A-31571; RRID:AB_162542 | 1:500 |
| Antibody | Alexa Fluor 647 Donkey anti-rabbit, polyclonal | Thermo Fisher Scientific | Thermo Fisher Scientific Cat# A-31573; RRID:AB_2536183 | 1:500 |
| Antibody | Alexa Fluor 647 Donkey anti-sheep, polyclonal | Jackson ImmunoResearch | Jackson ImmunoResearch Labs Cat#713-605-147; RRID:AB_2340751 | 1:500 |
| Antibody | Alexa Fluor 488Mouse anti-β-Tubulin, Class III, monoclonal | BD Biosciences | BD Biosciences Cat# 560338; RRID:AB_1645345 | 1:25 |
| Antibody | Alexa Fluor488Mouse IgG2a, κ Isotype control, monoclonal | BD Biosciences | BD Biosciences Cat# 558055; RRID:AB_1645612 | 1:25 |
| Antibody | PE Mouse IgG1, κ Isotype Control, monoclonal | BD Biosciences | BD Biosciences Cat# 554680; RRID:AB_395506 | 1:25 |
| Antibody | Sox2 Mouse, PE, Clone: O30-678, BD, monoclonal | BD Biosciences | BD Biosciences Cat# 562195; RRID:AB_10895118 | 1:25 |
| Recombinant DNA reagent | pSpCas9(BB)–2A- GFP (PX458) | Addgene | 48138 | |
| Recombinant DNA reagent | AAVS1-Neo-TRE- CMV-Cre-rtTA | Addgene | 165457 | |
| Recombinant DNA reagent | pSF4 TetCMV 5'TOP intron 20xGCN4 Renilla FKBP Stop 24xMS2v5 SV40 CTE polyA | Addgene | 119946 | |
| Recombinant DNA reagent | HR_G3BP1-V5- APEX2-GFP | Addgene | 105284 | |
| Recombinant DNA reagent | pmScarlet-i_C1 | Addgene | 85044 | |
| Commercial assay or kit | Cellartis DEF-CS 500 Culture System | Takara Bio | Y30012 | |
| Commercial assay or kit | Phusion Hot Start Flex DNA Polymerase | New England Biolabs | M0535S | |
| Commercial assay or kit | Human Stem Cell Nucleofector Kit 1 | Lonza | VPH-5012 | |
| Commercial assay or kit | QuickExtract DNA Extraction Solution | Cambio | QE09050 | |
| Commercial assay or kit | NEBNext Ultra II Directional RNA Library Prep Kit for Illumina | New England Biolabs | E7760 | |
| Commercial assay or kit | NEBNext Poly(A) mRNA Magnetic Isolation Module | New England Biolabs | E7490 | |
| Commercial assay or kit | Amaxa nucleofector 2b device | Lonza | AAB-1001 | |
| Other | gentleMACS Dissociator | Miltenyi Biotec | 130-093-235 | see section on 'Organoid dissociation' in the 'Materials and methods' for details |
| Other | FACS ARIAIII | BD Biosciences | see section on 'FACS' in the 'Materials and methods' for details | |
| Other | BD LSR Fortessa Cell Analyzer | BD Biosciences | see section on 'Flow cytometry analysis' in the 'Materials and methods' for details | |
| Other | Epredia Cryostar NX70 cryostat | Thermo Fisher Scientific | 957000H | see section on 'Immunohistochemistry' in the 'Materials and methods' for details |
| Other | Fragment analyser | Agilent | see section on 'RNA extraction, library generation and RNA-seq' in the 'Materials and methods' for details | |
| Other | Gradient master base unit | Biocomp | B108 | see section on 'Polysome profiling by sucrose gradient fractionation' in the 'Materials and methods' for details |
| Software, algorithm | Fiji | https://doi.org/10.1038/nmeth.2019; https://imagej.net/software/fiji/ | ||
| Software, algorithm | trim-galore v0.5.0 | https://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ | ||
| Software, algorithm | bowtie2 v2.3.4.1 | https://bowtie-bio.sourceforge.net/bowtie2/index.shtml | ||
| Software, algorithm | star v2.6.0c | doi:10.1093/bioinformatics/bts635 | ||
| Software, algorithm | subread v1.6.2 | doi:10.1093/nar/gkz114 | ||
| Software, algorithm | DESeq2 v1.18.1 | doi:10.1186/s13059-014-0550-8 | ||
| Software, algorithm | Seurat package | doi:10.1016/j.cell.2021.04.048 | ||
| Software, algorithm | Proteome Discoverer (version 2.4.0.305) | Thermo Fisher Scientific | ||
| Software, algorithm | MSAmanda v2.0.0.13248 | doi:10.1021/pr500202e | ||
| Software, algorithm | maSigPro version 1.68.00 | doi:10.1093/bioinformatics/btu333 | ||
| Software, algorithm | clusterProfiler | doi:10.1089/omi.2011.0118 | ||
| Software, algorithm | biomart | doi:10.1038/nprot.2009.97 | ||
| Software, algorithm | ViennaRNA package | doi:10.1186/1748-7188-6-26 | ||
| Software, algorithm | Transite | doi:10.1016/j.celrep.2020.108064; https://transite.mit.edu/ | ||
| Software, algorithm | REMBRANDTS | https://github.com/csglab/REMBRANDTS; Alkallas et al., 2017 | ||
| Software, algorithm | zUMI v2.9.7 | doi:10.1093/gigascience/giy059 | ||
| Chemical compound, drug | DAPI | Merck | D9542 | |
| Chemical compound, drug | Doxycycline hyclate | Merck | D9891 | |
| Chemical compound, drug | Sodium (meta)arsenite | Merck | S7400 | |
| Chemical compound, drug | Corning Matrigel hESC-Qualified Matrix | Corning | 354277 | |
| Chemical compound, drug | Puromycin dihydrochloride | Thermo Fisher Scientific | A1113803 | |
| Chemical compound, drug | Geneticin/G418 Sulfate | Thermo Fisher Scientific | 10131035 | |
| Chemical compound, drug | InSolution GSK-3 Inhibitor XVI, CHIR99021 | Merck | 361571 | |
| Chemical compound, drug | Everolimus | Abcam | ab142151 | |
| Chemical compound, drug | DMEM/F12 HEPES | Thermo Fisher Scientific | 11330–032 | |
| Chemical compound, drug | BSA | Europa Bioproducts | EQBAH-0500 | |
| Chemical compound, drug | 7.5% Sodium bicarbonate | Thermo Fisher Scientific | 25080094 | |
| Chemical compound, drug | Insulin-Transferrin- Selenium (100×) | Thermo Fisher Scientific | 41400–045 | |
| Chemical compound, drug | TGF-beta1 | R&D Systems | RD-240-B-010 | |
| Chemical compound, drug | Accutase | Merck | A6964 | |
| Chemical compound, drug | Anti-adherence rinsing solution | Stemcell Technologies | 7010 | |
| Chemical compound, drug | 10× Trypsin-EDTA | Thermo Fisher Scientific | 15400054 | |
| Chemical compound, drug | TURBO DNase (2 U/µl) | Thermo Fisher Scientific | AM2238 | |
| Chemical compound, drug | DPBS, no calcium, no magnesium (dPBS -/-) | Thermo Fisher Scientific | 14190250 | |
| Chemical compound, drug | Saponin | Merck | 47036 | |
| Chemical compound, drug | Sucrose | Merck | 84097 | |
| Chemical compound, drug | Tissue-Tek O.C.T. Compound | Sakura | 4583 | |
| Chemical compound, drug | Triton X-100 | Merck | 93420 | |
| Chemical compound, drug | Dextran Sulfate 50% Solution | Merck | S4030 | |
| Chemical compound, drug | tRNA from E. coli MRE 600 | Merck | 10109541001 | |
| Chemical compound, drug | Ribonucleoside Vanadyl Complex | New England Biolabs | S1402S | |
| Chemical compound, drug | Formamid | Merck | F9037 | |
| Chemical compound, drug | DCX probes | Stellaris | VSMF-2504–5 | |
| Chemical compound, drug | Stellaris RNA FISH wash buffer A | Stellaris | SMF-WA1-60 | |
| Chemical compound, drug | Stellaris RNA FISH wash buffer B | Stellaris | SMF-WB1-20 | |
| Chemical compound, drug | Dako Fluorescence mounting medium | Agilent | S302380-2 | |
| Chemical compound, drug | RNasin Plus Ribonuclease Inhibitor | Promega | NA2615 | |
| Chemical compound, drug | Acid-Phenol:Chloroform, pH 4.5 (with IAA, 125:24:1) | Thermo Fisher Scientific | AM9720 | |
| Chemical compound, drug | Glycoblue | Thermo Fisher Scientific | AM9515 | |
| Cell line (human) | Human embryonic stemm cell (hESC), H9, female | WiCell | WA09 | |
| Cell line (human) | Human induced pluripotent stem cell (hiPSC), Rozh-5, female | hPSCreg | WTSIi015-A | |
| Sequence-based reagent | Sox2_sgRNA-top | This paper | JS89 | CACCgGAGCGGCC CGGTGCCCGGCA |
| Sequence-based reagent | Sox2_sgRNA-bottom | This paper | JS90 | AAACTGCCGGGCAC CGGGCCGCTCc |
| Sequence-based reagent | Sox2_HAL_F | This paper | JS91 | gacggtatcgataagcttgatatcgtc gacCATGATGGAGACGGAGCTG |
| Sequence-based reagent | Sox2_HAL_R | This paper | JS92 | tccgcttccgtcgacCATGTG TGAGAGGGGCAG |
| Sequence-based reagent | P2A-EGFP_F | This paper | JS93 | cccctctcacacatgGTCGAC GGAAGCGGAGCTAC |
| Sequence-based reagent | P2A-EGFP_R | This paper | JS94 | ttcgctgtccggcccTTACTTG TACAGCTCGTCCATGC |
| Sequence-based reagent | Sox2_HAR_F | This paper | JS95 | gagctgtacaagtaaGGGCC GGACAGCGAACTG |
| Sequence-based reagent | Sox2_HAR_R | This paper | JS96 | tggagctccaccgcggtggcgggtttaaac GCAGACTGATTCAAATAATACAGAGCCG |
| Sequence-based reagent | F2DTA_F | This paper | JS56 | GTTTAAACCCGCCACCGC |
| Sequence-based reagent | F2DTA_R | This paper | JS57 | GTCGACGATATCAAGCTTATC |
| Sequence-based reagent | Sox2_PAMmut_F | This paper | JS104 | CCCGGTGCCCGGCA CAGCCATTAACGGCAC |
| Sequence-based reagent | Sox2_PAMmut_R | This paper | JS105 | GTGCCGTTAATGGCTG TGCCGGGCACCGGG |
| Sequence-based reagent | hSyn1_Gibson forward | This paper | OJAB602 | GAAAGAGAGATTTAGAATGA CAGTCTAGAGCGGATGCAT atcgatctgcagagggccctgcgtatg |
| Sequence-based reagent | hSyn1_Gibson Reverse | This paper | OJAB603 | gtcgtgcctgagagcgcagccttaagc tgcagaagttggtcgtgaggc actgggcaggtaagtatc |
| Sequence-based reagent | min_CMVpromoter_F | This paper | JS304 | ggtaggcgtgtacggtgg |
| Sequence-based reagent | 5'TOPreportergibson_R | This paper | JS305 | TCCTTAATCAGCTCGCT catggtggctagcctatagtg |
| Sequence-based reagent | gibsontagBFP_F | This paper | JS306 | TAGGCTAGCCACCATG agcgagctgattaaggag |
| Sequence-based reagent | gibsontagBFP_R | This paper | JS307 | CACTGGACTAGTGGATC CGAGCTCGGTACCTCA attaagcttgtgccccag |
| Sequence-based reagent | TSC2_sgRNA-top | This paper | JS376 | CACCGCTTTAGG GCGAGCGTTTGG |
| Sequence-based reagent | TSC2_sgRNA-bottom | This paper | JS377 | AAACCCAAACGC TCGCCCTAAAGC |
| Sequence-based reagent | TSC2_exon5_FP | This paper | JS378 | AGTGGAAGCACTCTGGAAGG |
| Sequence-based reagent | TSC2_exon5_RP | This paper | JS379 | GACGCCGAATCTACATCTCC |
| Sequence-based reagent | TSC2_exon5_seq | This paper | JS380 | CTGCCCTGTACAATGCTGATG |
| Sequence-based reagent | sox2_F | This paper | JS127 | CAGCTCGCAGACCTACATG |
| Sequence-based reagent | sox2_R | This paper | JS128 | GCACATGATGCTGGACTAG |
| Sequence-based reagent | AAVS1_F | This paper | JAB405 | tgagtccggaccactttgag |
| Sequence-based reagent | hSyn1 promoter_R | This paper | OW23 | ccgcctcatcctggtcc |
| Sequence-based reagent | WPRE_F | This paper | JS125 | gacgtccttctgctacgtc |
| Sequence-based reagent | AAVS1_R | This paper | JAB406 | cttcttggccacgtaacctg |
| Sequence-based reagent | G3BP1_genomic_F | This paper | KNO-oPT-102 | CACTCATTAGTGTTGTGACCC |
| Sequence-based reagent | APEX-N-R | This paper | KNO-oPT-103 | CTCACAGTTGGGTAAGACTTTC |
| Sequence-based reagent | Sox2 guide B | This paper | GAGCGGCCCGGTGCCCGGCA | |
| Sequence-based reagent | G3BP1 guide | This paper | TCCATGAAGATTCACTGCCG | |
| Sequence-based reagent | TSC2 guide | This paper | CTTTAGGGCGAGCGTTTGG | |
| Sequence-based reagent | RPL5_1 | Stellaris, Quasar 570 Dye | cgctagggggtgggaaaagg | |
| Sequence-based reagent | RPL5_2 | Stellaris, Quasar 570 Dye | catcctgcggaacagagacc | |
| Sequence-based reagent | RPL5_3 | Stellaris, Quasar 570 Dye | gccttattcttaacaacttt | |
| Sequence-based reagent | RPL5_4 | Stellaris, Quasar 570 Dye | cacttggtatctcttaaagt | |
| Sequence-based reagent | RPL5_5 | Stellaris, Quasar 570 Dye | cctctcgtcgtcttctaaat | |
| Sequence-based reagent | RPL5_6 | Stellaris, Quasar 570 Dye | tccgagcataataatcagtt | |
| Sequence-based reagent | RPL5_7 | Stellaris, Quasar 570 Dye | ttatcttgtatcaccaagcg | |
| Sequence-based reagent | RPL5_8 | Stellaris, Quasar 570 Dye | ctgtatttgggtgtgttgta | |
| Sequence-based reagent | RPL5_9 | Stellaris, Quasar 570 Dye | ctctgtttgtcacacgaact | |
| Sequence-based reagent | RPL5_10 | Stellaris, Quasar 570 Dye | acgggcataagcaatctgac | |
| Sequence-based reagent | RPL5_11 | Stellaris, Quasar 570 Dye | gctgcgcagactatcatatc | |
| Sequence-based reagent | RPL5_12 | Stellaris, Quasar 570 Dye | acaccatattttggcagttc | |
| Sequence-based reagent | RPL5_13 | Stellaris, Quasar 570 Dye | agcataatttgtcaggccaa | |
| Sequence-based reagent | RPL5_14 | Stellaris, Quasar 570 Dye | cagcaggccagtacaatatg | |
| Sequence-based reagent | RPL5_15 | Stellaris, Quasar 570 Dye | ccaaacctattgagaagcct | |
| Sequence-based reagent | RPL5_16 | Stellaris, Quasar 570 Dye | cttggccttcatagatcttg | |
| Sequence-based reagent | RPL5_17 | Stellaris, Quasar 570 Dye | ttgtattcatcaccagtcac | |
| Sequence-based reagent | RPL5_18 | Stellaris, Quasar 570 Dye | tggctgaccatcaatgcttt | |
| Sequence-based reagent | RPL5_19 | Stellaris, Quasar 570 Dye | tccaaatagcaggtgaaggc | |
| Sequence-based reagent | RPL5_20 | Stellaris, Quasar 570 Dye | cagtggtagttctggcaagg | |
| Sequence-based reagent | RPL5_21 | Stellaris, Quasar 570 Dye | cttcagggcaccaaaaactt | |
| Sequence-based reagent | RPL5_22 | Stellaris, Quasar 570 Dye | tgtgagggatagacaagcct | |
| Sequence-based reagent | RPL5_23 | Stellaris, Quasar 570 Dye | taaccagggaatcgtttggt | |
| Sequence-based reagent | RPL5_24 | Stellaris, Quasar 570 Dye | ctgcattaaattccttgctt | |
| Sequence-based reagent | RPL5_25 | Stellaris, Quasar 570 Dye | atgatgtgcttccgatgtac | |
| Sequence-based reagent | RPL5_26 | Stellaris, Quasar 570 Dye | gtaatctgcaacattctggc | |
| Sequence-based reagent | RPL5_27 | Stellaris, Quasar 570 Dye | tcttcttccattaagtagcg | |
| Sequence-based reagent | RPL5_28 | Stellaris, Quasar 570 Dye | actgtttcttgtaagcatct | |
| Sequence-based reagent | RPL5_29 | Stellaris, Quasar 570 Dye | ggagttacgctgttctttat | |
| Sequence-based reagent | RPL5_30 | Stellaris, Quasar 570 Dye | gagctttcttatacatctcc | |
| Sequence-based reagent | RPL5_31 | Stellaris, Quasar 570 Dye | tggattctctcgtatagcag | |
| Sequence-based reagent | RPL5_32 | Stellaris, Quasar 570 Dye | tcttgggcttcttttcatag | |
| Sequence-based reagent | RPL5_33 | Stellaris, Quasar 570 Dye | ccacctcttctttttaactt | |
| Sequence-based reagent | RPL5_34 | Stellaris, Quasar 570 Dye | tgagcaagggacattttggg | |
| Sequence-based reagent | RPL5_35 | Stellaris, Quasar 570 Dye | ttcttttgagctacccgatc | |
| Sequence-based reagent | RPL5_36 | Stellaris, Quasar 570 Dye | ctgagctctgaggaagcttg | |
| Sequence-based reagent | RPL5_37 | Stellaris, Quasar 570 Dye | aaattgctgggtttagctct | |
| Sequence-based reagent | RPL5_38 | Stellaris, Quasar 570 Dye | agttgctgttcataagttta | |
| Sequence-based reagent | RPL11_1 | Stellaris, Quasar 570 Dye | ccatgatggagagcaggaag | |
| Sequence-based reagent | RPL11_2 | Stellaris, Quasar 570 Dye | ttctccttttcaccttgatc | |
| Sequence-based reagent | RPL11_3 | Stellaris, Quasar 570 Dye | agtttgcggatgcgaagttc | |
| Sequence-based reagent | RPL11_4 | Stellaris, Quasar 570 Dye | cccaacacagatgttgagac | |
| Sequence-based reagent | RPL11_5 | Stellaris, Quasar 570 Dye | tggaaaacacaggggtctgc | |
| Sequence-based reagent | RPL11_6 | Stellaris, Quasar 570 Dye | gatctgacagtgtatctagc | |
| Sequence-based reagent | RPL11_7 | Stellaris, Quasar 570 Dye | atcttttcatttctccggat | |
| Sequence-based reagent | RPL11_8 | Stellaris, Quasar 570 Dye | tcgaactgtgcagtggacag | |
| Sequence-based reagent | RPL11_9 | Stellaris, Quasar 570 Dye | ttctccaagatttcttctgc | |
| Sequence-based reagent | RPL11_10 | Stellaris, Quasar 570 Dye | tttcttaactcatactcccg | |
| Sequence-based reagent | RPL11_11 | Stellaris, Quasar 570 Dye | tccagtatctgagaagttgt | |
| Sequence-based reagent | RPL11_12 | Stellaris, Quasar 570 Dye | cctggatcccaaaaccaaag | |
| Sequence-based reagent | RPL11_13 | Stellaris, Quasar 570 Dye | tttgatacccagatcgatgt | |
| Sequence-based reagent | RPL11_14 | Stellaris, Quasar 570 Dye | tagataccaatgcttgggtc | |
| Sequence-based reagent | RPL11_15 | Stellaris, Quasar 570 Dye | agcaccacatagaagtccag | |
| Sequence-based reagent | RPL11_16 | Stellaris, Quasar 570 Dye | tcttgtctgcgatgctgaaa | |
| Sequence-based reagent | RPL11_17 | Stellaris, Quasar 570 Dye | tctttgctgattctgtgttt | |
| Sequence-based reagent | RPL11_18 | Stellaris, Quasar 570 Dye | atgatcccatcatacttctg | |
| Sequence-based reagent | RPL11_19 | Stellaris, Quasar 570 Dye | acgggaatttatttgccagg | |
| Sequence-based reagent | RPL11_20 | Stellaris, Quasar 570 Dye | ctttttattgctcttttgga | |
| Recombinant DNA reagent | pSpCas9(BB)–2A- tomato SOX2-sgRNA | This study; Addgene | 196190 | |
| Recombinant DNA reagent | pHDR_sox2HA_P2A- GFP-pA_HA_G2913A | This study; Addgene | 196191 | |
| Recombinant DNA reagent | AAVS1 SA-2A-puro-pA_hSYN1_dTomato- SV40pA | This study; Addgene | 196192 | |
| Recombinant DNA reagent | AAVS1-Neo-TRE-CMV-5'TOPtagBFP_bGHpA -CAG rtTA | This study; Addgene | 196193 | |
| Recombinant DNA reagent | AAVS1-Neo-TRE-CMV-mutant5'TOPtagBFP _bGHpA-CAG rtTA | This study; Addgene | 196194 | |
| Recombinant DNA reagent | pSpCas9(BB)–2A-tomato-TSC2-sgRNA | This study; Addgene | 196195 | |
| Recombinant DNA reagent | pHDR_G3BP1-V5-APEX2-mScarlet-I EF1a-Puro | This study; Addgene | 196196 | |
| Recombinant DNA reagent | pSpCas9(BB)–2A -Puro G3BP1-sgRNA | This study; Addgene | 196197 |
Additional files
-
Supplementary file 1
List of Oligos used for PCRs, guide sequence cloning and RNA-FISH.
- https://cdn.elifesciences.org/articles/85135/elife-85135-supp1-v1.xlsx
-
Supplementary file 2
Summary of genomic integrity and karyotype testing of the cell lines and clones used in this study.
- https://cdn.elifesciences.org/articles/85135/elife-85135-supp2-v1.pdf
-
Supplementary file 3
Reagents and media used in the study.
- https://cdn.elifesciences.org/articles/85135/elife-85135-supp3-v1.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/85135/elife-85135-mdarchecklist1-v1.pdf
