1. Immunology and Inflammation
  2. Neuroscience

Cystatin F (Cst7) drives sex-dependent changes in microglia in an amyloid-driven model of Alzheimer’s disease

  1. Michael JD Daniels  Is a corresponding author
  2. Lucas Lefevre
  3. Stefan Szymkowiak
  4. Alice Drake
  5. Laura McCulloch
  6. Makis Tzioras
  7. Jack Barrington
  8. Owen R Dando
  9. Xin He
  10. Mehreen Mohammad
  11. Hiroki Sasaguri
  12. Takashi Saito
  13. Takaomi C Saido
  14. Tara L Spires-Jones
  15. Barry W McColl  Is a corresponding author
  1. UK Dementia Research Institute at The University of Edinburgh, United Kingdom
  2. Centre for Inflammation Research, Institute for Regeneration and Repair, The University of Edinburgh, United Kingdom
  3. Simons Initiative for the Developing Brain, University of Edinburgh, United Kingdom
  4. Department of Neurology and Neurological Science, Graduate School of Medicine, Tokyo Medical and Dental University, Japan
  5. Laboratory for Proteolytic Neuroscience, RIKEN Brain Science Institute, Japan
  6. Department of Neuroscience and Pathobiology, Research Institute of Environmental Medicine, Nagoya University, Japan
  7. Department of Neurocognitive Science, Institute of Brain Science, Nagoya City University Graduate School of Medical Sciences, Japan
https://doi.org/10.7554/eLife.85279
Share this article
Cite this article
  1. Michael JD Daniels
  2. Lucas Lefevre
  3. Stefan Szymkowiak
  4. Alice Drake
  5. Laura McCulloch
  6. Makis Tzioras
  7. Jack Barrington
  8. Owen R Dando
  9. Xin He
  10. Mehreen Mohammad
  11. Hiroki Sasaguri
  12. Takashi Saito
  13. Takaomi C Saido
  14. Tara L Spires-Jones
  15. Barry W McColl
(2023)
Cystatin F (Cst7) drives sex-dependent changes in microglia in an amyloid-driven model of Alzheimer’s disease
eLife 12:e85279.
https://doi.org/10.7554/eLife.85279
  2. Download BibTeX
  3. Download .RIS
7 figures, 4 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
Cst7/cystatin F is upregulated in microglia in murine models of Alzheimer’s disease (AD).

(A) Analysis of publicly available microglial RNASeq databases for Cst7 expression in amyloid-driven models. Background-matched control (grey) or relevant disease model (blue). (B) Brightfield slide-scanned images of wild-type (left) and AppNL-G-F (right) sagittal brain sections stained by in situ hybridisation for Cst7 (red). (C) Example image from Cst7 fluorescence in situ hybridisation (FISH) experiment stained with IBA1 (green), 6E10 (magenta), and Cst7 (cyan). (D) Quantification of (C) showing % Cst7+ area in areas within 25 µm (blue) of 6E10+ plaques or outside (grey). (E) Hi-mag confocal microscopy maximum intensity projection showing co-localisation of Cst7 with IBA1 around plaques. (F) Quantification of (E) showing % Cst7 overlap with IBA1. n=3–7. **p<0.01, ***p<0.001 by unpaired t-test or two-way ANOVA with Tukey’s multiple comparisons post hoc test. #p<0.05 by paired t-test. Scale bars are 20 µm.

Figure 1—source data 1

Source data associated with Figure 1.

(D) Quantification of (C) showing % Cst7+ area in areas within 25 µm of 6E10+ plaques or outside. (F) Quantification of (E) showing % Cst7 overlap with IBA1.

https://cdn.elifesciences.org/articles/85279/elife-85279-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
Download asset Open asset
Investigating expression of Cst7.

(A) Sub-set analysis of activated response microglia (ARM) cluster from Sala-Frigerio et al. expression of genes in females vs. males. Selected genes annotated. (B–D) Cst7 expression from published datasets. Data plotted using web tools on https://www.brainrnaseq.org/ (B), https://singlecell.broadinstitute.org (C), and https://www.brainimmuneatlas.org/ (D).

Figure 2 with 3 supplements
Download asset Open asset
Cst7 deletion leads to sex-dependent transcriptomic changes in microglia in the AppNL-G-F model of amyloid-driven Alzheimer’s disease (AD).

(A) Study design schematic. (B) Differentially expressed genes (DEGs) between wild-type and AppNL-G-F microglia in male and female mice. (C) Volcano plot of RNASeq from wild-type vs. AppNL-G-F female microglia. Points in red are significantly upregulated in disease. Points in blue are significantly downregulated. Selected genes are annotated. (D) Volcano plot of RNASeq from wild-type vs. AppNL-G-FCst7+/+ male microglia. (E) Volcano plot of RNASeq from female AppNL-G-FCst7+/+ vs. AppNL-G-FCst7-/- microglia. Points in red are significantly upregulated in AppNL-G-FCst7-/-. Points in blue are significantly downregulated. Selected genes are annotated. (F) Selected GO:BP (Gene Ontology:biological process) terms that are significantly enriched in the upregulated genes from (E) and corresponding significance p-value. (G) Volcano plot of RNASeq from male AppNL-G-FCst7+/+ vs. AppNL-G-FCst7-/- microglia. (H) Selected GO:BP terms that are significantly enriched in the upregulated genes from (G) and corresponding significance p-value. (I and J) Example gene expression (fpkm) from RNASeq of microglia isolated from male and female wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. Selected genes are Lilrb4 (I) and Cxcl2 (J).

Figure 2—source data 1

Source data associated with Figure 2.

(I and J) Example gene expression (fpkm) from RNASeq of microglia isolated from male and female wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. Selected genes are Lilrb4 (I) and Cxcl2 (J).

https://cdn.elifesciences.org/articles/85279/elife-85279-fig2-data1-v2.xlsx
Figure 2—source data 2

Differentially expressed genes (DEGs) between male and female AppNL-G-F and AppNL-G-FCst7-/- mice (selected genes in bold).

https://cdn.elifesciences.org/articles/85279/elife-85279-fig2-data2-v2.docx
Figure 2—figure supplement 1
Download asset Open asset
Gating strategy for microglia fluorescence-activated cell sorting (FACS).

Microglia/BAMs were defined as single cells, Zombie NIR- live cells, CD11b+CD45+ myeloid cells, Ly6C- microglia/BAMs. Phenotypic markers MHCII and CD11c were also tested. All gates were set using fluorescence minus one (FMO) controls.

Figure 2—figure supplement 2
Download asset Open asset
Gene expression from RNASeq data.

(A) Example expression (fpkm) of Cst7 from RNASeq of microglia isolated from male and female wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. (B) Venn diagram showing differentially expressed genes (DEGs) in AppNL-G-F microglia that are male only (left), shared between male and female (middle), or female only (right). (C) Venn diagram showing DEGs in Cst7-/- microglia that are male only (left), shared between male and female (middle), or female only (right). (D) DEGs in male vs. female AppNL-G-F or AppNL-G-FCst7-/- mice. (E) Example image from Lilrb4a fluorescence in situ hybridisation (FISH) experiment stained with IBA1 (green), 6E10 (magenta), and Lilrb4a (cyan) showing co-localisation of Lilrb4a with IBA1 around plaques. (F) Quantification of (E) showing Lilrb4a expression in IBA1+ cells in male and female AppNL-G-F and AppNL-G-FCst7-/- brains. n=6. *p<0.05 by two-way ANOVA with Sidak’s multiple comparisons post hoc test.

Figure 2—figure supplement 3
Download asset Open asset
Gene expression from RNASeq data compared to qPCR from naïve (non-diseased) mice.

(A) Expression (fpkm) of Lilrb4a and Il1b from RNASeq of wild-type (grey), AppNL-G-F (blue), or AppNL-G-FCst7-/- (red) microglia from male and female mice. (B) Relative expression (ddCt vs. mean of male wild-type) of Lilrb4a and Il1b from naïve (non-diseased) wild-type (grey) and Cst7-/- (red) microglia. n=3–4. Analysed by DESeq2 (A) or by two-way ANOVA with Sidak’s multiple comparisons post hoc test (B).

Figure 3 with 1 supplement
Download asset Open asset
Cst7 deletion leads to region and sex-dependent changes in lysosomes in AppNL-G-F mice.

(A) Example images from male and female wild-type and AppNL-G-F cortex stained with IBA1 (green), 6E10 (magenta), and LAMP2 (cyan). (B–D) IBA1 % coverage from images taken of wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- brains in cortex (B), hippocampus (C), and dorsal subiculum (D). (E) Example images from AppNL-G-FCst7+/+ and AppNL-G-FCst7-/- subicula in male and female mice. Top panel shows LAMP2 (cyan) and bottom panel shows IBA1 (green), 6E10 (magenta), and LAMP2 (cyan) merge. Scale bars are 50 μm. (F–H) Ratio of IBA1/LAMP2 double positive staining vs. IBA1 total staining in the cortex (F), hippocampus (G), and dorsal subiculum (H) of wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. (I and J) Example images from the cortex (I) and subiculum (J) of an AppNL-G-F mouse stained with 6E10 (magenta) and MeX04 (white). (K) Ratio of MeX04 total staining vs. 6E10 total staining in cortex (blue), hippocampus (red), and subiculum (green) of male and female AppNL-G-F mice. Scale bars are 50 μm. Data points are average from 2 fields of view/mouse (1 for subiculum) and bars are plotted as mean + SEM. n=5–12. *p<0.05, **p<0.01, ***p<0.001 by two-way ANOVA with Tukey’s multiple comparisons post hoc test.

Figure 3—source data 1

Source data associated with Figure 3.

(B–D) IBA1 % coverage from images taken of wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- brains in cortex (B), hippocampus (C), and dorsal subiculum (D). (F–H) Ratio of IBA1/LAMP2 double positive staining vs. IBA1 total staining in the cortex (F), hippocampus (G), and dorsal subiculum (H) of wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. (K) Ratio of MeX04 total staining vs. 6E10 total staining in cortex (blue), hippocampus (red), and subiculum (green) of male and female AppNL-G-F mice.

https://cdn.elifesciences.org/articles/85279/elife-85279-fig3-data1-v2.xlsx
Figure 3—figure supplement 1
Download asset Open asset
Immunohistochemistry supplementary information.

(A) Whole slide scan of an AppNL-G-F brain stained with 6E10 (red) and MeX04 (white) to illustrate regions of interest taken for analysis. Example regions are cortex (blue square), hippocampus (red square), and subiculum (green square). (B–D) % 6E10 burden in cortex (B), hippocampus (C), and subiculum (D) of male and female wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. (E) % LAMP2 burden vs. % IBA1 burden scatter plot from all mice in study with linear regression. n=5–12. ***p<0.001 by two-way ANOVA with Tukey’s multiple comparisons post hoc test.

Figure 4 with 1 supplement
Download asset Open asset
Cst7 regulates microglial Aβ burden in female AppNL-G-F mice.

(A) Study design schematic. (B) % MeX04+ microglia of total microglia in male and female wild-type (grey), AppNL-G-FCst7+/+ (blue), and AppNL-G-FCst7-/- (red) brains. (C) Median fluorescence intensity (MFI) of MeX04 in microglia. (D) MFI of CD45 on microglia. (E) % CD11c+ microglia of total microglia. (F) % MHC-II+ microglia of total microglia. (G) MFI of P2Y12 on microglia. Bars are plotted as mean + SEM. n=5–12. *p<0.05, **p<0.01, ***p<0.001 by two-way ANOVA with Sidak’s multiple comparisons post hoc test.

Figure 4—source data 1

Source data associated with Figure 4.

(B) % MeX04+ microglia of total microglia in male and female wild-type (grey), AppNL-G-FCst7+/+ (blue), and AppNL-G-FCst7-/- (red) brains. (C) Median fluorescence intensity (MFI) of MeX04 in microglia. (D) MFI of CD45 on microglia. (E) % CD11c+ microglia of total microglia. (F) % MHC-II+ microglia of total microglia. (G) MFI of P2Y12 on microglia.

https://cdn.elifesciences.org/articles/85279/elife-85279-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Download asset Open asset
Validating MeX04 to measure Aβ-containing microglia.

Fluorescence-activated cell sorting (FACS) plots of microglia gated by MeX04 and SSC-A. Plots show data from a wild-type mouse injected with MeX04 (left), an aged AppNL-G-F mouse injected with vehicle (middle), and an aged AppNL-G-F mouse injected with MeX04 (right).

Figure 5 with 4 supplements
Download asset Open asset
Cst7 negatively regulates phagocytosis in microglia from female AppNL-G-F mice.

(A) Study design schematic. (B–C) qPCR data for Cst7 (B) and Tmem119 (C) RNA expression from female wild-type and AppNL-G-F microglia isolated by CD11b beads and cultured for 3 days in vitro. Bars represent mean fold change calculated by ΔΔCt. n=4. *p<0.05, ***p<0.001 by two-way t-test. (D–E) Cathepsin L (D) and C (E) activity from female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) microglia measured by probe-based assay. Bars represent mean relative fluorescence units (RFU) + SEM. n=4–5. (F) Example images from myelin phagocytosis assays with female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) microglia taken immediately before (t=0) and 2 hr 45 min after (t=2 hr 45 min) addition of pHrodo-tagged myelin. (G) Quantification of (F). Data shown are mean RFU (calculated as total integrated intensity of pHrodo Red normalised to cell confluence) ± SEM. n=4. *p<0.05 calculated by unpaired t-test on area under curve (AUC) of data.

Figure 5—source data 1

Source data associated with Figure 5.

(B–C) qPCR data for Cst7 (B) and Tmem119 (C) RNA expression from female wild-type and AppNL-G-F microglia isolated by CD11b beads and cultured for 3 days in vitro. (D–E) Cathepsin L (D) and C (E) activity from female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) microglia measured by probe-based assay. (G) Quantification of myelin phagocytosis assays with female AppNL-G-FCst7+/+ and AppNL-G-FCst7-/- microglia taken immediately before (t=0) and 2 hr 45 min after (t=2 hr 45 min) addition of pHrodo-tagged myelin.

https://cdn.elifesciences.org/articles/85279/elife-85279-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
Download asset Open asset
Investigating Cst7 knockout in vitro.

(A–D) Uptake of various tagged substrates from male (solid lines/symbols) and female (dotted lines/symbols) wild-type (black) and Cst7-/- (red) microglia. Substrates tested were HiLyte647-tagged Aβ1-42(A), pHrodo-tagged myelin (B), pHrodo-tagged S. aureus (C), and pHrodo-tagged human Alzheimer’s disease (AD) synaptoneurosomes (D). (E) Uptake and degradation of HiLyte647-tagged Aβ1-42 from male (solid lines/symbols) and female (dotted lines/symbols) wild-type (black) and Cst7-/- (red) microglia and microglia treated with pan-cathepsin inhibitor K777 (10 µM, blue lines/symbols). (F) Lysosomal proteolysis measured by de-quenching of DQ-BSA from male (solid lines/symbols) and female (dotted lines/symbols) wild-type (black) and Cst7-/- (red) microglia and microglia treated with pan-cathepsin inhibitor K777 (10 µM, blue lines/symbols). Data are mean signal measured by relative fluorescence units (RFU) ± SEM. n=4. All statistics were p>0.05 calculated by one-way ANOVA on area under curve (AUC) of data with Dunnett’s multiple comparison’s test. (G–I) qPCR data showing gene expression (relative to wild-type untreated) of male wild-type (black) and Cst7-/- (red) microglia stimulated with LPS (100 ng/mL, 24 hr), IL-4 (20 ng/mL, 24 hr) or apoptotic SH-SH5Y cells (2:1 ratio, 24 hr). Genes tested were Arg1 (G), Il1b (H), and Trem2 (I). (K and J) IL-1β secretion from male wild-type (black) and Cst7-/- (red) microglia treated with LPS (1 µg/mL, 4 hr) or LPS+silica (varying dose, 4 hr (K) or 300 µg/mL, varying time (J)) to activate the NLRP3 inflammasome. Data are mean secretion/expression + SEM. n=4.

Figure 5—figure supplement 2
Download asset Open asset
Investigating Cst7 knockout on microglial cytokine secretion.

Multiplex bead-based ELISA data from male wild-type (black) and Cst7-/- (red) microglia stimulated with LPS (100 ng/mL, 24 hr) or IL-4 (20 ng/mL, 24 hr). Data are mean ± SEM. n=4.

Figure 5—figure supplement 3
Download asset Open asset
Investigating Cst7 knockdown in BV-2 cells vitro.

(A) qPCR data of Cst7 expression in BV-2 cells treated with scrambled control siRNA (black) or siRNA targeting Cst7 (red). (B) IL-6 secretion from BV-2 cells treated with scrambled control siRNA (black) or siRNA targeting Cst7 (red) following stimulation with LPS (100 ng/mL, 24 hr) or IL-4 (20 ng/mL, 24 hr). (C–E) qPCR data of gene expression in BV-2 cells treated with scrambled control siRNA (black) or siRNA targeting Cst7 (red) before stimulation with LPS (100 ng/mL, 24 hr) or IL-4 (20 ng/mL, 24 hr). Genes tested were Arg1 (C), Il1b (D), and Trem2 (E). Data are shown as mean + SEM. n=5. **p<0.01 by one-sample t-test against hypothetical value of 100.

Figure 5—figure supplement 4
Download asset Open asset
Investigating Cst7 knockout from AppNL-G-F mice in vitro.

(A) Yield of isolated microglia from AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) mice. (B) IL-6 secretion from AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) cultured microglia treated with LPS (100 ng/mL, 24 hr). (C) IL-1β secretion from AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) cultured microglia treated with LPS (100 ng/mL, 24 hr) or LPS (1 µg/mL, 4 hr)+silica (300 µg/mL, 4 hr) to activate the NLRP3 inflammasome. (D) TNFα secretion from AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) cultured microglia treated with LPS (100 ng/mL, 24 hr). Data are presented as mean cytokine concentration in pg/mL + SEM. (E) Uptake and degradation of HiLyte647-tagged Aβ1-42 from female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) cultured microglia. (F) Uptake and degradation of HiLyte647-tagged Aβ1-42 from BV-2 cells treated with vehicle (0.5% DMSO, black), K777 (10 µM, green), or Ca074Me (100 µM, orange). (G) Lysosomal proteolysis measured by de-quenching of DQ-BSA from female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) cultured microglia. (H) Uptake of HiLyte647-tagged Aβ1-42 from female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) cultured microglia. Data are shown as mean ± SEM. n=4–5. ***p<0.001 calculated by one-way ANOVA on area under curve (AUC) of data with Dunnett’s multiple comparison’s test.

Figure 6 with 1 supplement
Download asset Open asset
Investigating the effect of Cst7 deletion on disease pathology.

(A) % Aβ coverage measured by 6E10 3,3'-diaminobenzidine (DAB) staining in cortex (blue), hippocampus (red), subiculum (green), cerebellum (magenta), and whole brain (grey) of male and female AppNL-G-F brains. (B–F) % Aβ coverage in the cortex (B), hippocampus (C), subiculum (D), cerebellum (E), and whole brain (F) of male and female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) mice. Points are measured by thresholding of whole region area in sagittal section. Bars represent mean + SEM % coverage. n=10–12. *p<0.05, **p<0.01 calculated by two-way ANOVA with Sidak’s multiple comparisons post hoc test. (G) Example images from subicula of female AppNL-G-FCst7+/+ (left) and AppNL-G-FCst7-/- (right) mice stained with MeX04 (blue). Scale bars are 50 μm. (H) Quantification of (G). MeX04+ plaque count in the subicula of female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) mice. Points are number of plaques from a single field of view for each mouse. Bars are mean plaque count + SEM. n=10–12. $p<0.05 calculated by two-way Mann-Whitney test. (I) Example image of a plaque with Thio S (blue) and synapses stained with synaptophysin (red) in AppNL-G-F brain. Plaque border is highlighted in yellow. (J) Quantification of (I) measuring coverage of synaptophysin. Bars represent mean + SEM % coverage. n=5–12. *p<0.05 calculated by two-way ANOVA with Tukey’s multiple comparisons post hoc test.

Figure 6—source data 1

Source data associated with Figure 6.

(A) % Aβ coverage measured by 6E10 3,3'-diaminobenzidine (DAB) staining in cortex, hippocampus, subiculum, cerebellum, and whole brain of male and female AppNL-G-F brains. (B–F) % Aβ coverage in the cortex (B), hippocampus (C), subiculum (D), cerebellum (E), and whole brain (F) of male and female AppNL-G-FCst7+/+ and AppNL-G-FCst7-/- mice. Points are measured by thresholding of whole region area in sagittal section. (H) Quantification of MeX04+ plaque count in the subicula of female AppNL-G-FCst7+/+ and AppNL-G-FCst7-/-. (J) Quantification of % coverage of synaptophysin in the cortex of male and female wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- brains.

https://cdn.elifesciences.org/articles/85279/elife-85279-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
Download asset Open asset
Investigating the role of Cst7 in plaque burden.

Area of MeX04+ plaques in the subiculum of male and female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) brains. Bars are mean plaque area + SEM. n=10–12.

Author response image 1
Download asset Open asset

Tables

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Genetic reagent (Mus musculus)AppNL-G-FDOI:10.1038/nn.3697
Genetic reagent (Mus musculus)Cst7-/-DOI:10.1016/j.immuni.2016.03.003
Cell line (Mus musculus)BV2CollaboratorRRID: CVCL_0182Authenticated (STR profiling)
Cell line (Homo sapiens)SH-SY5YCollaboratorRRID: CVCL_0019Authenticated (STR profiling)
Biological sample (Homo sapiens)Synaptoneurosome from AD brainDOI:10.1016/j.xcrm.2023.101175AMREC (approval number 15-HV-016)
Biological sample (Mus musculus)Purified myelinThis paperSee Materials and methods ‘Myelin purification and pHrodo tagging’
AntibodyAnti-Ly6C- Alexa Fluor 488
(Rat monoclonal)		BioLegendCat# 128021FACS 1:500
AntibodyAnti-P2Y12 – PE
(Rat monoclonal)		BioLegendCat# 848003FACS 1:200
AntibodyAnti-MHCII – PEDazzle594
(Rat monoclonal)		BioLegendCat# 107647FACS 1:200
AntibodyAnti-CD45 – PE-Cy7
(Rat monoclonal)		BioLegendCat# 103113FACS 1:200
AntibodyAnti- CD11c – APC
(Armenian Hamster monoclonal)		BioLegendCat# 117309FACS 1:200
AntibodyAnti- CD11b – BV711
(Rat monoclonal)		BioLegendCat# 848003FACS 1:50
AntibodyAnti-IBA1 (Rabbit polyclonal)WakoCat# 019-19741IF 1:2000
AntibodyAnti- Aβ (6E10) (Mouse monoclonal)BioLegendCat# 803001IF/DAB 1:1000
AntibodyAnti-LAMP2 (Rat monoclonal)BioLegendCat# 108501IF 1:200
AntibodyAnti-Synaptophysin (Sy38) (Mouse monoclonal)Abcamab8049IF 1:200
AntibodyAnti-rabbit IgG Alexa Fluor 488
(Goat polyclonal)		ThermoFisherCat# A-11008IF 1:500
AntibodyAnti-mouse IgG Alexa Fluor 555
(Donkey polyclonal)		ThermoFisherCat# A-31570IF 1:500
AntibodyAnti-rat IgG Alexa Fluor 647
(Goat polyclonal)		ThermoFisherCat# A-21247IF 1:500
AntibodyAnti-mouse BiotinylatedVector LabsCat# ba-9200DAB 1:100
Chemical compound, drugMethoxy X04TocrisCat# 4920
Chemical compound, drugCathepsin L probeBachemCat# 4003379Z-Phe-Arg-AMC
Chemical compound, drugCathepsin C probeBachemCat# 4003759H-Gly-Phe-AMC
Sequence-based reagentCst7_FThis paperPCR primersACCAATAACCCAGGAGTGCTTA
Sequence-based reagentCst7_RThis paperPCR primersTGACCCAGACTTCAGAGTAGCA
Sequence-based reagentArg1_FThis paperPCR primersGGAGACCACAGTCTGGCAGTTGGA
Sequence-based reagentArg1_RThis paperPCR primersGGACACAGGTTGCCCATGCAGA
Sequence-based reagentIl1b_FThis paperPCR primersCGACAAAATACCTGTGGCCTTGGGC
Sequence-based reagentIl1b_RThis paperPCR primersTGCTTGGGATCCACACTCTCCAGC
Sequence-based reagentTrem2_FThis paperPCR primersCTGCTGATCACAGCCCTGTCCCAA
Sequence-based reagentTrem2_RThis paperPCR primersCCCCCAGTGCTTCAAGGCGTCATA
Sequence-based reagentGapdh_FThis paperPCR primersTGCATCCACTGGTGCTGCCAA
Sequence-based reagentGapdh_RThis paperPCR primersACTTGGCAGGTTTCTCCAGGCG
Sequence-based reagentLilrb4a_FThis paperPCR primersATGGGCACAAAAAGAAGGCTAA
Sequence-based reagentLilrb4a_RThis paperPCR primersGGCATAGGTTACATCCTGGGTC
Sequence-based reagentNdufv1_FThis paperPCR primersATTTTCTCGGCGGGTTGGTT
Sequence-based reagentNdufv1_RThis paperPCR primersCACCTTTCAGCCTCCAGTCA
Commercial assay or kitDuoSet ELISA – IL-1βR&D SystemsCat# DY401
Commercial assay or kitDuoSet ELISA – IL-6R&D SystemsCat# DY406
Commercial assay or kitDuoSet ELISA – TNFαR&D SystemsCat# DY411
Commercial assay or kitRNAscope 2.5 HD Duplex AssayBiotechneCat# 322436
Commercial assay or kitRNAscope probes – Cst7BiotechneCat# 498711-C2
Commercial assay or kitRNAscope probes – Lilrb4aBiotechneCat# 1260291-C2
Table 1
Antibodies used for flow cytometry.
FluorochromeAntigenCloneLotCat numberStock concentration (mg/mL)Dilution
Alexa Fluor 488Ly6CHK1.4B2487391280210.5500
PEP2Y12S16007DB2984598480030.2200
PEDazzle594MHCIIM5/114.15.2B2160621076470.2200
PE-Cy7CD4530-F11B2711231031130.2200
APCCD11cN418B2803131173090.2200
BV711CD11bM1/70B3059111012410.00550
Table 2
Primers used for qPCR.
GeneForwardReverse
Cst7ACCAATAACCCAGGAGTGCTTATGACCCAGACTTCAGAGTAGCA
Arg1GGAGACCACAGTCTGGCAGTTGGAGGACACAGGTTGCCCATGCAGA
Il1bCGACAAAATACCTGTGGCCTTGGGCTGCTTGGGATCCACACTCTCCAGC
Trem2CTGCTGATCACAGCCCTGTCCCAACCCCCAGTGCTTCAAGGCGTCATA
GapdhTGCATCCACTGGTGCTGCCAAACTTGGCAGGTTTCTCCAGGCG
Lilrb4aATGGGCACAAAAAGAAGGCTAAGGCATAGGTTACATCCTGGGTC
Ndufv1ATTTTCTCGGCGGGTTGGTTCACCTTTCAGCCTCCAGTCA
Table 3
Antibodies used for immunohistochemistry.
AntigenTypeSpecies (raised)SupplierCat numberStock concentration (mg/mL)Dilution
IBA1PrimaryRabbitWako019-197410.51:2000
Aβ (6E10)PrimaryMouseBioLegend80300111:1000
LAMP2PrimaryRatBioLegend1085010.51:200
Synaptophysin (Sy38)PrimaryMouseAbcamab8049Lot:1043113-11:200
Anti-rabbit IgG Alexa Fluor 488SecondaryGoatThermoFisherA-1100821:500
Anti-mouse IgG Alexa Fluor 555SecondaryDonkeyThermoFisherA-3157021:500
Anti-rat IgG Alexa Fluor 647SecondaryGoatThermoFisherA-2124721:500
Anti-mouse BiotinylatedSecondaryGoatVector Labsba-92001.51:100

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/85279/elife-85279-mdarchecklist1-v2.pdf

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Michael JD Daniels
  2. Lucas Lefevre
  3. Stefan Szymkowiak
  4. Alice Drake
  5. Laura McCulloch
  6. Makis Tzioras
  7. Jack Barrington
  8. Owen R Dando
  9. Xin He
  10. Mehreen Mohammad
  11. Hiroki Sasaguri
  12. Takashi Saito
  13. Takaomi C Saido
  14. Tara L Spires-Jones
  15. Barry W McColl
(2023)
Cystatin F (Cst7) drives sex-dependent changes in microglia in an amyloid-driven model of Alzheimer’s disease
eLife 12:e85279.
https://doi.org/10.7554/eLife.85279