DMRT1 is a testis-determining gene in rabbits and is also essential for female fertility
Figures
SRY, DMRT1, and POU5F1 location during early gonadal development.
(A) Key stages of gonadal development in rabbits with 31 days of gestation. Germ cells are first detected at 9 days post-coïtum (dpc), before the genital ridge formation, which occurs between 10 and 12 dpc. In XY gonads, testicular cords begin forming at 16 dpc, and germ cells enter meiosis a few months after birth. In XX gonads, the ovigerous cords appear at 20 dpc, and meiosis begins around birth. Location of SRY, DMRT1, and POU5F1 by in situ hybridization (RNAscope technology) on XY and XX control gonads at (B) 12 dpc or (C) 13 dpc. Dotted line: developing genital crests. Yellow arrowheads: coelomic epithelial cells expressing DMRT1. Scale bar = 50 µm.
Somatic markers location during testis differentiation.
Location of SRY by in situ hybridization (RNAscope technology), DMRT1, and SOX9 by immunohistochemistry on XY control testes from 14 to 18 dpc. The dotted line at 15 dpc: territory with cells expressing SRY and DMRT1 but not SOX9. Yellow arrowheads: tunica albuginea in formation. Scale bar = 50 µm.
DMRT1 and SOX9 co-location on 14 dpc XY control gonad.
DMRT1 (green) and SOX9 (red) immunodetection in XY control gonad at 14 dpc. Nuclei were stained in blue (DAPI). Arrowheads: cells co-expressing DMRT1 and SOX9. Scale bar = 50 µm.
Identification of PAX8-positive cells in 15 dpc control gonads.
Immunostaining of PAX8 in XY and XX control gonads at 15 dpc. Scale bar = 50 µm.
Somatic markers location and expression during ovarian differentiation.
(A) Immunostaining of DMRT1 on XX control ovaries from 14 to 18 dpc. (B) Quantitative RT-PCR (RT-qPCR) analyses of RSPO1, DMRT1, and FOXL2 expression from 16 to 20 dpc in control gonads of both sexes. The error bars correspond to the standard error of the mean (n=3-5) (C) RSPO1 in situ hybridization (RNAscope technology), immunostaining of DMRT1 and FOXL2 on 20 dpc control ovaries. Scale bar = 50 µm.
DMRT1 and POU5F1 co-detection in control gonads.
DMRT1 (green) and POU5F1 (red) immunodetection in XY and XX control gonads from 16 to 20 dpc. Nuclei were stained in blue (DAPI). Arrowheads: cells expressing POU5F1 only. Arrows: cells co-expressing POU5F1 and DMRT1. Dotted line: delimitation of the ovarian surface epithelium. Dots with intense green labeling: auto-fluorescence of red blood cells. Scale bar = 50 µm.
Ovarian-like morphology and transcriptomic signature of XY DMRT1−/− gonads at 20 dpc.
(A) Hematoxylin and eosin staining of gonads sections from control and DMRT1−/− 20 dpc rabbits. The enlarged area shows the characteristic ovarian surface epithelium found on XY DMRT1−/− gonads. Scale bar = 50 µm. Heatmap representation of (B) 3460 deregulated genes (adjusted p-value <0.05 and |log2FC| > 1) or (C) 27 selected genes between XY control, XY DMRT1−/−, XX DMRT1−/−, and XX control at 20 dpc.
DMRT1 mutation using CRISPR/Cas9 in rabbits.
(A) Position of the two guides (sgRNA1 and sgRNA2) on the rabbit DMRT1 transcript. Blue boxes represent the translated exons. The DM domain expands from exon I to exon II. The vertical red arrow indicates the Cas9-induced cleavage. The red box points to the sequence of the sgRNAs. The hatched box and bold blue letters point to the sequence between the theoretical and expected cleavage points. The cleaved fragment was inserted tandemly in the mutant allele at the cleavage site. Thus, by sequencing, a repeat was found (the repeats are written in blue and green bold letters). Consequently, the wild-type and the mutant allele were characterized through PCR using the F/R set of primers and gel electrophoresis. +1: putative transcription start site; ATG: site of initiation of translation; STOP: stop codon. (B) Total RNA were reverse transcribed (RT+), and the amplified products were analyzed through gel electrophoresis. A unique amplicon of 254 bp was observed in PCR products from wild-type rabbits and two (254 and 301 bp) in PCR products from heterozygous rabbits. RT−: reverse transcription control (no reverse transcriptase). (C) Western blot with nuclear proteins extracted from the liver of control rabbits and from 7 to 8 gonads of 1–3 dpp DMRT1+/+, DMRT1+/−, and DMRT1−/− rabbits.
Somatic markers expression and location on control and DMRT1−/− gonads at 20 dpc.
Quantitative RT-PCR (RT-qPCR) analyses of (A) testicular-related differentiation genes (SOX9, AMH, DHH, and SRY) or (B) ovarian-related differentiation genes (FOXL2, CYP19A1, and RSPO1) in XY control, XY DMRT1−/−, XX DMRT1−/−, and XX control gonads (n = 4–5) at 20 dpc. Statistical analyses were performed using the non-parametric Kruskal–Wallis test, followed by a pairwise permutation test: *p-value <0.05; ns: non-significant. (C) Immunostaining of DMRT1, SOX9, and FOXL2 on XY control, XY DMRT1−/−, XX DMRT1−/−, and XX control gonad sections at 20 dpc. Scale bar = 50 µm.
Evolution of gonadal morphogenesis in XY and XX DMRT1−/− rabbits.
Hematoxylin and eosin staining of gonad sections from XY and XX DMRT1−/− gonads and XX control ovaries at 3 days post-partum (dpp), 18 dpp, and in adulthood (4–9 months). The enlargements for the first two panels correspond to the nuclei pointed by an arrow. PL: preleptotene stage; L: leptotene stage; Z: zygotene stage; D: diplotene stage; F: ovarian follicle; CL: luteal cells. Scale bar = 50 µm.
POU5F1 and Ki67 location on control and DMRT1−/− gonads at 3 dpp.
Immunostaining of POU5F1 (pluripotency marker) and Ki67 (a marker of the exit of the G0 phase of the cell cycle) on gonad sections from XY DMRT1−/−, XX DMRT1−/−, and XX control at 3 dpp. Scale bar = 50 µm.
Evolution of gonadal size in XY and XX DMRT1−/− rabbits.
Hematoxylin and eosin staining of gonad sections from XY and XX DMRT1−/− gonads and XX control ovaries at 18 dpp, and in adulthood (4–9 months). Scale bar = 500 µm.
Tables
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Biological sample (Oryctolagus cuniniculus) | Gonads | Hypharm | NZ1777 | New Zealand rabbits |
| Commercial kit | RNAscope kit | ACD | 322310 | 2.5HD assay-brown |
| Sequence-based reagent | RNAscope probe anti-DMRT1 | ACD | 410481 | XM_002708188.1 |
| Sequence-based reagent | RNAscope probe anti-SRY | ACD | 803191 | AY785433.1 |
| Sequence-based reagent | RNAscope probe anti-POU5F1 | ACD | 513271 | NM_001099957.1 |
| Sequence-based reagent | RNAscope probe anti-RSPO1 | ACD | 488231 | XM_002720657.2 |
| Antibody | Anti-DMRT1 (mouse monoclonal) | Santa Cruz | sc-377167 | IHC (1:500) IF (1:200) WB (1:100) |
| Antibody | Anti-SOX9 (rabbit polyclonal) | Francis Poulat | IHC (1:500) IF (1:200) | |
| Antibody | Anti-FOXL2 (rabbit polyclonal) | Boulanger et al., 2014 | IHC (1:500) | |
| Antibody | Anti-POU5F1 (goat polyclonal) | Santa Cruz | sc-8628 | IHC (1:500) IF (1:200) |
| Antibody | Anti-PAX8 (rabbit polyclonal) | Proteintech | 10226-1-AP | IHC (1:6000) |
| Antibody | Anti-Ki67 (rabbit monoclonal) | Thermo Scientific | MA5-14520 | IHC (1:500) |
| Sequence-based reagent | SRY_F | This paper | PCR primers | TGCTTACACACCAGCCAAACA |
| Sequence-based reagent | SRY_R | This paper | PCR primers | TTCCTGGCCGCTCACTTTAC |
| Sequence-based reagent | DMRT1_F | This paper | PCR primers | GGAGCCTCCCAGCACCTTA |
| Sequence-based reagent | DMRT1_R | This paper | PCR primers | TGCATCCTGTACTGCGAACTCA |
| Sequence-based reagent | SOX9_F | This paper | PCR primers | GGCTCCGACACCGAGAATACAC |
| Sequence-based reagent | SOX9_R | This paper | PCR primers | GAACTTGTCCTCTTCGCTCTCCTT |
| Sequence-based reagent | CYP19A1_F | This paper | PCR primers | GGAAGAATGCATCGACTTGAGTT |
| Sequence-based reagent | CYP19A1_R | This paper | PCR primers | GGGCCCAAAACCAAATGGT |
| Sequence-based reagent | RSPO1_F | This paper | PCR primers | GCCCGCCTGGATACTTCGA |
| Sequence-based reagent | RSPO1_R | This paper | PCR primers | GGTGCAGAAGTTGTGGCTGAA |
| Sequence-based reagent | FOXL2_F | This paper | PCR primers | TTTCCCCTTTCCCCCATCTG |
| Sequence-based reagent | FOXL2_R | This paper | PCR primers | CTGAACCTTGCACCCAGCAT |
| Sequence-based reagent | AMH_F | This paper | PCR primers | GCTCATCCCCGAGACCTAC |
| Sequence-based reagent | AMH_R | This paper | PCR primers | CATCTTCAACAGCAGCACC |
| Sequence-based reagent | DHH_F | This paper | PCR primers | GCAATAAGTACGGGCTGCTG |
| Sequence-based reagent | DHH_R | This paper | PCR primers | GGCCAGGGAGTTATCAGCTT |
| Software | qBase+ | Biogazelle | ||
| Software | GraphPad Prism | GraphPad Software |
Primers used for genotyping PCR or quantitative RT-PCR (RT-qPCR) analyses.
| Gene | Forward (5′–3′) | Reverse (3′–5′) |
|---|---|---|
| Genotyping PCR | ||
| DMRT1 | TTTGAGCTGTGTCCCCAGAGT | ACCTCCCCAGAAGAAGAATCG |
| SRY | GTTCGGAGCACTGTACAGCG | GCGTTCATGGGTCGCTTGAC |
| RT-qPCR analyses | ||
| SRY | TGCTTACACACCAGCCAAACA | TTCCTGGCCGCTCACTTTAC |
| DMRT1 | GGAGCCTCCCAGCACCTTA | TGCATCCTGTACTGCGAACTCA |
| SOX9 | GGCTCCGACACCGAGAATACAC | GAACTTGTCCTCTTCGCTCTCCTT |
| CYP19A1 | GGAAGAATGCATCGACTTGAGTT | GGGCCCAAAACCAAATGGT |
| ESR1 | TCCTCATCCTCTCCCACATC | AGCATCTCCAGCAACAGGTC |
| RSPO1 | GCCCGCCTGGATACTTCGA | GGTGCAGAAGTTGTGGCTGAA |
| FOXL2 | TTTCCCCTTTCCCCCATCTG | CTGAACCTTGCACCCAGCAT |
| AMH | GCTCATCCCCGAGACCTAC | CATCTTCAACAGCAGCACC |
| DHH | GCAATAAGTACGGGCTGCTG | GGCCAGGGAGTTATCAGCTT |
| H2AFX | ACCTGACGGCCGAGATCCT | CGCCCAGCAGCTTGTTGAG |
| YWHAZ | GGGTCTGGCCCTTAACTTCTCT | AGCAATGGCTTCATCAAAAGC |
| SF1 (splicing factor 1) | GCTTCCGACTGCAAATTCCA | TCACCCAGTTCAGCCATGAG |
Synthesized probes used for in situ hybridization.
| Gene name | RNAscope probe catalog number | Transcript accession number |
|---|---|---|
| DMRT1 | 410481 | XM_002708188.1 |
| SRY | 803191 | AY785433.1 |
| POU5F1 | 513271 | NM_001099957.1 |
| RSPO1 | 488231 | XM_002720657.2 |
List of antibodies used for immunohistochemistry (IHC), immunofluorescence (IF), or western blot (WB).
| Antibody name | Reference | Dilution | |
|---|---|---|---|
| Primary antibodies | Mouse monoclonal to DMRT1 | sc-377167 (Santa Cruz) | 1/500 (IHC); 1/200 (IF); 1/100 (WB) |
| Rabbit polyclonal to SOX9 | Francis Poulat | 1/500 (IHC); 1/200 (IF) | |
| Rabbit polyclonal to FOXL2 | Boulanger et al., 2014 | 1/500 (IHC) | |
| Goat polyclonal to POU5F1 | sc-8628 (Santa Cruz) | 1/500 (IHC); 1/200 (IF) | |
| Rabbit polyclonal to PAX8 | 10336-1-AP (Proteintech) | 1/6000 (IHC) | |
| Rabbit monoclonal to Ki67 | MA5-14520 (Thermo Scientific) | 1/500 (IHC) | |
| Biotinylated secondary antibodies (IHC) | Horse anti-rabbit | BA-1100 (Vector Laboratories) | 1/200 |
| Anti-mouse | Included in M.O.M. kit (BMK-2202, Vector Laboratories) | 1/200 | |
| Horse anti-goat | BA-9500 (Vector Laboratories) | 1/200 | |
| Secondary antibodies (IF) | Poly HRP-conjugated goat anti-rabbit | B40944 (Invitrogen) | No diluted |
| DyLight 488 goat anti-mouse | 072-03-18-06 (KPL) | 1/200 | |
| Alexa Fluor 594 chicken anti-goat | A21468 (Life technologies) | 1/200 |
Additional files
-
Supplementary file 1
List of DEGs in DMRT1−/− gonads (XY and XX) compared to control gonads (XY and XX) (adjusted p-value <0.05 and |log2FC| > 1).
List of deregulated genes (DEGs) between KO-XY vs Control-XY gonads (sheet 1), KO-XY vs KO-XY gonads (sheet 2), KO-XX vs Control-XX gonads (sheet 3), and Control-XY vs Control-XX gonads (sheet 4). The gene name of DEGs was based on their annotation or human homology (Craig et al., 2012).
- https://cdn.elifesciences.org/articles/89284/elife-89284-supp1-v2.xlsx
-
Supplementary file 2
Clustering and expression values (TPM, transcripts per million) of the 3460 DEGs.
Cluster membership of the 3460 DEGs with their expression data (TPM) according to the four genotypes (XY control, XY DMRT1−/−, XX DMRT1−/−, XX control).
- https://cdn.elifesciences.org/articles/89284/elife-89284-supp2-v2.xlsx
-
MDAR checklist
- https://cdn.elifesciences.org/articles/89284/elife-89284-mdarchecklist1-v2.docx