Cystatin F (Cst7) drives sex-dependent changes in microglia in an amyloid-driven model of Alzheimer’s disease
- UK Dementia Research Insitute at The University of Edinburgh, United Kingdom
- Centre for Inflammation Research, Institute for Regeneration and Repair, The University of Edinburgh, United Kingdom
- Simons Initiative for the Developing Brain, University of Edinburgh, United Kingdom
- Department of Neurology and Neurological Science, Graduate School of Medicine, Tokyo Medical and Dental University, Japan
- Laboratory for Proteolytic Neuroscience, RIKEN Brain Science Institute, Japan
- Department of Neuroscience and Pathobiology, Research Institute of Environmental Medicine, Nagoya University, Japan
Figures
Figure 1 with 1 supplement
Cst7/cystatin F is upregulated in microglia in murine models of Alzheimer’s disease (AD).
(A) Analysis of publicly available microglial RNASeq databases for Cst7 expression in amyloid-driven models. Background-matched control (grey) or relevant disease model (blue). (B) Brightfield …
-
Figure 1—source data 1
Source data associated with Figure 1.
(D) Quantification of (C) showing % Cst7+ area in areas within 25 µm of 6E10+ plaques or outside. (F) Quantification of (E) showing % Cst7 overlap with IBA1.
- https://cdn.elifesciences.org/articles/85279/elife-85279-fig1-data1-v1.xlsx
Figure 1—figure supplement 1
Investigating expression of Cst7.
(A) Sub-set analysis of activated response microglia (ARM) cluster from Sala-Frigerio et al. expression of genes in females vs. males. Selected genes annotated. (B–D) Cst7 expression from published …
Figure 2 with 3 supplements
Cst7 deletion leads to sex-dependent transcriptomic changes in microglia in the AppNL-G-F model of amyloid-driven Alzheimer’s disease (AD).
(A) Study design schematic. (B) Differentially expressed genes (DEGs) between wild-type and AppNL-G-F microglia in male and female mice. (C) Volcano plot of RNASeq from wild-type vs. AppNL-G-F …
-
Figure 2—source data 1
Source data associated with Figure 2.
(I and J) Example gene expression (fpkm) from RNASeq of microglia isolated from male and female wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. Selected genes are Lilrb4 (I) and Cxcl2 (J).
- https://cdn.elifesciences.org/articles/85279/elife-85279-fig2-data1-v1.xlsx
-
Figure 2—source data 2
Differentially expressed genes (DEGs) between male and female AppNL-G-F and AppNL-G-FCst7-/- mice (selected genes in bold).
- https://cdn.elifesciences.org/articles/85279/elife-85279-fig2-data2-v1.docx
Figure 2—figure supplement 1
Gating strategy for microglia fluorescence-activated cell sorting (FACS).
Microglia/BAMs were defined as single cells, Zombie NIR- live cells, CD11b+CD45+ myeloid cells, Ly6C- microglia/BAMs. Phenotypic markers MHCII and CD11c were also tested. All gates were set using …
Figure 2—figure supplement 2
Gene expression from RNASeq data.
(A) Example expression (fpkm) of Cst7 from RNASeq of microglia isolated from male and female wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. (B) Venn diagram showing differentially expressed …
Figure 2—figure supplement 3
Gene expression from RNASeq data compared to qPCR from naïve (non-diseased) mice.
(A) Expression (fpkm) of Lilrb4a and Il1b from RNASeq of wild-type (grey), AppNL-G-F (blue), or AppNL-G-FCst7-/- (red) microglia from male and female mice. (B) Relative expression (ddCt vs. mean of …
Figure 3 with 1 supplement
Cst7 deletion leads to region and sex-dependent changes in lysosomes in AppNL-G-F mice.
(A) Example images from male and female wild-type and AppNL-G-F cortex stained with IBA1 (green), 6E10 (magenta), and LAMP2 (cyan). (B–D) IBA1 % coverage from images taken of wild-type, AppNL-G-FCst7…
-
Figure 3—source data 1
Source data associated with Figure 3.
(B–D) IBA1 % coverage from images taken of wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- brains in cortex (B), hippocampus (C), and dorsal subiculum (D). (F–H) Ratio of IBA1/LAMP2 double positive staining vs. IBA1 total staining in the cortex (F), hippocampus (G), and dorsal subiculum (H) of wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- mice. (K) Ratio of MeX04 total staining vs. 6E10 total staining in cortex (blue), hippocampus (red), and subiculum (green) of male and female AppNL-G-F mice.
- https://cdn.elifesciences.org/articles/85279/elife-85279-fig3-data1-v1.xlsx
Figure 3—figure supplement 1
Immunohistochemistry supplementary information.
(A) Whole slide scan of an AppNL-G-F brain stained with 6E10 (red) and MeX04 (white) to illustrate regions of interest taken for analysis. Example regions are cortex (blue square), hippocampus (red …
Figure 4 with 1 supplement
Cst7 regulates microglial Aβ burden in female AppNL-G-F mice.
(A) Study design schematic. (B) % MeX04+ microglia of total microglia in male and female wild-type (grey), AppNL-G-FCst7+/+ (blue), and AppNL-G-FCst7-/- (red) brains. (C) Median fluorescence …
-
Figure 4—source data 1
Source data associated with Figure 4.
(B) % MeX04+ microglia of total microglia in male and female wild-type (grey), AppNL-G-FCst7+/+ (blue), and AppNL-G-FCst7-/- (red) brains. (C) Median fluorescence intensity (MFI) of MeX04 in microglia. (D) MFI of CD45 on microglia. (E) % CD11c+ microglia of total microglia. (F) % MHC-II+ microglia of total microglia. (G) MFI of P2Y12 on microglia.
- https://cdn.elifesciences.org/articles/85279/elife-85279-fig4-data1-v1.xlsx
Figure 4—figure supplement 1
Validating MeX04 to measure Aβ-containing microglia.
Fluorescence-activated cell sorting (FACS) plots of microglia gated by MeX04 and SSC-A. Plots show data from a wild-type mouse injected with MeX04 (left), an aged AppNL-G-F mouse injected with …
Figure 5 with 4 supplements
Cst7 negatively regulates phagocytosis in microglia from female AppNL-G-F mice.
(A) Study design schematic. (B–C) qPCR data for Cst7 (B) and Tmem119 (C) RNA expression from female wild-type and AppNL-G-F microglia isolated by CD11b beads and cultured for 3 days in vitro. Bars …
-
Figure 5—source data 1
Source data associated with Figure 5.
(B–C) qPCR data for Cst7 (B) and Tmem119 (C) RNA expression from female wild-type and AppNL-G-F microglia isolated by CD11b beads and cultured for 3 days in vitro. (D–E) Cathepsin L (D) and C (E) activity from female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) microglia measured by probe-based assay. (G) Quantification of myelin phagocytosis assays with female AppNL-G-FCst7+/+ and AppNL-G-FCst7-/- microglia taken immediately before (t=0) and 2 hr 45 min after (t=2 hr 45 min) addition of pHrodo-tagged myelin.
- https://cdn.elifesciences.org/articles/85279/elife-85279-fig5-data1-v1.xlsx
Figure 5—figure supplement 1
Investigating Cst7 knockout in vitro.
(A–D) Uptake of various tagged substrates from male (solid lines/symbols) and female (dotted lines/symbols) wild-type (black) and Cst7-/- (red) microglia. Substrates tested were HiLyte647-tagged Aβ1-…
Figure 5—figure supplement 2
Investigating Cst7 knockout on microglial cytokine secretion.
Multiplex bead-based ELISA data from male wild-type (black) and Cst7-/- (red) microglia stimulated with LPS (100 ng/mL, 24 hr) or IL-4 (20 ng/mL, 24 hr). Data are mean ± SEM. n=4.
Figure 5—figure supplement 3
Investigating Cst7 knockdown in BV-2 cells vitro.
(A) qPCR data of Cst7 expression in BV-2 cells treated with scrambled control siRNA (black) or siRNA targeting Cst7 (red). (B) IL-6 secretion from BV-2 cells treated with scrambled control siRNA …
Figure 5—figure supplement 4
Investigating Cst7 knockout from AppNL-G-F mice in vitro.
(A) Yield of isolated microglia from AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) mice. (B) IL-6 secretion from AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) cultured microglia treated …
Figure 6 with 1 supplement
Investigating the effect of Cst7 deletion on disease pathology.
(A) % Aβ coverage measured by 6E10 3,3'-diaminobenzidine (DAB) staining in cortex (blue), hippocampus (red), subiculum (green), cerebellum (magenta), and whole brain (grey) of male and female AppNL-G…
-
Figure 6—source data 1
Source data associated with Figure 6.
(A) % Aβ coverage measured by 6E10 3,3'-diaminobenzidine (DAB) staining in cortex, hippocampus, subiculum, cerebellum, and whole brain of male and female AppNL-G-F brains. (B–F) % Aβ coverage in the cortex (B), hippocampus (C), subiculum (D), cerebellum (E), and whole brain (F) of male and female AppNL-G-FCst7+/+ and AppNL-G-FCst7-/- mice. Points are measured by thresholding of whole region area in sagittal section. (H) Quantification of MeX04+ plaque count in the subicula of female AppNL-G-FCst7+/+ and AppNL-G-FCst7-/-. (J) Quantification of % coverage of synaptophysin in the cortex of male and female wild-type, AppNL-G-FCst7+/+, and AppNL-G-FCst7-/- brains.
- https://cdn.elifesciences.org/articles/85279/elife-85279-fig6-data1-v1.xlsx
Figure 6—figure supplement 1
Investigating the role of Cst7 in plaque burden.
Area of MeX04+ plaques in the subiculum of male and female AppNL-G-FCst7+/+ (blue) and AppNL-G-FCst7-/- (red) brains. Bars are mean plaque area + SEM. n=10–12.
Author response image 1
Tables
Key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Mus musculus) | AppNL-G-F | DOI:10.1038/nn.3697 | ||
| Genetic reagent (Mus musculus) | Cst7-/- | DOI:10.1016/j.immuni.2016.03.003 | ||
| Cell line (Mus musculus) | BV2 | Collaborator | RRID: CVCL_0182 | Authenticated (STR profiling) |
| Cell line (Homo sapiens) | SH-SY5Y | Collaborator | RRID: CVCL_0019 | Authenticated (STR profiling) |
| Biological sample (Homo sapiens) | Synaptoneurosome from AD brain | DOI:10.1016/j.xcrm.2023.101175 | AMREC (approval number 15-HV-016) | |
| Biological sample (Mus musculus) | Purified myelin | This paper | See Materials and methods ‘Myelin purification and pHrodo tagging’ | |
| Antibody | Anti-Ly6C- Alexa Fluor 488 (Rat monoclonal) | BioLegend | Cat# 128021 | FACS 1:500 |
| Antibody | Anti-P2Y12 – PE (Rat monoclonal) | BioLegend | Cat# 848003 | FACS 1:200 |
| Antibody | Anti-MHCII – PEDazzle594 (Rat monoclonal) | BioLegend | Cat# 107647 | FACS 1:200 |
| Antibody | Anti-CD45 – PE-Cy7 (Rat monoclonal) | BioLegend | Cat# 103113 | FACS 1:200 |
| Antibody | Anti- CD11c – APC (Armenian Hamster monoclonal) | BioLegend | Cat# 117309 | FACS 1:200 |
| Antibody | Anti- CD11b – BV711 (Rat monoclonal) | BioLegend | Cat# 848003 | FACS 1:50 |
| Antibody | Anti-IBA1 (Rabbit polyclonal) | Wako | Cat# 019-19741 | IF 1:2000 |
| Antibody | Anti- Aβ (6E10) (Mouse monoclonal) | BioLegend | Cat# 803001 | IF/DAB 1:1000 |
| Antibody | Anti-LAMP2 (Rat monoclonal) | BioLegend | Cat# 108501 | IF 1:200 |
| Antibody | Anti-Synaptophysin (Sy38) (Mouse monoclonal) | Abcam | ab8049 | IF 1:200 |
| Antibody | Anti-rabbit IgG Alexa Fluor 488 (Goat polyclonal) | ThermoFisher | Cat# A-11008 | IF 1:500 |
| Antibody | Anti-mouse IgG Alexa Fluor 555 (Donkey polyclonal) | ThermoFisher | Cat# A-31570 | IF 1:500 |
| Antibody | Anti-rat IgG Alexa Fluor 647 (Goat polyclonal) | ThermoFisher | Cat# A-21247 | IF 1:500 |
| Antibody | Anti-mouse Biotinylated | Vector Labs | Cat# ba-9200 | DAB 1:100 |
| Chemical compound, drug | Methoxy X04 | Tocris | Cat# 4920 | |
| Chemical compound, drug | Cathepsin L probe | Bachem | Cat# 4003379 | Z-Phe-Arg-AMC |
| Chemical compound, drug | Cathepsin C probe | Bachem | Cat# 4003759 | H-Gly-Phe-AMC |
| Sequence-based reagent | Cst7_F | This paper | PCR primers | ACCAATAACCCAGGAGTGCTTA |
| Sequence-based reagent | Cst7_R | This paper | PCR primers | TGACCCAGACTTCAGAGTAGCA |
| Sequence-based reagent | Arg1_F | This paper | PCR primers | GGAGACCACAGTCTGGCAGTTGGA |
| Sequence-based reagent | Arg1_R | This paper | PCR primers | GGACACAGGTTGCCCATGCAGA |
| Sequence-based reagent | Il1b_F | This paper | PCR primers | CGACAAAATACCTGTGGCCTTGGGC |
| Sequence-based reagent | Il1b_R | This paper | PCR primers | TGCTTGGGATCCACACTCTCCAGC |
| Sequence-based reagent | Trem2_F | This paper | PCR primers | CTGCTGATCACAGCCCTGTCCCAA |
| Sequence-based reagent | Trem2_R | This paper | PCR primers | CCCCCAGTGCTTCAAGGCGTCATA |
| Sequence-based reagent | Gapdh_F | This paper | PCR primers | TGCATCCACTGGTGCTGCCAA |
| Sequence-based reagent | Gapdh_R | This paper | PCR primers | ACTTGGCAGGTTTCTCCAGGCG |
| Sequence-based reagent | Lilrb4a_F | This paper | PCR primers | ATGGGCACAAAAAGAAGGCTAA |
| Sequence-based reagent | Lilrb4a_R | This paper | PCR primers | GGCATAGGTTACATCCTGGGTC |
| Sequence-based reagent | Ndufv1_F | This paper | PCR primers | ATTTTCTCGGCGGGTTGGTT |
| Sequence-based reagent | Ndufv1_R | This paper | PCR primers | CACCTTTCAGCCTCCAGTCA |
| Commercial assay or kit | DuoSet ELISA – IL-1β | R&D Systems | Cat# DY401 | |
| Commercial assay or kit | DuoSet ELISA – IL-6 | R&D Systems | Cat# DY406 | |
| Commercial assay or kit | DuoSet ELISA – TNFα | R&D Systems | Cat# DY411 | |
| Commercial assay or kit | RNAscope 2.5 HD Duplex Assay | Biotechne | Cat# 322436 | |
| Commercial assay or kit | RNAscope probes – Cst7 | Biotechne | Cat# 498711-C2 | |
| Commercial assay or kit | RNAscope probes – Lilrb4a | Biotechne | Cat# 1260291-C2 |
Table 1
Antibodies used for flow cytometry.
| Fluorochrome | Antigen | Clone | Lot | Cat number | Stock concentration (mg/mL) | Dilution |
|---|---|---|---|---|---|---|
| Alexa Fluor 488 | Ly6C | HK1.4 | B248739 | 128021 | 0.5 | 500 |
| PE | P2Y12 | S16007D | B298459 | 848003 | 0.2 | 200 |
| PEDazzle594 | MHCII | M5/114.15.2 | B216062 | 107647 | 0.2 | 200 |
| PE-Cy7 | CD45 | 30-F11 | B271123 | 103113 | 0.2 | 200 |
| APC | CD11c | N418 | B280313 | 117309 | 0.2 | 200 |
| BV711 | CD11b | M1/70 | B305911 | 101241 | 0.005 | 50 |
Table 2
Primers used for qPCR.
| Gene | Forward | Reverse |
|---|---|---|
| Cst7 | ACCAATAACCCAGGAGTGCTTA | TGACCCAGACTTCAGAGTAGCA |
| Arg1 | GGAGACCACAGTCTGGCAGTTGGA | GGACACAGGTTGCCCATGCAGA |
| Il1b | CGACAAAATACCTGTGGCCTTGGGC | TGCTTGGGATCCACACTCTCCAGC |
| Trem2 | CTGCTGATCACAGCCCTGTCCCAA | CCCCCAGTGCTTCAAGGCGTCATA |
| Gapdh | TGCATCCACTGGTGCTGCCAA | ACTTGGCAGGTTTCTCCAGGCG |
| Lilrb4a | ATGGGCACAAAAAGAAGGCTAA | GGCATAGGTTACATCCTGGGTC |
| Ndufv1 | ATTTTCTCGGCGGGTTGGTT | CACCTTTCAGCCTCCAGTCA |
Table 3
Antibodies used for immunohistochemistry.
| Antigen | Type | Species (raised) | Supplier | Cat number | Stock concentration (mg/mL) | Dilution |
|---|---|---|---|---|---|---|
| IBA1 | Primary | Rabbit | Wako | 019-19741 | 0.5 | 1:2000 |
| Aβ (6E10) | Primary | Mouse | BioLegend | 803001 | 1 | 1:1000 |
| LAMP2 | Primary | Rat | BioLegend | 108501 | 0.5 | 1:200 |
| Synaptophysin (Sy38) | Primary | Mouse | Abcam | ab8049 | Lot:1043113-1 | 1:200 |
| Anti-rabbit IgG Alexa Fluor 488 | Secondary | Goat | ThermoFisher | A-11008 | 2 | 1:500 |
| Anti-mouse IgG Alexa Fluor 555 | Secondary | Donkey | ThermoFisher | A-31570 | 2 | 1:500 |
| Anti-rat IgG Alexa Fluor 647 | Secondary | Goat | ThermoFisher | A-21247 | 2 | 1:500 |
| Anti-mouse Biotinylated | Secondary | Goat | Vector Labs | ba-9200 | 1.5 | 1:100 |
