N-cadherin directs the collective Schwann cell migration required for nerve regeneration through Slit2/3-mediated contact inhibition of locomotion
- UCL Laboratory for Molecular Cell Biology and the UCL Cancer Institute, University College London, United Kingdom
Figures
Figure 1 with 2 supplements
N-cadherin is required for contact inhibition of locomotion between Schwann cells (SCs).
(a) Representative still images comparing the collective migration of siRNA Scrambled Control or N-cadherin (N-Cad) KD SCs in a wound healing assay. The dashed lines indicate the leading edge of …
-
Figure 1—source data 1
Excel spreadsheet containing data used to generate graphs in Figure 1.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig1-data1-v2.xlsx
Figure 1—figure supplement 1
N-cadherin is required for contact inhibition of locomotion between Schwann cells (SCs).
(a) Representative western blot from three independent experiments showing N-cadherin (N-Cad) (127 kDa) protein levels in SCs treated with either 2 nM control, siRNA1, or siRNA2 for 48 hr. ERK (44, …
-
Figure 1—figure supplement 1—source data 1
Original file for the western blot analysis of N-cadherin KD in Figure 1—figure supplement 1a (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig1-figsupp1-data1-v2.zip
-
Figure 1—figure supplement 1—source data 2
Labelled file for the western blot analysis of N-cadherin KD in Figure 1—figure supplement 1a (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig1-figsupp1-data2-v2.zip
-
Figure 1—figure supplement 1—source data 3
Original file for the western blot analysis of loading control in Figure 1—figure supplement 1a (ERK).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig1-figsupp1-data3-v2.zip
-
Figure 1—figure supplement 1—source data 4
Labelled file for the western blot analysis of loading control in Figure 1—figure supplement 1a (ERK).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig1-figsupp1-data4-v2.zip
Figure 1—video 1
N-cadherin mediates contact inhibition of locomotion (CIL).
Related to Figure 1f. Representative time-lapse microscopy of control and N-cadherin (N-Cad) knockdown Schwann cells treated with siRNA1 or siRNA2, which repulsed or overlapped respectively. Cells …
Figure 2 with 2 supplements
N-cadherin-dependent contact inhibition of locomotion (CIL) is independent of the adherens junction complex.
(a) Representative time-lapse microscopy images of a CIL assay in which red fluorescence-labelled control cells (C1 and C2) were mixed with green fluorescent-labelled N-cadherin (N-Cad) knockdown …
-
Figure 2—source data 1
Excel spreadsheet containing data used to generate graphs in Figure 2.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-data1-v2.xlsx
Figure 2—figure supplement 1
N-cadherin-dependent contact inhibition of locomotion (CIL) is independent of the adherens junction complex.
(a) Representative images from time-lapse microscopy showing the collective migration of control, N-cadherin (N-Cad) knockdown, or control and N-Cad knockdown Schwann cells (SCs) upon contact and at …
-
Figure 2—figure supplement 1—source data 1
Original file for the western blot analysis of α-catenin KD in Figure 2—figure supplement 1c (α-catenin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data1-v2.zip
-
Figure 2—figure supplement 1—source data 2
Labelled file for the western blot analysis of α-catenin KD in Figure 2—figure supplement 1c (α-catenin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data2-v2.zip
-
Figure 2—figure supplement 1—source data 3
Original file for the western blot analysis of loading control in Figure 2—figure supplement 1c (ERK).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data3-v2.zip
-
Figure 2—figure supplement 1—source data 4
Labelled file for the western blot analysis of loading control in Figure 2—figure supplement 1c (ERK).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data4-v2.zip
-
Figure 2—figure supplement 1—source data 5
Original file for the western blot analysis of p120 catenin KD in Figure 2—figure supplement 1e (p120 catenin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data5-v2.zip
-
Figure 2—figure supplement 1—source data 6
Labelled file for the western blot analysis of p120 catenin KD in Figure 2—figure supplement 1e (p120 catenin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data6-v2.zip
-
Figure 2—figure supplement 1—source data 7
Original file for the western blot analysis of N-cadherin in Figure 2—figure supplement 1 (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data7-v2.zip
-
Figure 2—figure supplement 1—source data 8
Labelled file for the western blot analysis of N-cadherin in Figure 2—figure supplement 1e (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data8-v2.zip
-
Figure 2—figure supplement 1—source data 9
Original file for the western blot analysis of loading control in Figure 2—figure supplement 1e (ERK).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data9-v2.zip
-
Figure 2—figure supplement 1—source data 10
Labelled file for the western blot analysis of loading control in Figure 2—figure supplement 1e (ERK).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig2-figsupp1-data10-v2.zip
Figure 2—video 1
Contact inhibition of locomotion (CIL) is independent of trans-homodimerisation.
Related to Figure 2a. Representative time-lapse microscopy of a CIL assay in which red-labelled control cells were mixed with green-labelled N-cadherin (N-Cad) knockdown cells. Cells of interest are …
Figure 3 with 2 supplements
The extracellular domain of N-cadherin is sufficient to mediate contact inhibition of locomotion (CIL).
(a) Schematic of N-cadherin (N-Cad) full-length, extracellular, and intracellular domains tagged with tomato at the C-terminus. The intracellular domain of N-Cad has an additional Lyn …
-
Figure 3—source data 1
Original file for the western blot analysis of N-cadherin KD in Figure 3b (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig3-data1-v2.xlsx
-
Figure 3—source data 2
Labelled file for the western blot analysis of N-cadherin KD in Figure 3b (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig3-data2-v2.zip
-
Figure 3—source data 3
Original file for the western blot analysis showing the expression levels of the constructs in Figure 3b (tomato).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig3-data3-v2.zip
-
Figure 3—source data 4
Labelled file for the western blot analysis showing the expression levels of the constructs in Figure 3b (tomato).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig3-data4-v2.zip
-
Figure 3—source data 5
Original file for the western blot analysis of loading control in Figure 3b (ERK).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig3-data5-v2.zip
-
Figure 3—source data 6
Labelled file for the western blot analysis loading control in Figure 3b (ERK).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig3-data6-v2.zip
-
Figure 3—source data 7
Excel spreadsheet containing data used to generate graphs in Figure 3.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig3-data7-v2.xlsx
Figure 3—figure supplement 1
The extracellular domain of N-cadherin is sufficient to mediate contact inhibition of locomotion (CIL).
Representative confocal images of N-cadherin (N-cad) knockdown cells overexpressing siRNA-resistant, tomato-tagged N-Cad full length (left panel), the intracellular domain (middle panel), or the …
Figure 3—video 1
The extracellular domain is sufficient to mediate contact inhibition of locomotion (CIL).
Related to Figure 3c. A video compilation of representative time-lapse microscopy from a CIL assay of N-cadherin (N-Cad) knockdown cells transfected with the full length of N-Cad (siRNA1+FL), the …
Figure 4 with 3 supplements
Glypican-4 and Slit2/Slit3 are required for contact inhibition of locomotion (CIL).
(a) Quantification of a CIL assay, showing control or Glypican-4 knockdown cells, treated with siRNA1 or siRNA2, that are repulsed or not repulsed upon contact respectively (Figure 4—video 1). Data …
-
Figure 4—source data 1
Excel spreadsheet containing data used to generate graphs in Figure 4.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-data1-v2.xlsx
Figure 4—figure supplement 1
Glypican-4 and Slit2/Slit3 are required for contact inhibition of locomotion (CIL).
(a) Quantification of CIL in control or EphB2 knockdown Schwann cells (SCs) (n = 3, mean ± SEM). p-values were calculated using a two-way ANOVA followed by Sidak’s test for multiple comparisons. (b) …
-
Figure 4—figure supplement 1—source data 1
Original gel for analysis of Robo1-3 expression in SCs in Figure 4—figure supplement 1f.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data1-v2.xlsx
-
Figure 4—figure supplement 1—source data 2
Labelled gel for analysis of Robo1-3 expression in SCs in Figure 4—figure supplement 1f.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data2-v2.zip
-
Figure 4—figure supplement 1—source data 3
Original gel for analysis of Robo 4 expression in SCs in Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data3-v2.zip
-
Figure 4—figure supplement 1—source data 4
Labelled gel for analysis of Robo 4 expression in SCs in Figure 4—figure supplement 1f.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data4-v2.zip
-
Figure 4—figure supplement 1—source data 5
Original file for the western blot analysis of Slit2/3 KD in Figure 4—figure supplement 1g (Slit2).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data5-v2.zip
-
Figure 4—figure supplement 1—source data 6
Labelled file for the western blot analysis of Slit2/3 KD in Figure 4—figure supplement 1g (Slit2).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data6-v2.zip
-
Figure 4—figure supplement 1—source data 7
Original file for the western blot analysis of Slit2/3 KD in Figure 4—figure supplement 1g (Slit3).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data7-v2.zip
-
Figure 4—figure supplement 1—source data 8
Labelled file for the western blot analysis of Slit2/3 KD in Figure 4—figure supplement 1g (Slit3).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data8-v2.zip
-
Figure 4—figure supplement 1—source data 9
Original file for the western blot analysis of Slit2/3 KD in Figure 4—figure supplement 1 (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data9-v2.zip
-
Figure 4—figure supplement 1—source data 10
Labelled file for the western blot analysis of Slit2/3 KD in Figure 4—figure supplement 1g (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data10-v2.zip
-
Figure 4—figure supplement 1—source data 11
Original file for the western blot analysis of loading control in Figure 4—figure supplement 1g (Vinculin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data11-v2.zip
-
Figure 4—figure supplement 1—source data 12
Labelled file for the western blot analysis of loading control in Figure 4—figure supplement 1g (Vinculin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data12-v2.zip
-
Figure 4—figure supplement 1—source data 13
Excel spreadsheet containing data used to generate graphs in Figure 4—figure supplement 1.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig4-figsupp1-data13-v2.xlsx
Figure 4—video 1
Glypican-4 is required for contact inhibition of locomotion (CIL) between Schwann cells.
Related to Figure 4a. Representative time-lapse microscopy of a CIL assay, showing control or Glypican-4 knockdown cells, treated with siRNA1 (si1) or siRNA2 (si2), that are repulsed or not repulsed …
Figure 4—video 2
Slit2/3 mediates contact inhibition of locomotion (CIL) between Schwann cells (SCs).
Related to Figure 4h. Representative time-lapse microscopy of showing Sox2 overexpressing or Slit2/3 knockdown cells, treated with siRNA1. Sox2 induces SC clustering of migratory, polarised cords, …
Figure 5 with 2 supplements
N-cadherin is required for the trafficking of Slit2/Slit3 to the cell surface.
(a–d) Representative confocal images of control or N-cadherin (N-Cad) knockdown Schwann cells (SCs). Cells were labelled with antibodies to (a) Slit2 or (c) Slit3 (green) with quantification of …
-
Figure 5—source data 1
Excel spreadsheet containing data used to generate graphs in Figure 5.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-data1-v2.xlsx
Figure 5—figure supplement 1
N-cadherin is required for the localisation of Slit2/Slit3 at the cell surface.
(a) Representative western blot (n = 3) of control and N-cadherin (N-Cad) knockdown cells, probed for Slit2 (200 kDa), Slit3 (200 kDa), and N-Cad (127 kDa). Vinculin (117 kDa) was used as a loading …
-
Figure 5—figure supplement 1—source data 1
Original file for the western blot analysis of N-cadherin KD in Figure 5—figure supplement 1a (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data1-v2.xlsx
-
Figure 5—figure supplement 1—source data 2
Labelled file for the western blot analysis of N-cadherin KD in Figure 5—figure supplement 1a (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data2-v2.zip
-
Figure 5—figure supplement 1—source data 3
Original file for the western blot analysis of N-cadherin KD in Figure 5—figure supplement 1a (Slit2).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data3-v2.zip
-
Figure 5—figure supplement 1—source data 4
Labelled file for the western blot analysis of N-cadherin KD in Figure 5—figure supplement 1a (Slit2).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data4-v2.zip
-
Figure 5—figure supplement 1—source data 5
Original file for the western blot analysis of N-cadherin KD in Figure 5—figure supplement 1a (Slit3).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data5-v2.zip
-
Figure 5—figure supplement 1—source data 6
Labelled file for the western blot analysis of N-cadherin KD in Figure 5—figure supplement 1a (Slit3).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data6-v2.zip
-
Figure 5—figure supplement 1—source data 7
Original file for the western blot analysis of N-cadherin KD in Figure 5—figure supplement 1a (Vinculin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data7-v2.zip
-
Figure 5—figure supplement 1—source data 8
Labelled file for the western blot analysis of N-cadherin KD in Figure 5—figure supplement 1a (Vinculin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data8-v2.zip
-
Figure 5—figure supplement 1—source data 9
Original file for the western blot showing the co-immunoprecipitation of either tomato or full-length N-Cad tagged with tomato, co-expressed with myc-tagged Slit2 in HEK cells in Figure 5—figure supplement 1c (Slit2).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data9-v2.zip
-
Figure 5—figure supplement 1—source data 10
Labelled file for the western blot showing the co-immunoprecipitation of either tomato or full-length N-Cad tagged with tomato, co-expressed with myc-tagged Slit2 in HEK cells in Figure 5—figure supplement 1 (Slit2).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data10-v2.zip
-
Figure 5—figure supplement 1—source data 11
Original file for the western blot showing the co-immunoprecipitation of either tomato or full-length N-Cad tagged with tomato, co-expressed with myc-tagged Slit2 in HEK cells in Figure 5—figure supplement 1c (myc).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data11-v2.zip
-
Figure 5—figure supplement 1—source data 12
Labelled file for the western blot showing the co-immunoprecipitation of either tomato or full-length N-Cad tagged with tomato, co-expressed with myc-tagged Slit2 in HEK cells in Figure 5—figure supplement 1c (myc).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data12-v2.zip
-
Figure 5—figure supplement 1—source data 13
Original file for the western blot showing the co-immunoprecipitation of either tomato or full-length N-Cad tagged with tomato, co-expressed with myc-tagged Slit2 in HEK cells in Figure 5—figure supplement 1c (tomato).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data13-v2.zip
-
Figure 5—figure supplement 1—source data 14
Labelled file for the western blot showing the co-immunoprecipitation of either tomato or full-length N-Cad tagged with tomato, co-expressed with myc-tagged Slit2 in HEK cells in Figure 5—figure supplement 1 (tomato).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data14-v2.zip
-
Figure 5—figure supplement 1—source data 15
Excel spreadsheet containing data used to generate graphs in Figure 5—figure supplement 1.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig5-figsupp1-data15-v2.xlsx
Figure 5—video 1
N-cadherin moves in waves towards cell contacts.
Related to Figure 5—figure supplement 1d. Spinning disc confocal microscopy of Schwann cells (SCs) transfected with construct expressing siRNA resistant tomato-tagged N-cadherin in order to …
Figure 6 with 4 supplements
The Slit-repulsive signal is required for the efficient collective migration of Schwann cells (SCs) during nerve regeneration.
(a) Quantification of the collective migration of control compared to Slit2/Slit3 knockdown SCs at 6 hr using a chamber assay (Figure 6—video 1). Data is normalised to control and presented as mean …
-
Figure 6—source data 1
Excel spreadsheet containing data used to generate graphs in Figure 6.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig6-data1-v2.xlsx
Figure 6—figure supplement 1
The Slit-repulsive signal is required for the efficient collective migration of Schwann cells (SCs).
(a) Representative stills from time-lapse microscopy (Figure 6—video 1) showing the collective migration of control or Slit2/Slit3 knockdown SCs seeded in chambers at the indicated time points and …
-
Figure 6—figure supplement 1—source data 1
Original gel for analysis of western blot showing pTuner empty vector SCs or pTuner Sox2 SCs response to Shield treatment at 24 hr in Figure 6—figure supplement 1 (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig6-figsupp1-data1-v2.xlsx
-
Figure 6—figure supplement 1—source data 2
Labelled gel for analysis of western blot showing pTuner empty vector SCs or pTuner Sox2 SCs response to Shield treatment at 24 hr in Figure 6—figure supplement 1c (N-cadherin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig6-figsupp1-data2-v2.zip
-
Figure 6—figure supplement 1—source data 3
Original gel for analysis of western blot showing pTuner empty vector SCs or pTuner Sox2 SCs response to Shield treatment at 24 hr in Figure 6—figure supplement 1c (Sox2).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig6-figsupp1-data3-v2.zip
-
Figure 6—figure supplement 1—source data 4
Labelled gel for analysis of western blot showing pTuner empty vector SCs or pTuner Sox2 SCs response to Shield treatment at 24 hr in Figure 6—figure supplement 1c (Sox2).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig6-figsupp1-data4-v2.zip
-
Figure 6—figure supplement 1—source data 5
Original gel for analysis of western blot showing loading controls for pTuner empty vector SCs or pTuner Sox2 SCs response to Shield treatment at 24 hr in Figure 6—figure supplement 1c (Vinculin and α-tubulin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig6-figsupp1-data5-v2.zip
-
Figure 6—figure supplement 1—source data 6
Labelled gel for analysis of western blot showing loading controls for pTuner empty vector SCs or pTuner Sox2 SCs response to Shield treatment at 24 hr in Figure 6—figure supplement 1 (Vinculin and α-tubulin).
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig6-figsupp1-data6-v2.zip
-
Figure 6—figure supplement 1—source data 7
Excel spreadsheet containing data used to generate graphs in Figure 6—figure supplement 1.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig6-figsupp1-data7-v2.xlsx
Figure 6—video 1
Slit2/3 are required for the efficient collective migration of Schwann cells (SCs).
Related to Figure 6a. Representative time-lapse microscopy of the collective migration of SCs treated with control siRNA or Slit2/3 siRNA2. Following Slit2/3 knockdown, SCs are clustered and migrate …
Figure 6—video 2
Recombinant Slit2 induces Schwann cell clustering.
Related to Figure 6c. Representative time-lapse microscopy of a cell clustering assay, showing PBS or recombinant Slit2 (rSlit2)-treated Schwann cells, that are repulsed and not repulsed upon …
Figure 6—video 3
Slit2 is required for the efficient collective migration of Schwann cells (SCs).
Related to Figure 6d. Representative time-lapse microscopy of a collective migration assay, showing PBS or recombinant Slit2 (rSlit2)-treated SCs. Note that rSlit2-treated SCs close the gap more …
Figure 7 with 2 supplements
The Slit-repulsive signal is required for the efficient collective migration of Schwann cells (SCs) in the ex vivo nerve bridge.
(a) Schematic showing ex vivo migration protocol. (b) Representative immunofluorescence images in untreated ex vivo explants showing plp-eGFP SCs (green) migrating along the vasculature (magenta) in …
-
Figure 7—source data 1
Excel spreadsheet containing data used to generate graphs in Figure 7.
- https://cdn.elifesciences.org/articles/88872/elife-88872-fig7-data1-v2.xlsx
Figure 7—figure supplement 1
The Slit-repulsive signal is required for the efficient collective migration of Schwann cells (SCs) ex vivo.
(a) Representative tile scans of untreated ex vivo explants showing the components of the bridge. Images show densely packed nuclei (blue) between the proximal and distal stumps. Regrowing axons …
Figure 7—video 1
Slit2 is required for the collective migration of Schwann cells (SCs) within a regenerating nerve.
Related to Figure 7b. Representative time-lapse microscopy of nerve explants from mice 5 d following sciatic nerve transection showing the effect of PBS or recombinant Slit2 (rSlit2) (60 μg/ml) …
Tables
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Other | Plp-eGFP | Mallon et al., 2002 | Available from Jackson Laboratories https://www.jax.org/strain/033357 | |
| Cell line (Rattus norvegius) | Schwann cells | Mathon et al., 2001 | SCs | |
| Cell line (R. norvegius) | Sox2 Schwann cells | This paper | Created using the Proteotuner Shield System by Clontech | |
| Cell line (R. norvegius) | ProteoTuner Schwann Cells | This paper | Created using the Proteotuner Shield System by Clontech | |
| Sequence-based reagent | αE-catenin siRNA1 | This paper | siRNA | AAGAACGCCTGGAAAGCATAA |
| Sequence-based reagent | αE-catenin siRNA2 | This paper | siRNA | CAACCGGGACTTGATATACAA |
| Sequence-based reagent | Cadherin-2 siRNA1 | This paper | siRNA | TCCCAACATGTTTACAATCAA |
| Sequence-based reagent | Cadherin-2 siRNA2 | This paper | siRNA | CAGTATACGTTAATAATTCAA |
| Sequence-based reagent | p120-catenin siRNA1 | This paper | siRNA | AGGTCAGATCGTGGAAACCTA |
| Sequence-based reagent | p120-catenin siRNA2 | This paper | siRNA | ATGCTCGGAACAACAAAGAGTTAA |
| Sequence-based reagent | Glypican-4 siRNA1 | This paper | siRNA | CCGACTGGTTACTGATGTCAA |
| Sequence-based reagent | Glypican-4 siRNA2 | This paper | siRNA | CGGTGTAGTTACAGAACTGTA |
| Sequence-based reagent | Slit2 siRNA1 | This paper | siRNA | ATCAATATTGATGATTGCGAA |
| Sequence-based reagent | Slit2 siRNA1 | This paper | siRNA | GACGACTAGACCGTAGTAATA |
| Sequence-based reagent | Slit3 siRNA1 | This paper | siRNA | AACGGCGGTGCCCAAAGAATT |
| Sequence-based reagent | Slit3 siRNA1 | This paper | siRNA | ATCGTGGAAATACGCCTAGAA |
| Sequence-based reagent | Robo1 siRNA1 | This paper | siRNA | AAGGGCGGCGAAAGAGTGGAA |
| Sequence-based reagent | Robo1 siRNA2 | This paper | siRNA | CCCGACTATAGAATGGTACAA |
| Sequence-based reagent | Robo2 siRNA1 | This paper | siRNA | CTCATTGGATTGTCCGGCTAA |
| Sequence-based reagent | Robo2 siRNA2 | This paper | siRNA | CTCGGACACTATCCTGCGGAA |
| Sequence-based reagent | N-cadherin siRNA1 targeting sequence | This paper | Forward primer | 5’-CACGATAAACAATGAGACTGGGGACATC-3’ |
| Sequence-based reagent | N-cadherin siRNA1 targeting sequence | This paper | Reverse primer | Reverse primer 5’-AACATATTGGGTGAAGGTGTGCTGGG-3’ |
| Sequence-based reagent | Slit1 forward | This paper | PCR primers | GCACTTGTCACAATGACCCT |
| Sequence-based reagent | Slit1 reverse | This paper | PCR primers | CCCTTCAAAGCCGGAAGGA |
| Sequence-based reagent | Slit2 forward | This paper | PCR primers | GTGTTAGAAGCCACGGGAAT |
| Sequence-based reagent | Slit2 reverse | This paper | PCR primers | GCGTCTGGTGTGAATGAGAT |
| Sequence-based reagent | Slit3 forward | This paper | PCR primers | GGATTATCGCAACAGATTCAG |
| Sequence-based reagent | Slit3 reverse | This paper | PCR primers | GGTCAGTGGTATATTCAGGG |
| Sequence-based reagent | Robo1 forward | This paper | PCR primers | AGGGGAGTCAGAATCTGCTT |
| Sequence-based reagent | Robo1 reverse | This paper | PCR primers | CCTCTGGACGTTCGTAACAG |
| Sequence-based reagent | Robo2 forward | This paper | PCR primers | TTGGATCAGAGGAGTCCCTG |
| Sequence-based reagent | Robo2 reverse | This paper | PCR primers | ACCCTTTAGAGGAGGCTGTT |
| Antibody | N-Cadherin (mouse monoclonal) | BD Transduction | 610920 | 1:1000 immunofluorescence western blot |
| Antibody | α-catenin (rabbit polyclonal) | Sigma | C2081 | 1:1000 immunofluorescence western blot |
| Antibody | β-catenin (mouse monoclonal) | BD Transduction | 610920 | 1:2000 immunofluorescence western blot |
| Antibody | p120-catenin (mouse monoclonal) | BD Transduction | 61034 | 1:2000 immunofluorescence western blot |
| Antibody | ERK1/2 (rabbit polyclonal) | Sigma | M5670 | 1:1000 western blot |
| Antibody | mCherry (rabbit polyclonal) | Abcam | ab183628 | 1:1000 western blot |
| Antibody | mCherry (rat monoclonal) | Life Technologies | M11217 | 1:1000 Immunoprecipitation |
| Antibody | Slit2 (rabbit monoclonal) | Abcam | ab134166 | 1:1000 western blot |
| Antibody | Slit2 (rabbit polyclonal) | Thermo Fisher Scientific | PA531133 | 1:1000 Immunofluorescence |
| Antibody | Slit3 (rabbit polyclonal) | Sigma | SAB2104337 | 1:1000 Immunofluorescence |
| Antibody | Slit3 (goat polyclonal) | R&D Systems | AF3629 | 1:1000 western blot |
| Antibody | Myc (mouse monoclonal) | Merck Millipore | 05-724 | 1:1000 western blot |
| Antibody | Alexa Fluor 546 Phalloidin | Life Technologies | A22283 | 1:1000 Immunofluorescence |
| Antibody | Goal anti-mouse Alexa Flour 488 | Thermo Fisher Scientific | A1100 | 1:1000 Immunofluorescence |
| Antibody | Rabbit IgG HRP | GE Healthcare | NA934V | 1:1000 western blot |
| Antibody | Mouse IgG HRP | GE Healthcare | NA931V | 1:1000 western blot |
| Antibody | Goat IgG HRP | R&D Systems | HAF012 | 1:1000 western blot |
| Software, algorithm | Prism | GraphPad | RRID:SCR_002798 | https://www.graphpad.com/features |
| Software, algorithm | Adobe Photoshop | Adobe Systems | RRID:SCR_014199 | https://www.adobe.com/ |
| Software, algorithm | Adobe Illustrator | Adobe Systems | RRID:SCR_010279 | https://www.adobe.com/ |
| Software, algorithm | FIJI/ImageJ | Shih and Yamada, 2012 #370 | RRID:SCR_002285 | https://imagej.net/Fiji/Downloads |
