Allosteric activation or inhibition of PI3Kγ mediated through conformational changes in the p110γ helical domain

  1. Noah J Harris
  2. Meredith L Jenkins
  3. Sung-Eun Nam
  4. Manoj K Rathinaswamy
  5. Matthew AH Parson
  6. Harish Ranga-Prasad
  7. Udit Dalwadi
  8. Brandon E Moeller
  9. Eleanor Sheeky
  10. Scott D Hansen
  11. Calvin K Yip  Is a corresponding author
  12. John E Burke  Is a corresponding author
  1. Department of Biochemistry and Microbiology, University of Victoria, Canada
  2. Department of Biochemistry and Molecular Biology, The University of British Columbia, Canada
  3. Department of Chemistry and Biochemistry, Institute of Molecular Biology, University of Oregon, United States
6 figures, 1 table and 4 additional files

Figures

The inhibitory nanobody NB7 binds tightly to all p110γ complexes and inhibits kinase activity, but does not prevent membrane binding.

(A) Cartoon schematic depicting nanobody inhibition of activation by lipidated Gβγ (1.5 µM final concentration) on 5% PIP2 membrane (5% phosphatidylinositol 4,5-bisphosphate [PIP2], 95% …

Figure 2 with 3 supplements
Structure of p110γ bound to inhibitory nanobody NB7.

(A) Domain schematics of p110γ with helical domain (blue), activation loop (orange), and regulatory motif (green) of p110γ annotated. (B) Cryo electron microscopy (cryo-EM) density of the p110γ-NB7 …

Figure 2—figure supplement 1
p110γ-NB7 complex cryo electron microscopy (cryo-EM) analysis workflow.

Cryo-EM processing workflow of p110γ-NB7 complex is shown in order of a representative micrographs, representative 2D classification and 3D reconstruction processing strategy. Bottom left shows …

Figure 2—figure supplement 2
Density fit of p110γ-NB7 complex.

Model of p110γ (blue)/NB7 (red) complex in different orientations is shown fit within the cryo electron microscopy (cryo-EM) density map (green mesh).

Figure 2—figure supplement 3
Comparison of full-length p110γ bound to NB7 compared to p110γ-p101.

The structure of the p110γ-p101 complex (PDB: 7MEZ) compared to the NB7-p110γ complex is shown colored according to B-factor based on the legend.

Figure 3 with 1 supplement
PKCβ leads to dual phosphorylation of internal sites in the helical domain, with selectivity for apo p110γ and p110γ-p84 over p110γ-p101.

(A) Putative phosphorylation sites mapped on the structure of p110γ (PDB: 7MEZ) and cartoon schematic. The regions are colored based on domain schematics featured in Figure 2A. (B) Raw MS spectra of …

Figure 3—figure supplement 1
MS/MS spectra of peptides spanning S582 and S594/S595 for both phosphorylated and unphosphorylated states.

The theoretical and experimental mass are annotated for all peptides.

Activating phosphorylation at the helical domain leads to opening of the regulatory motif.

(A) Hydrogen-deuterium exchange mass spectrometry (HDX-MS) comparing apo and phosphorylated p110γ. Significant differences in deuterium exchange are mapped on to the structure and cartoon of p110γ …

Nanobody NB7 blocks PKCβ phosphorylation, and phosphorylation prevents nanobody binding.

(A) Extracted ion chromatograms for p110γ, p110γ-p101, and p110γ bound to NB7 are shown for the S594 or S595 phosphorylation site in p110γ. A bar graph showing the intensities of phosphorylated and …

Comparison of nanobody binding site compared to p85 inhibition of class IA phosphoinositide 3 kinases (PI3Ks) and class IB activation sites.

(A) Comparison of the nanobody NB7 binding site in p110γ compared to the nSH2 inhibitory site in p110α (PDB: 3HHM) (Mandelker et al., 2009). (B) Comparison of the nanobody NB7 binding site in p110γ …

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Strain, strain background (Escherichia coli)E. coli XL10-GOLD KanR Ultracompetent CellsAgilent200317
Strain, strain background (Escherichia coli)BL21 E. coli C41 (DE3) RIPLPMID: 24876499C41
Strain, strain background (Spodoptera frugiperda)Sf9 Insect CellsExpression systems94-001S
Strain, strain background (Escherichia coli)E. coli DH10EMBacY Competent CellsGeneva BiotechDH10EMBacY
Recombinant DNA reagentpMultiBac-Gβ1/Gγ2PMID:34452907pOP737
Recombinant DNA reagentpACEBac1-hsp110γPMID:34452907MR30
Recombinant DNA reagentpMultiBac-hsp110γ-ssp101PMID:34452907MR22
Recombinant DNA reagentpMultiBac-hsp110γ-mmp84PMID:34452907MR24
Recombinant DNA reagentpFastBac HRas G12VPMID:34452907BS9
Recombinant DNA reagentbiGBac hsp110γ/ybbr-hsp84PMID:36842083HP28
Recombinant DNA reagentbiGBac hsp110γ/ybbr-hsp101PMID:36842083HP29
Recombinant DNA reagenthis6-GST-PrescissionProtease-SNAP-RBD(K65E)PMID:34452907pSH936
Recombinant DNA reagenthis6TEV-HRas(1-184aa) C118S, C181SPMID:34452907pSH414
Recombinant DNA reagenthis6-G2, SNAP-G1 (DUAL FastBac)PMID:34452907pSH651
Recombinant DNA reagentpACEBAC-PKCβII (internal tev cleavage site)This paperpMR56
Recombinant DNA reagentpFASTBac p110αPMID: 28515318pOV1181
Recombinant DNA reagentpFASTBac p110βPMID: 28515318pOV1182
Recombinant DNA reagentpFASTBac p110δPMID: 28515318pOV1183
Recombinant DNA reagentpFASTBac p85βThis paperEX21
Sequence-based reagentFwd primer for amplifying KD of PKCIISigmaMR51FGTATTTTCAGGGCgccggtaccACGA
CCAACACTGTCTCCAAATTTG
Sequence-based reagentRvs primer for amplifying KD of PKCIISigmaMR51RgactcgagcggccgcTTATAGCTCTT
GACTTCGGGTTTTAAAAATTCAG
Sequence-based reagentFwd primer for amplifying N term of PKCIISigmaMR52FCCATCACggatctggcggtagt
ATGGCTGACCCGGCTGCG
Sequence-based reagentRvs primer for amplifying N term of PKCIISigmaMR52RGCCCTGAAAATACAGGTTTTCCTTTTCTTCCGGGACCTTGGTTCCC
Sequence-based reagentFwd primer for adding stop codon to PKCIISigmaMR56FAGTCAAGAGCTAAgcgg
ccgctcgagtctagagcctgc
Sequence-based reagentRvs primer for adding stop codon to PKCIISigmaMR56RgactcgagcggccgcTTAGCTCTTGA
CTTCGGGTTTTAAAAATTCAG
Commercial assay or kitTranscreener ADP2 FI Assay (1000 Assay, 384 Well)BellBrook Labs3013-1K
Chemical compound, drugDeuterium oxide 99.9%Sigma151882
Chemical compound, drugGuanosine 5′-diphosphate (GDP) sodium salt hydrateSigmaG7127-100MG
Chemical compound, drugGuanosine 5′-triphosphate (GTP) sodium salt hydrateSigmaG8877-250MG
Chemical compound, drugSodium deoxycholateSigmaD6750
Chemical compound, drugPolyoxyethylene (10) lauryl etherSigmaP9769
Chemical compound, drugCHAPS, Molecular Biology GradeEMD Millipore220201
Chemical compound, drugPhosphatidylserine (Porcine Brain)Avanti840032C
Chemical compound, drugPhosphatidylethanolamine (Egg yolk)SigmaP6386
Chemical compound, drugCholesterolSigma47,127U
Chemical compound, drugPhosphatidylcholine (Egg yolk)Avanti840051C
Chemical compound, drugPhosphatidylinositol-4,5-bisphosphate (Porcine Brain)Avanti840046
Chemical compound, drugSphingomyelin (Egg yolk)SigmaS0756
Chemical compound, drug1,2-Dioleoyl-sn-glycero-3-phosphocholine (DOPC)Avanti850375C
Chemical compound, drug1,2-Dioleoyl-sn-glycero-3-phospho-L-serine (18:1, DOPS)Avanti840035C
Chemical compound, drug1,2-Dioleoyl-sn-glycero-3-phosphoethanolamine-N-[4-(p-maleimidomethyl)cyclohexane-carboxamide] (18:1 MCC-PE)Avanti780201C
Chemical compound, drug10 mg/mL beta casein solutionThermo Fisher37528
Chemical compound, drug10× PBS (pH 7.4)Corning46-013CM
Chemical compound, drugglucose oxidase from Aspergillus niger (225 U/mg)BiophoreticsB01357.02
Chemical compound, drugCatalaseSigmaC40-100MG Bovine Liver
Chemical compound, drugTroloxCayman Chemicals10011659
Chemical compound, drugDyomics 647 maleimide dyeDyomics647P1-03
Chemical compound, drugCoenzyme ASigmaC3019
Chemical compound, drugSulfuric acidSigma58105-2.5L-PC
Software, algorithmCOOT-0.9.4.1CCP4https://www2.mrc-lmb.cam.ac.uk/personal/pemsley/coot/
Software, algorithmPhenix-1.19.1Open sourcehttps://www.phenix-online.org/
Software, algorithmPDBePISA (Proteins, Interfaces, Structures and Assemblies)EMBL-EBIhttps://www.ebi.ac.uk/pdbe/pisa/pistart.html
Software, algorithmESPript 3.0Robert and Gouet, 2014https://espript.ibcp.fr
Software, algorithmHDExaminerSierra Analyticshttp://massspec.com/hdexaminer
Software, algorithmGraphPad Prism 7GraphPadhttps://www.graphpad.com
Software, algorithmPyMOLSchroedingerhttp://pymol.org
Software, algorithmCompass Data AnalysisBrukerhttps://www.bruker.com
Software, algorithmChimeraXUCSFhttps://www.rbvi.ucsf.edu/chimerax/
Software, algorithmImageJ/FijiImageJhttps://imagej.net/software/fiji/
Software, algorithmNikon NIS elementsNikonhttps://www.microscope.healthcare.nikon.com/products/software/nis-elements
Software, algorithmcryoSPARC v.3.3.2Structura Biotechnologyhttps://cryosparc.com/
OtherSf9 insect cells for expressionExpression Systems94–001SSf9 cell line used for protein expression (Methods)
OtherInsect cell mediaExpression Systems96-001-01Sf9 cell media (Methods)
OtherHellmanex III cleaning solutionFisher14-385-864Cleaning solution for TIRF experiments (PMID:36842083)
OtherSix-well sticky-side chamberIBIDI80608Side chamber used for TIRF experiments (Methods)
OtherC-Flat 2/2T gridsElectron Microscopy SciencesCFT-223CGrids used for EM studies (Methods)
OtherPDB coordinate file for p110γ-NB7 structurePDB8DP0PDB to use for p110-NB7 structure
OtherEM density file for p110γ-NB7 complexEMDEMD-27627EM density file to use for p110-NB7
OtherHDX-MS and phosphorylation proteomics dataPRIDEPXD040765Database and number where HDX data was uploaded

Additional files

Download links