Mutation of vsx genes in zebrafish highlights the robustness of the retinal specification network
- Centro Andaluz de Biología del Desarrollo (CSIC/UPO/JA), Spain
- Centre for Integrative Biology, Facultad de Ciencias, Universidad Mayor, Chile
- IRCCS SYNLAB SDN, Via E. Gianturco, Italy
- Department of Molecular Life Sciences, University of Zürich, Switzerland
- Champalimaud Research, Champalimaud Centre for the Unknown, Portugal
Figures
Figure 1 with 3 supplements
DNA-binding domain deletion of vsx genes affect neural retina formation and disrupt VBA reflex.
(a) CRISPR/Cas9 DNA editing tool was used to generate deletions (green box) in the highly conserved DBD from vsx1 (top) and vsx2 (bottom) TFs. Blue boxes represent gene exons, black boxes the …
Figure 1—figure supplement 1
Zebrafish Vsx1 and Vsx2 proteins are disrupted in vsxKO animals.
(a, b). Scheme of zebrafish Vsx1 and Vsx2 peptides and protein alignments showing the nuclear localization signal (N, yellow), homeodomain (HD, blue) and CVC (green) regions. The starting of the …
Figure 1—figure supplement 2
Eye size is normal in vsxKO juvenile fish.
(a, b). Lateral view of a 2-week-old wildtype (a) and vsxKO (b) fish. Note that vsxKO juvenile fish show no obvious morphological differences with wildtype siblings. (a', b'). High-magnification …
Figure 1—figure supplement 3
VBA and nuclear layers width are affected in vsx mutants.
(a-d). Dorsal view of wildtype (a), vsx1∆245 (b), vsx2∆73 (c), and vsxKO (d) animals at 6dpf. vsx1∆245 (b) and vsxKO (d) fish have problems sensing background light and appear darker than wildtype (a…
Figure 2 with 1 supplement
ERG response is reduced in vsxKO larvae.
(a) Representative ERG tracks at maximum light intensity from WT (blue), vsx1∆245 (red), vsx2∆73 (green) and vsxKO double mutants (grey and yellow) at 5dpf. For vsxKO larvae, two typical recordings …
Figure 2—figure supplement 1
OKR measurements indicate decreased eye movement velocity in vsx mutants.
(a-c). OKR was recorded in wildtype (blue), vsx1∆245 (red), vsx2∆73 (green), and vsxKO double mutants (yellow) at 5dpf in response to different contrast (a), spatial frequency (b) and angular …
Figure 3 with 1 supplement
Mitosis and apoptosis markers expression are increased in vsxKO retinas.
(a-f). Phospho-histone H3 (PH3) antibody staining reveals cell divisions in central retina cryosections from WT (a-c) and vsxKO (d-f) samples at three different developmental stages (48, 60, and …
Figure 3—figure supplement 1
Delayed differentiation but normal RPE and proliferation in zebrafish vsxKO eyes at 24‐26hpf.
(a, b). Phospho‐histone H3 (PH3) antibody staining was used to evaluate proliferation in WT (a) and vsxKO (b) retinas at 24hpf. (c). Quantification of PH3 positive cells in WT and vsxKO retinas at …
Figure 4 with 3 supplements
Altered expression of Bipolar and Müller glia cell markers in 3dpf vsx mutant fish.
(a-h). Confocal sections from in toto in situ hybridization experiments using specific fluorescent probes to label different cell types in wildtype and vsxKO retinas at 72hpf. No clear differences …
Figure 4—figure supplement 1
Delayed photoreceptor differentiation is observed in vsxKO retinas.
(a-f), (h-m). Cryosections of wildtype (a-c, h-j) and vsxKO retinas (d-f, k-m) stained with photoreceptor specific antibodies and DAPI as a nuclear marker. Cones and rods were visualized by using …
Figure 4—figure supplement 2
Analysis of INL markers prox1, ptf1a, and pax6 in WT and vsxKO retinas.
(a-h). Confocal representative images of genes expressed in the INL by fluorescent in situ hybridization at different stages. At 48hpf, no obvious change in the expression of prox1 was detected …
Figure 4—figure supplement 3
V2 spinal cord interneurons are not affected by the mutation of Vsx TFs.
(a-d). Fluorescent in situ hybridization lateral images from 24hpf wildtype (a, b) and vsxKO (c, d) mutants using vsx1 (a, c) and tal1 (b, d) probes to visualize V2a and V2b trunk interneurons, …
Figure 5 with 4 supplements
Lack of Vsx TFs in the forming retina is buffered by genetic redundancy.
(a) Volcano plots illustrating chromatin accessibility variations upon vsx1 and vsx2 mutation in zebrafish retina at 18hpf. Each dot corresponds to an ATAC-seq peak, that is an open chromatin …
-
Figure 5—source data 1
List of all ATAC-seq peaks with differential accessibility in vsxKO vs WT.
Worksheet #1. Table of contents. Worksheet #2. List of all ATAC-seq peaks upregulated in the vsxKO with adjusted p-value <0.05. Genes associated with the peak are reported in the last column. Worksheet #3. List of all ATAC-seq peaks downregulated in the vsxKO with adjusted <i>P-value <0.05. Genes associated with the peak are reported in the last column.
- https://cdn.elifesciences.org/articles/85594/elife-85594-fig5-data1-v1.xlsx
-
Figure 5—source data 2
Analysis of gene ontology terms for genes neighboring differentially opened regions in vsxKO.
Worksheet #1. Table of contents. Worksheet #2. Gene ontology terms enriched using as input the list of genes associated with differentially open chromatin region from ATAC-seq.
- https://cdn.elifesciences.org/articles/85594/elife-85594-fig5-data2-v1.xlsx
-
Figure 5—source data 3
List of differentially expressed genes between WT and vsxKO embryos and cross-listing between DEGs and DOCRs from WT and vsxKO.
Worksheet #1. Table of contents. Worksheet #2. List of differentially expressed genes (DEGs) with q-value <0.05 between WT and vsxKO embryos Worksheet #3. Cross-list between DEGs from worksheet #2 and differentially open chromatin regions (DOCRs) more accessible in the vsxKO. Every DEG may be associated with more than one DOCR (column M). Worksheet #4. Cross-list between DEGs from worksheet #2 and differentially open chromatin regions (DOCRs) less accessible in the vsxKO. Every DEG may be associated with more than one DOCR (column M).
- https://cdn.elifesciences.org/articles/85594/elife-85594-fig5-data3-v1.xlsx
-
Figure 5—source data 4
List of differentially expressed genes between WT vs vsx2MO and between vsxKO vs vsx2MO.
Worksheet #1. Table of contents. Worksheet #2. List of differentially expressed genes (DEGs) with q-value <0.05 between WT (uninjected) and vsx2-morpholino-injected embryos. Worksheet #3. List of differentially expressed genes (DEGs) with q-value <0.05 between vsx2-morpholino-injected and vsxKO embryos.
- https://cdn.elifesciences.org/articles/85594/elife-85594-fig5-data4-v1.xlsx
Figure 5—figure supplement 1
The expression pattern of vsx mutant transcripts is misregulated in vsxKO animals during retina development.
(a-l). Fluorescent in situ hybridization for vsx1 (a-f) and vsx2 (g-l) genes over retina formation in wildtype (a-c, g-i) and vsxKO (d-f) animals (j-l). In wildtype samples, vsx2 is strongly …
Figure 5—figure supplement 2
Transcriptomic divergence between vsxKO and vsx2 morphant samples.
(a) Experimental design. Zebrafish heads including both eyes were mechanically dissected at 18hpf from WT, vsxKO and vsx2MO samples. The trunk and tail (highlighted in blue) were used to extract DNA …
Figure 5—figure supplement 3
Mutation of vsx genes in medaka impairs INL differentiation and eye growth.
(a) CRISPR/Cas9 was used to eliminate (green box) the DBD from vsx1 (top) and vsx2.1 (bottom) TFs in medaka. Blue boxes represent exons, black boxes the location of sgRNAs used and primers for …
Figure 5—figure supplement 4
Normal eye size in vsxKO animals is observed at juvenile stages.
(a-f). Visual system histological sections stained with nuclear marker DAPI and phalloidin-Alexa488 for actin filaments from wildtype (a, c and e, n=5 for both stages) and vsxKO (b, d and f) animals …
Author response image 1
Videos
Video 1
vsxKO larvae show normal GCL retinotectal projections.
(a, b). 3-D reconstructions of confocal stacks from zebrafish larval eyes injected with either DiO (green) or DiI (red) to label retinal ganglion cells and their projections to the optic tectum in …
Tables
Table 1
Nucleotide sequence of oligos used in this work.
Organism, gene of interest, application and nucleotide sequence is described in each column. Note that the target site is bolded in CRISPR/Cas9 primers used for vsx disruption.
| Organism | Gene | Application | Oligo sequence (5’–3’) |
|---|---|---|---|
| Danio rerio | vsx1 | CRISPR/Cas9 | TAATACGACTCACTATAGGGTTCCTCAAGTTGATGGGGTTTTAGAGCTAGAA |
| Danio rerio | vsx1 | CRISPR/Cas9 | TAATACGACTCACTATAGGTTTACGCGAGAGAAATGCGTTTTAGAGCTAGAA |
| Danio rerio | vsx2 | CRISPR/Cas9 | TAATACGACTCACTATAGGTGCCGGAGGACAGAATACGTTTTAGAGCTAGAA |
| Danio rerio | vsx2 | CRISPR/Cas9 | TAATACGACTCACTATAGGTGGAGAAAGCTTTTAACGGTTTTAGAGCTAGAA |
| Danio rerio | vsx1 | Genotyping Fw | ATGACTGCCTTTCCGGTGAT |
| Danio rerio | vsx1 | Genotyping Rv | CTGCTGGCTCACCTAGAAGC |
| Danio rerio | vsx2 | Genotyping Fw | TCGTAATCTTTCCACTGATTCTGAT |
| Danio rerio | vsx2 | Genotyping Rv | TGTTCTAGAGCATATTGTCTGTTCC |
| Danio rerio | vsx1 | Cloning Fw | CGGGAAGAGAAGAAGCTACAGAT |
| Danio rerio | vsx1 | Cloning Rv | GCCTTCTCTTTTTCCTCTTTTGA |
| Danio rerio | vsx2 | Cloning Fw | CTGTTTTGTCGGAAAGTTTGAA |
| Danio rerio | vsx2 | Cloning Rv | CCAGCTGGTAAGATGTAAATATTGTT |
| Danio rerio | ptf1a | Cloning Fw | GGCTTAGACTCTTTCTCCTCCTC |
| Danio rerio | ptf1a | Cloning Rv | CGTAGTCTGGGTCATTTGGAGAT |
| Danio rerio | gfap | Cloning Fw | GTTCCTTCTCATCCTACCGAAAG |
| Danio rerio | gfap | Cloning Rv | GATCAGCAAACTTTGAGCGATAC |
| Danio rerio | pkcb1 | Cloning Fw | GCGCAGTAAGCACAAGTTCAAGG |
| Danio rerio | pkcb1 | Cloning Rv | CCCAGCCAGCATCTCATATAGC |
| Danio rerio | prdm1a | Cloning Fw | TCAAAACGGCATGAACATCTATT |
| Danio rerio | prdm1a | Cloning Rv | AGGGGTTTGTCTTTCAGAGAAGT |
| Danio rerio | tal1 | Cloning Fw | AGTATGATTTGCTCATCCTCCAA |
| Danio rerio | tal1 | Cloning Rv | TTTGTTTGTTTGCGCATTTAATA |
| Danio rerio | tfec | Cloning Fw | TATAAAGACCGGACGGGGACAAC |
| Danio rerio | tfec | Cloning Rv | CAGCTCCTGGATTCGTAGCTGGA |
| Danio rerio | bhlhe40 | Cloning Fw | TTGCAAATCGGCGAACAGGG |
| Danio rerio | bhlhe40 | Cloning Rv | GGAAACGTGCACGCAGTCG |
| Danio rerio | eef1a1l1 | qPCR Fw | TCCACCGGTCACCTGATCTAC |
| Danio rerio | eef1a1l1 | qPCR Rv | CAACACCCAGGCGTACTTGA |
| Danio rerio | vsx1 | qPCR Fw | TCTAGGTGAGCCAGCAGGAAT |
| Danio rerio | vsx1 | qPCR Rv | CCATGTCGTGTCGCTGTCTT |
| Danio rerio | vsx2 | qPCR Fw | GGGATTAATTGGGCCTGGAGG |
| Danio rerio | vsx2 | qPCR Rv | GCTGGCAGACTGGTTATGTTCC |
| Danio rerio | six3a | qPCR Fw | AAAAACAGGCTCCAGCATCAA |
| Danio rerio | six3a | qPCR Rv | AAGAATTGACGTGCCCGTGT |
| Danio rerio | six3b | qPCR Fw | TCCCCGTCGTTTTGTCTCTG |
| Danio rerio | six3b | qPCR Rv | AGAAGTTTAGGGTGGGCAGC |
| Danio rerio | lhx2b | qPCR Fw | AGGCAAGATTTCGGATCGCT |
| Danio rerio | lhx2b | qPCR Rv | TCTCTGCACCGAAAACCTGTA |
| Danio rerio | mitfa | qPCR Fw | CTGATGGCTTTCCAGTAGCAGA |
| Danio rerio | mitfa | qPCR Rv | GCTTTCAGGATGGTGCCTTT |
| Danio rerio | nr2e1 | qPCR Fw | CAAATCTGGCACACAGGGCG |
| Danio rerio | nr2e1 | qPCR Rv | CGACGAACCGTTCACCTCTT |
| Danio rerio | prrx1a | qPCR Fw | CTCACCGTCATACAGTGCCA |
| Danio rerio | prrx1a | qPCR Rv | AGAGTCTTTGACAGCCCAGC |
| Danio rerio | rorab | qPCR Fw | ACAAACCAGCACCAGTTCGG |
| Danio rerio | rorab | qPCR Rv | CCTCCTGAAGAAACCCTTGCAT |
| Danio rerio | rx1 | qPCR Fw | AAGAACTTGCATCGGACGGT |
| Danio rerio | rx1 | qPCR Rv | TCGGAAGCTTGCATCCAGTT |
| Danio rerio | rx2 | qPCR Fw | TCGGGACGCATAAAGTGGAC |
| Danio rerio | rx2 | qPCR Rv | CGGGTCTCCCAAATCTGCAT |
| Danio rerio | rx3 | qPCR Fw | CCGAGTACAGGTGTGGTTCC |
| Danio rerio | rx3 | qPCR Rv | GTCAACCAGGGCTCTAACGG |
| Danio rerio | hmx4 | qPCR Fw | TGTCGACCCGCTTCTTTGAA |
| Danio rerio | hmx4 | qPCR Rv | TGATGAAGACAGCCATCCCG |
| Oryzias latipes | vsx1 | CRISPR/Cas9 | TAATACGACTCACTATAGGCAGAGTGAGGTTCAGTGGGTTTTAGAGCTAGAA |
| Oryzias latipes | vsx1 | CRISPR/Cas9 | TAATACGACTCACTATAGGTAGGGCCTGACCTGGATTGTTTTAGAGCTAGAA |
| Oryzias latipes | vsx2.1 | CRISPR/Cas9 | TAATACGACTCACTATAGGGGATGATGAGAGTCAAGGGTTTTAGAGCTAGAA |
| Oryzias latipes | vsx2.1 | CRISPR/Cas9 | TAATACGACTCACTATAGGAAAAAATAACAGAATTGAGTTTTAGAGCTAGAA |
| Oryzias latipes | vsx1 | Genotyping Fw | AACAATAATTTAAAATGCGGAAAAA |
| Oryzias latipes | vsx1 | Genotyping Rv | GAAACTAAAATCCCATTCAGTGCT |
| Oryzias latipes | vsx2.1 | Genotyping Fw | ATATCACGGGAAATTAAAATGCTC |
| Oryzias latipes | vsx2.1 | Genotyping Rv | AAGTCAAATGTGCCATTGTTAGTC |
