Glial-dependent clustering of voltage-gated ion channels in Drosophila precedes myelin formation
- Institut für Neuro- und Verhaltensbiologie; Röntgenstraße, Germany
- Max-Planck Institut für molekulare Biomedizin; Wissenschaftliches Service-Labor für Elektronenmikroskopie; Röntgenstraße, Germany
Figures
Figure 1 with 1 supplement
Localization of Paralytic (Para) voltage-gated ion channels in the larval nervous system.
(A) Schematic view on the para gene. Alternative splicing at the circled exons results in the generation of more than 60 Para isoforms. All isoforms share a common N-terminus. Here, the MiMIC …
Figure 1—figure supplement 1
Ensheathing- / wrapping glia in Drosophila and characterization of Para protein.
(A–C) Schematic representation of the larval (A,B) and the adult Drosophila nervous system (C). The ensheathing glia is labeled in blue, the ensheathing/wrapping glia is labeled in green, the …
-
Figure 1—figure supplement 1—source data 1
Four images of western blots, with and without marker bands, are provided.
- https://cdn.elifesciences.org/articles/85752/elife-85752-fig1-figsupp1-data1-v2.zip
Figure 2
Differential localization of voltage-gated ion channels in Drosophila.
(A) Third instar larvae with the genotype [paramCherry; OK371-Gal4, UAS-mCherrydsRNA]. paramCherry expression is suppressed in all glutamatergic neurons and thus, ParamCherry localization along …
Figure 3
Clustered localization of Paralytic (Para) along motor axons.
(A) High-resolution Airyscan analysis of ParamCherry and (B) HRP localization in an adult nerve. The boxed area is shown in higher magnification below (A’,B’). Note the clustered appearance of ParamC…
Figure 4
Localization of Paralytic (Para) along sensory axons.
(A,A’) Ventral pickpocket expressing sensory neuron (v’ada) of a third instar larva with the genotype [paraFlpTag-GFP; ppk-Gal4, UAS-flp, UAS-tdTomato] stained for GFP (green), HRP (magenta), and …
Figure 5
A glial lacunar system surrounds the axon initial segment.
(A) Weak Paralytic (Para) expression can be detected on paraApex2 expressing small axons (arrowheads) running in fascicles within the nerve. (B–D) Cross sections through the same axon at various …
Figure 6 with 1 supplement
Organization of the lacuna forming tract glial.
(A,B) Apex2 expression directed by 75H03-Gal4. Axons (asterisks) are engulfed by lacunar structures that are largely formed by the tract glia. (C) Maximum projection of a confocal image stack. 75H03-…
Figure 6—figure supplement 1
Glial cell types involved in lacuna formation.
(A–C) The tract glial cells as defined by 75H03-Gal4 UAS-tdTomato activity also express the CNS ensheathing glia marker 83E12-LexA LexAop-CD8::GFP. (D) The PNS wrapping glia marker nrv2-Gal4 …
Figure 7 with 5 supplements
Drosophila wrapping glia form myelin.
(A) Drosophila leg of a 3-week-old fly with wrapping glial nuclei in green, the cuticle is stained by autofluorescence, the genotype is [nrv2-Gal4, UAS-lamGFP]. (B–K) Electron microscopic images of …
Figure 7—figure supplement 1
Count of axons in Drosophila leg nerves and measurement of glial cell process width.
(A) About 760 axons innervate the leg. The majority is smaller than 0.5 μm in diameter, very few ones are larger than 2 μm. (B) The width of glial cell processes is about 28 nm and very regular.
Figure 7—figure supplement 2
Extent of the lacunar system.
(A) CNS/PNS boundary of the mesothoracic neuromere of an adult ventral nerve cord with the genotype [75H03-Gal4, UAS-tdTomato, 83E12-lexA, lexAop-CD8GFP] imaged for tdTomato, GFP, and HRP …
Figure 7—figure supplement 3
Quantification of myelin distribution in the leg nerve.
(A–I) Examples of myelin-like structures of the leg nerve. (A) Myelin-like sheets can be found separating the lacunar region from small caliber axons. (B) Myelin-like sheets separate large caliber …
Figure 7—figure supplement 4
Multilayered myelin-like structures are formed around single axons in the adult nervous system.
(A) Loosely wrapped glial membranes around one single axon (asterisk). The spacing of the glial membranes resembles the glial lacunae. (B) Wrapping around a single axon. The green shaded glial cell …
Figure 7—figure supplement 5
Formation of myelin-like structures in the adult CNS of Drosophila.
(A) High-pressure freezing preparation. Spiral growth of a glial cell process. (B) Membrane stack formed by a wrapping glial cell. Note the bulbed growing tips of the glial membrane sheets …
Figure 8 with 2 supplements
Localization of the voltage-gated sodium channel depends on glia.
(A,A’) Third instar larval filet preparation with the genotype [nrv2-Gal4, UAS-CD8-GFP; R90C03-Gal80] showing the localization of Paralytic (Para) as detected using the anti-Para antibody in a …
Figure 8—figure supplement 1
Glia ablation does not affect the localization of the voltage-gated potassium channel Shal.
(A) Control larva with an endogenously tagged Shal potassium channel. Shal predominantly localizes to the axon initial segment. (B) Upon ablation of the ensheathing glia, no change in Shal …
Figure 8—figure supplement 2
Ablation of central ensheathing glia does not affect positioning of Paralytic (Para) at the axon initial segment (AIS).
CNS preparations of third instar larvae of the genotypes indicated are shown. (A) Control larva, expressing CD8GFP under the control of the split Gal4 driver [83E12-Gal4AD, repo-Gal4DBD, UAS-CD8GFP] …
Figure 9
Organization of the axon initial segment (AIS) in Drosophila motor axons.
Voltage-gated sodium channels are preferentially positioned at the AIS of the motor axon. (A) In the larval nervous system positioning is mediated by the peripheral wrapping glia. (B) In adults …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (Drosophila melanogaster) | y[1] w[*] Mi{MIC}MI08578a Mi{MIC}MI08578b | Bloomington Drosophila Stock Center | BDSC51087 | |
| Genetic reagent (Drosophila melanogaster) | y[1] w[*] Mi{FlpStop}para[MI08578-FlpStop.D]/FM7c | Bloomington Drosophila Stock Center | BDSC67680 | |
| Genetic reagent (Drosophila melanogaster) | Para-mCherry | This study | Figures 1, 2 | |
| Genetic reagent (Drosophila melanogaster) | Para-Apex | This study | Figures 1, 5 | |
| Genetic reagent (Drosophila melanogaster) | Para-FlpTag GFP/Fm7i | Fendl et al., 2020 | ||
| Genetic reagent (Drosophila melanogaster) | y[1] w[*]; Mi{PT-GFSTF.1}Shal[MI00446-GFSTF.1] | Bloomington Drosophila Stock Center | BDSC60149 | |
| Genetic reagent (Drosophila melanogaster) | y[1] w[*] Mi{PT-GFSTF.2}Sh[MI10885-GFSTF.2]/FM7j, B[1] | Bloomington Drosophila Stock Center | BDSC59423 | |
| Genetic reagent (Drosophila melanogaster) | y[1] w[*]; Mi{PT-GFSTF.1}Shab[MI00848-GFSTF.1]/TM6C, Sb[1] Tb[1] | Bloomington Drosophila Stock Center | BDSC60514 | |
| Genetic reagent (Drosophila melanogaster) | y[1] sc[*] v[1] sev[21]; P{y[+t7.7] v[+t1.8]=VALIUM20-mCherry}attP2 | Bloomington Drosophila Stock Center | BDSC35785 | |
| Genetic reagent (Drosophila melanogaster) | UAS-CD8GFP II; R90C03Gal80 III | Kottmeier et al., 2020 | ||
| Genetic reagent (Drosophila melanogaster) | UAS-Hid/CyOw; R90C03Gal80 III | Kottmeier et al., 2020 | ||
| Genetic reagent (Drosophila melanogaster) | UAS-lacZ NLS II | Y. Hirmoi | ||
| Genetic reagent (Drosophila melanogaster) | UAS-lambda-Htl | Gisselbrecht et al., 1996 | ||
| Genetic reagent (Drosophila melanogaster) | UAS-htlDN II | Bloomington Drosophila Stock Center | BDSC5366 | |
| Genetic reagent (Drosophila melanogaster) | UAS-CD8GFP II | Bloomington Drosophila Stock Center | BDSC5137 | |
| Genetic reagent (Drosophila melanogaster) | UAS-CD8mCherry II | Bloomington Drosophila Stock Center | BDSC 27391 | |
| Genetic reagent (Drosophila melanogaster) | UAS-Hid II | Igaki et al., 2000 | ||
| Genetic reagent (Drosophila melanogaster) | UAS-Flp | Bloomington Drosophila Stock Center | BDSC 4539 | |
| Genetic reagent (Drosophila melanogaster) | UAS-Myr-Flag-APEX2-NES86Fb III | This study | Figures 6, 7 | |
| Genetic reagent (Drosophila melanogaster) | pBPhsFLP2::pEST/I;; UAS HA, FLAG, V5, OLLAS/III | Nern et al., 2015 | ||
| Genetic reagent (Drosophila melanogaster) | ChAT-Gal4 | Salvaterra and Kitamoto, 2001 | ||
| Genetic reagent (Drosophila melanogaster) | OK371-Gal4 | Mahr and Aberle, 2006 | ||
| Genetic reagent (Drosophila melanogaster) | GMR94G06Gal4 III | Bloomington Drosophila Stock Center | BDSC40701 | |
| Genetic reagent (Drosophila melanogaster) | Nrv2Gal4 II | Sun et al., 1999 | ||
| Genetic reagent (Drosophila melanogaster) | Nrv2Gal4 II; R90C03Gal80 III | Kottmeier et al., 2020 | ||
| Genetic reagent (Drosophila melanogaster) | Nrv2Gal4 II; R90C03Gal80, UAS-CD8Cherry III | Kottmeier et al., 2020 | ||
| Genetic reagent (Drosophila melanogaster) | GMR83E12_AD II; Repo4.3_DBD III | Bittern et al., 2021 | ||
| Genetic reagent (Drosophila melanogaster) | GMR75H03-Gal4 III | Bloomington Drosophila Stock Center | BDSC39908 | |
| Genetic reagent (Drosophila melanogaster) | ppkGal4, AUS-tdTomato III | Herzmann et al., 2017 | ||
| Genetic reagent (Drosophila melanogaster) | lexAop-Flp III | Bloomington Drosophila Stock Center | BDSC55819 | |
| Genetic reagent (Drosophila melanogaster) | w[*]; TI{2A-lexA::GAD}VGlut[2A-lexA]/CyO | Bloomington Drosophila Stock Center | BDSC84442 | |
| Genetic reagent (Drosophila melanogaster) | ParaST76 | Bloomington Drosophila Stock Center | BDSC26701 | |
| Genetic reagent (Drosophila melanogaster) | Oregon R | Bloomington Drosophila Stock Center | BDSC5 | |
| Antibody | Anti-Para N-term (rabbit, polyclonal) | This study | IF (1:1000), WB (1:1000) Figures 1, 2 | |
| Antibody | Anti-dsRed (rabbit, polyclonal) | Takara | Cat#632496 RRID:AB_10013483 | IF (1:1000) |
| Antibody | Anti-GFP (chicken, polyclonal) | Abcam | Cat#ab13970 RRID:AB_300798 | IF(1:500) |
| Antibody | Anti-GFP (rabbit, polyclonal) | Invitrogen | Cat#A-11122 RRID:AB_221569 | IF(1:1000) |
| Antibody | Anti-Rumpel (rabbit, polyclonal) | Yildirim et al., 2022 | IF(1:1000) | |
| Antibody | Anti-Repo (mouse, monoclonal) | Hybridoma Bank | Cat#8D12 RRID: AB_528448 | IF(1:5) |
| Antibody | Anti-V5 (rabbit, polyclonal) | Sigma-Aldrich | Cat#V8137-.2MG RRID:AB_261889 | IF(1:500) |
| Antibody | Anti-HA (mouse, monoclonal) | Covance BioLegend | Cat#MMS-101R RRID:AB_291262 | IF(1:1000) |
| Antibody | Anti-Flag (rat, monoclonal) | Novus Biologicals | Cat#NBP1-06712SS RRID:AB_162598 | IF(1:200) |
| Antibody | FluoTag-X4 anti-GFP (Alpaca, monoclonal) | NanoTag Biotechnologies | Cat#N0304 RRID:AB_2905516 | IF(1:500) |
| Antibody | FluoTag-X4 anti-RFP (Alpaca, monoclonal) | NanoTag Biotechnologies | Cat#N0404 RRID:AB_2744638 | IF(1:500) |
| Antibody | Anti-rabbit Alexa 488 (goat, polyclonal) | Thermo Fisher | Cat#A-11008 RRID:AB_143165 | IF(1:1000) |
| Antibody | Anti-rabbit Alexa 568 (goat, polyclonal) | Thermo Fisher | Cat#A-11011 RRID:AB_143157 | IF(1:1000) |
| Antibody | Anti-chicken Alexa 488 (goat, polyclonal) | Thermo Fisher | Cat#A-11039, RRID:AB_2534096 | IF(1:1000) |
| Antibody | Anti-mouse Alexa 488 (goat, polyclonal) | Thermo Fisher | Cat#A-11001, RRID:AB_2534069 | IF(1:1000) |
| Antibody | Anti-HRP Alexa 647 (goat, polyclonal) | Thermo Fisher | Cat#123-605-021, RRID:AB_2338967 | IF(1:500) |
| Antibody | Anti-rabbit HRP (goat, polyclonal) | Invitrogen | Cat#31460 RRID:AB_228341 | WB(1:5000) |
| Recombinant DNA reagent | pBS-KS-attB1-2-PT-SA-SD-0-mCherry | Drosophila Genome Research Centre | DGRC#1299 | |
| Recombinant DNA reagent | pBS-KS-attB1-2-PT-SA-SD-0-Apex2 | This study | Generation of transgenic fly | |
| Sequence-based reagent | BamH1 Apex2 fwd | This study | PCR primer | AAGGATCCGGAAAGTCTTACCCAACTGT |
| Sequence-based reagent | BamH1 Apex2 rev | This study | PCR primer | AAGGATCCGGCATCAGCAAACCCAAG |
| Sequence-based reagent | MiLF | Venken et al., 2011 | PCR primer | GCGTAAGCTACCTTAATCTCAAGAAGAG |
| Sequence-based reagent | MiLR | Venken et al., 2011 | PCR primer | CGCGGCGTAATGTGATTTACTATCATAC |
| Sequence-based reagent | mCherry-Seq fwd | PCR primer | ACGGCGAGTTCATCTACAAG | |
| Sequence-based reagent | mCherry-Seq rev | PCR primer | TTCAGCCTCTGCTTGATCTC | |
| Sequence-based reagent | Apex253_rev1 | This study | PCR primer | AGCTCAAAATAGGGAACTCCG |
| Sequence-based reagent | Apex286_fwd1 | This study | PCR primer | TACCAGTTGGCTGGCGTTGTT |
| Sequence-based reagent | Para qPCR Primer | Thermo Fisher Scientific | Cat#4331182 Dm01813740_m1 | |
| Sequence-based reagent | RPL32 qPCR Primer | Thermo Fisher Scientific | Cat#4331182 Dm02151827_g1 | |
| Commercial assay or kit | RNeasy Kit | QIAGEN | Cat#74104 | |
| Commercial assay or kit | Quantitect Reverse Transcription Kit | QIAGEN | Cat#205313 | |
| Commercial assay or kit | Taqman gene expression assay, Universal Master Mix II, with UNG | Thermo Fisher Scientific | Cat#4440038 | |
| Software algorithm | GraphPad PRISM | GraphPad Software, USA | Version 6.0 | |
| Software algorithm | Fiji | https://imagej.net/software/fiji/ | ||
| Software algorithm | ZEN Software | Zeiss | Black version | |
| Software algorithm | Affinity Photo | Serif (Europe) | ||
| Software algorithm | MATLAB | The MathWorks, Inc | ||
| Software algorithm | Photoshop CS6 | Adobe |
