The nutrient-sensing GCN2 signaling pathway is essential for circadian clock function by regulating histone acetylation under amino acid starvation
- State Key Laboratory of Mycology, Institute of Microbiology, Chinese Academy of Sciences, China
- College of Life Sciences, University of the Chinese Academy of Sciences, China
- School of Life Sciences, Yunnan University, Kunming, China
- Key Laboratory of Gene Engineering of the Ministry of Education, State Key Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen University, China
- MOA Key Laboratory of Soil Microbiology, College of Biological Sciences, China Agricultural University, China
- Department of Physiology, University of Texas Southwestern Medical Center, United States
Figures
Figure 1 with 2 supplements
CPC-3 and CPC-1 are required for circadian rhythm by regulating rhythmic frq transcription in response to amino acid starvation.
(A) Race tube assay showing that amino acid starvation (3-aminotriazole [3-AT] treatment) disrupted circadian conidiation rhythm of the cpc-3KO and cpc-1KO strains. 0 mM 3-AT is the normal growth …
-
Figure 1—source data 1
LumiCycle analysis dataset in Figure 1B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-data1-v2.zip
-
Figure 1—source data 2
Scan of western blot probed for FRQ protein and quantification dataset in Figure 1C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-data2-v2.zip
-
Figure 1—source data 3
Scan of Northern blot probed for frq mRNA and quantification dataset in Figure 1D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-data3-v2.zip
Figure 1—figure supplement 1
CPC-3 and CPC-1 are activated and required for robust circadian conidiation rhythm under histidine starvation.
(A) eIF2α was phosphorylated and CPC-1 was activated in WT but not cpc-3KO strain in the presence of 3 mM 3-aminotriazole (3-AT). Western blot of proteins from WT and cpc-3KO strains treated (+) or …
-
Figure 1—figure supplement 1—source data 1
Scan of western blot probed for eIF2α protein phosphorylation and CPC-1 protein in Figure 1—figure supplement 1A.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-figsupp1-data1-v2.zip
-
Figure 1—figure supplement 1—source data 2
Scan of western blot probed for CPC-1 protein in Figure 1—figure supplement 1B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-figsupp1-data2-v2.zip
Figure 1—figure supplement 2
Rhythmic frq expression of cpc-3KO and cpc-1KO strain.
(A) Luciferase reporter assay showing loss of circadian rhythm in the cpc-3KO and cpc-1KO strain with 3-aminotriazole (3-AT; raw data are shown). (B) Luciferase reporter assay showing normal …
-
Figure 1—figure supplement 2—source data 1
LumiCycle analysis dataset in Figure 1—figure supplement 2A.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-figsupp2-data1-v2.zip
-
Figure 1—figure supplement 2—source data 2
LumiCycle analysis dataset in Figure 1—figure supplement 2B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-figsupp2-data2-v2.zip
-
Figure 1—figure supplement 2—source data 3
Scan of western blot probed for FRQ protein and quantification dataset in Figure 1—figure supplement 2C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-figsupp2-data3-v2.zip
-
Figure 1—figure supplement 2—source data 4
Scan of Northern blot probed for frq mRNA and quantification dataset in Figure 1—figure supplement 2D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig1-figsupp2-data4-v2.zip
Figure 2 with 1 supplement
CPC-3 and CPC-1 are required for rhythmic WCC binding in response to amino acid starvation.
Western blot assay showing that WCC protein levels were elevated in the cpc-3KO (A) and cpc-1KO (B) strains after 3 mM 3-aminotriazole (3-AT) treatment. Protein extracts were isolated from WT, cpc-3K…
-
Figure 2—source data 1
Scan of western blot probed for WC-1 and WC-2 proteins in WT and cpc-3KO strains with 3-aminotriazole (3-AT) in Figure 2A.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig2-data1-v2.zip
-
Figure 2—source data 2
Scan of western blot probed for WC-1 and WC-2 proteins in WT and cpc-1KO strains with 3-aminotriazole (3-AT) in Figure 2B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig2-data2-v2.zip
-
Figure 2—source data 3
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 2C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig2-data3-v2.zip
-
Figure 2—source data 4
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 2D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig2-data4-v2.zip
Figure 2—figure supplement 1
WCC binding at the frq promoter and WCC phosphorylation levels in the cpc-3KO and cpc-1KO strain.
(A) Chromatin immunoprecipitation (ChIP) assay showing that deletion of cpc-3 or cpc-1 did not dramatically affect WC-2 binding at the promoter of frq gene without 3-aminotriazole (3-AT; n = 3; WT: …
-
Figure 2—figure supplement 1—source data 1
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 2—figure supplement 1A.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig2-figsupp1-data1-v2.zip
-
Figure 2—figure supplement 1—source data 2
Scan of western blot probed for phosphorylation of WC-1 and WC-2 proteins in WT and cpc-3KO strains with 3-aminotriazole (3-AT) in Figure 2—figure supplement 1B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig2-figsupp1-data2-v2.zip
-
Figure 2—figure supplement 1—source data 3
Scan of western blot probed for phosphorylation of WC-1 and WC-2 proteins in WT and cpc-1KO strains with 3-aminotriazole (3-AT) in Figure 2—figure supplement 1C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig2-figsupp1-data3-v2.zip
-
Figure 2—figure supplement 1—source data 4
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 2—figure supplement 1D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig2-figsupp1-data4-v2.zip
Figure 3
CPC-1 is required for the maintenance of chromatin structure in response to amino acid starvation.
Chromatin immunoprecipitation (ChIP) assay showing that amino acid starvation slightly increased histone H2B levels (A) and dramatically decreased histone H3ac levels (B) at the promoter of frq gene …
-
Figure 3—source data 1
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 3A.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig3-data1-v2.zip
-
Figure 3—source data 2
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 3B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig3-data2-v2.zip
-
Figure 3—source data 3
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 3C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig3-data3-v2.zip
-
Figure 3—source data 4
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 3D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig3-data4-v2.zip
Figure 4 with 1 supplement
CPC-1 recruits GCN-5 to activate frq transcription in response to amino acid starvation.
(A) Chromatin immunoprecipitation (ChIP) assay showing that CPC-1 rhythmically bound at the promoter of frq gene (n = 3; WT: p = 8.37E−06, cpc-1KO: p > 0.05). WT and cpc-1KO strains grown for the …
-
Figure 4—source data 1
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 4A.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig4-data1-v2.zip
-
Figure 4—source data 2
Scan of western blot probed for Flag.ADA-2 and Myc.GCN-5 proteins in Figure 4B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig4-data2-v2.zip
-
Figure 4—source data 3
Scan of western blot probed for Flag.ADA-2 and Myc.CPC-1 proteins in Figure 4C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig4-data3-v2.zip
-
Figure 4—source data 4
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 4D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig4-data4-v2.zip
Figure 4—figure supplement 1
CPC-1 rhythmically binds at the frq promoter and GCN-5 interacts with WCC.
(A) Chromatin immunoprecipitation (ChIP) assay showing that CPC-1 rhythmically bound at the promoter of frq gene with 3 mM 3-aminotriazole (3-AT) (n = 3; WT: p = 7.64E−05). WT and cpc-1KO strains …
-
Figure 4—figure supplement 1—source data 1
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 4—figure supplement 1A.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig4-figsupp1-data1-v2.zip
-
Figure 4—figure supplement 1—source data 2
Scan of western blot probed for Myc.CPC-1, WC-1, and WC-2 proteins in Figure 4—figure supplement 1B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig4-figsupp1-data2-v2.zip
-
Figure 4—figure supplement 1—source data 3
Scan of western blot probed for Myc.GCN-5, WC-1, and WC-2 proteins in Figure 4—figure supplement 1C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig4-figsupp1-data3-v2.zip
Figure 5 with 1 supplement
GCN-5 is required for rhythmic chromatin structure changes at the frq promoter.
(A) Race tube assay showing that the conidiation rhythm in gcn-5KO strain was lost compared with WT strain. (B) Luciferase assay showing that the luciferase activity rhythm was impaired in the gcn-5K…
-
Figure 5—source data 1
LumiCycle analysis dataset in Figure 5B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-data1-v2.zip
-
Figure 5—source data 2
Scan of western blot probed for FRQ protein and quantification dataset in Figure 5C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-data2-v2.zip
-
Figure 5—source data 3
RT-qPCR analysis dataset in Figure 5D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-data3-v2.zip
-
Figure 5—source data 4
RT-qPCR analysis dataset in Figure 5E.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-data4-v2.zip
-
Figure 5—source data 5
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 5F.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-data5-v2.zip
-
Figure 5—source data 6
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 5G.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-data6-v2.zip
Figure 5—figure supplement 1
ADA-2 is required for circadian rhythm by regulating rhythmic frq expression.
(A) Race tube assay showing that the conidiation rhythm in ada-2KO strains was lost compared with WT strains. (B) Luciferase assay showing that the luciferase activity rhythm was impaired in the gcn-…
-
Figure 5—figure supplement 1—source data 1
LumiCycle analysis dataset in Figure 5—figure supplement 1B.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-figsupp1-data1-v2.zip
-
Figure 5—figure supplement 1—source data 2
LumiCycle analysis dataset in Figure 5—figure supplement 1C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-figsupp1-data2-v2.zip
-
Figure 5—figure supplement 1—source data 3
Scan of western blot probed for FRQ protein and quantification dataset in Figure 5—figure supplement 1D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-figsupp1-data3-v2.zip
-
Figure 5—figure supplement 1—source data 4
Quantification of Northern blot dataset in Figure 5—figure supplement 1E.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-figsupp1-data4-v2.zip
-
Figure 5—figure supplement 1—source data 5
Quantification of Northern blot dataset in Figure 5—figure supplement 1F.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig5-figsupp1-data5-v2.zip
Figure 6
Elevated histone acetylation partially rescues impaired circadian rhythm caused by amino acid starvation stress.
(A) Race tube assay showing that high concentrations of 3-aminotriazole (3-AT) treatment elongated circadian conidiation period of WT strain. (B) Race tube assay showing that the high concentrations …
-
Figure 6—source data 1
RT-qPCR analysis dataset in Figure 6D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig6-data1-v2.zip
Figure 7 with 1 supplement
Circadian clock control of CPC-1-activated metabolic genes under amino acid starvation.
(A) Comparison of the transcript expression profiles of the WT strains with and without 12 mM 3-aminotriazole (3-AT) treatment. (B) Gene functional enrichment analysis based on the mRNA levels …
-
Figure 7—source data 1
Raw dataset of RNA-seq analysis in Figure 7A.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig7-data1-v2.zip
-
Figure 7—source data 2
Raw dataset of RNA-seq analysis in Figure 7C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig7-data2-v2.zip
-
Figure 7—source data 3
RT-qPCR analysis dataset in Figure 7F.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig7-data3-v2.zip
Figure 7—figure supplement 1
CPC-1 regulated metabolic genes under amino acid starvation.
(A) Pie charts showing the overlaps of downregulated genes in the WT strain, but unchanged genes in the cpc-1KO strains. (B) Gene functional enrichment analysis based on the mRNA levels changes for …
-
Figure 7—figure supplement 1—source data 1
Chromatin immunoprecipitation (ChIP) analysis dataset in Figure 7—figure supplement 1C.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig7-figsupp1-data1-v2.zip
-
Figure 7—figure supplement 1—source data 2
RT-qPCR analysis dataset in Figure 7—figure supplement 1D.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig7-figsupp1-data2-v2.zip
-
Figure 7—figure supplement 1—source data 3
RT-qPCR analysis dataset in Figure 7—figure supplement 1E.
- https://cdn.elifesciences.org/articles/85241/elife-85241-fig7-figsupp1-data3-v2.zip
Figure 8
Model showing the role of CPC-3 and CPC-1 in maintaining the Neurospora circadian rhythm in response to amino acid starvation.
Under normal conditions, CPC-1 is expressed at its basal levels in the WT (Left) or cpc-3KO (Right) strain, which is required for rhythmic expression of frq gene by recruiting the histone …
Author response image 1
Author response image 2
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Neurospora crassa) | 87-3 (ras-1bd, a) | Dr.Yi Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | 301-6 (ras-1bd, his-3-, A) | Dr.Yi Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | ras-1bd;cpc-3KO | Fungal Genetics Stock Center | NCU01187 | |
| Strain, strain background (Neurospora crassa) | ras-1bd;cpc-1KO | Fungal Genetics Stock Center | NCU04050 | |
| Strain, strain background (Neurospora crassa) | ras-1bd;gcn-5KO | Fungal Genetics Stock Center | NCU10847 | |
| Strain, strain background (Neurospora crassa) | ras-1bd;ada-2KO | Fungal Genetics Stock Center | NCU04459 | |
| Strain, strain background (Neurospora crassa) | ras-1bd;hda-1KO | Fungal Genetics Stock Center | NCU01525 | |
| Strain, strain background (Neurospora crassa) | ras-1bd;cpc-1KO, cpc-1-Myc.CPC-1 | Dr.Xiao Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | 301-6, cfp-Myc.CPC-1, cfp-Flag.ADA-2 | Dr.Xiao Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | 301-6, cfp-Myc.GCN-5, cfp-Flag.ADA-2 | Dr.Xiao Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | frq-luc | Dr.Yi Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | ras-1bd;cpc-3KO, frq-luc | Dr.Xiao Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | ras-1bd;cpc-1KO, frq-luc | Dr.Xiao Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | FRQ-LUC | Dr. Luis Larrondo’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | ras-1bd;gcn-5KO, FRQ-LUC | Dr.Xiao Liu’s Laboratory | ||
| Strain, strain background (Neurospora crassa) | ras-1bd;ada-2KO, FRQ-LUC | Dr.Xiao Liu’s Laboratory | ||
| Antibody | Rabbit polyclonal anti-Histone H2B | Abcam | Cat# ab1790 | 1:3000 |
| Antibody | Rabbit polyclonal anti-Histone H3ac | Millipore | Cat# 06-599 | 1:3000 |
| Antibody | Mouse monoclonal anti-c-Myc | TransGen | Cat# HT101 | 1:3000 |
| Antibody | Mouse monoclonal anti-Flag | Sigma | Cat# F1804 | 1:3000 |
| Antibody | Rabbit polyclonal anti-P-eIF2α | Abcam | Cat# ab32157 | 1:3000 |
| Antibody | Rabbit polyclonal anti-CPC-1 | Dr.Xiao Liu’s Laboratory | 1:3000 | |
| Antibody | Rabbit polyclonal anti-FRQ | Dr.Yi Liu’s Laboratory | 1:3000 | |
| Antibody | Rabbit polyclonal anti-WC-1 | Dr.Yi Liu’s Laboratory | 1:4000 | |
| Antibody | Rabbit polyclonal anti-WC-2 | Dr.Yi Liu’s Laboratory | 1:8000 | |
| Sequence-based reagent | frq-F | Dr.Xiao Liu’s Laboratory | RT-qPCR | GCAGTGTCATTGACGACTTG |
| Sequence-based reagent | frq-R | Dr.Xiao Liu’s Laboratory | RT-qPCR | CCTCCAACTCACGTTTCTTTC |
| Sequence-based reagent | his-3-F | Dr.Xiao Liu’s Laboratory | RT-qPCR | CCTCGTTCGTCAAGCACATTA |
| Sequence-based reagent | his-3-R | Dr.Xiao Liu’s Laboratory | RT-qPCR | CTCCTCAACCTTAGCCAACTG |
| Sequence-based reagent | trp-3-F | Dr.Xiao Liu’s Laboratory | RT-qPCR | ACCTATATCCTTCAGAACCAATACG |
| Sequence-based reagent | trp-3-R | Dr.Xiao Liu’s Laboratory | RT-qPCR | GCTCGGTATCCTTCCAGTTG |
| Sequence-based reagent | ser-2-F | Dr.Xiao Liu’s Laboratory | RT-qPCR | GCTGCTAACGGTGACTACTT |
| Sequence-based reagent | ser-2-R | Dr.Xiao Liu’s Laboratory | RT-qPCR | GGTGAGGATGATGTTGTTGAG |
| Sequence-based reagent | arg-1-F | Dr.Xiao Liu’s Laboratory | RT-qPCR | CCCATCATTGCCCGTGCCC |
| Sequence-based reagent | arg-1-R | Dr.Xiao Liu’s Laboratory | RT-qPCR | TGACGACCCTGGAAGCGAG |
| Sequence-based reagent | β-tubulin-F | Dr.Xiao Liu’s Laboratory | RT-qPCR | GCGTATCGGCGAGCAGTT |
| Sequence-based reagent | β-tubulin-R | Dr.Xiao Liu’s Laboratory | RT-qPCR | CCTCACCAGTGTACCAATGCA |
| Sequence-based reagent | frq C-box-F | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | GTCAAGCTCGTACCCACATC |
| Sequence-based reagent | frq C-box-R | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | CCGAAAGTATCTTGAGCCTCC |
| Sequence-based reagent | frq promoter-F | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | GTTGCCGTGACTCCCCCTTG |
| Sequence-based reagent | frq promoter-R | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | CCGAAAGTATCTTGAGCCTCC |
| Sequence-based reagent | his-3 ChIP-F | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | TTTTCATAAAGCCCGAGTCT |
| Sequence-based reagent | his-3 ChIP-R | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | CAGGTATTGTGCTGTTCCCC |
| Sequence-based reagent | trp-3 ChIP-F | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | AATCGGGTGAGTCAAAGGCG |
| Sequence-based reagent | trp-3 ChIP-R | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | CGAGCAAGAGGGAGAGGTGT |
| Sequence-based reagent | ser-2 ChIP-F | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | GGGACAAAAGCAGTGATTCTA |
| Sequence-based reagent | ser-2 ChIP-R | Dr.Xiao Liu’s Laboratory | ChIP-qPCR | CGATTTACATCCATCTGAGA |
| Sequence-based reagent | frq northern-F | Dr.Xiao Liu’s Laboratory | Northern blot | TAATACGACTCACTATAGGGCCTTCGTTGGATATCCATCATG |
| Sequence-based reagent | frq northern-R | Dr.Xiao Liu’s Laboratory | Northern blot | GAATTCTTGCAGGGAAGCCGG |
| Software, algorithm | ImageJ | https://imagej.nih.gov/ij/ | ||
| Software, algorithm | LumiCycle | https://actimetrics.com/products/lumicycle/ | ||
| Software, algorithm | CircaCompare | https://github.com/RWParsons/circacompare/; Parsons et al., 2020 |
Additional files
-
MDAR checklist
- https://cdn.elifesciences.org/articles/85241/elife-85241-mdarchecklist1-v2.pdf
-
Supplementary file 1
Analyses of CPC-1 regulated genes.
- https://cdn.elifesciences.org/articles/85241/elife-85241-supp1-v2.xlsx
-
Supplementary file 2
Analyses of rhythmic datasets by CircaCompare.
- https://cdn.elifesciences.org/articles/85241/elife-85241-supp2-v2.xlsx
