1. Developmental Biology
  2. Genetics and Genomics

Rescuable sleep and synaptogenesis phenotypes in a Drosophila model of O-GlcNAc transferase intellectual disability

  1. Ignacy Czajewski
  2. Bijayalaxmi Swain
  3. Jiawei Xu
  4. Laurin McDowall
  5. Andrew T Ferenbach
  6. Daan MF van Aalten  Is a corresponding author
  1. Division of Molecular, Cell and Developmental Biology, School of Life Sciences, University of Dundee, United Kingdom
  2. Section of Neurobiology and DANDRITE, Department of Molecular Biology and Genetics, Aarhus University, Denmark
https://doi.org/10.7554/eLife.90376
Share this article
Cite this article
  1. Ignacy Czajewski
  2. Bijayalaxmi Swain
  3. Jiawei Xu
  4. Laurin McDowall
  5. Andrew T Ferenbach
  6. Daan MF van Aalten
(2024)
Rescuable sleep and synaptogenesis phenotypes in a Drosophila model of O-GlcNAc transferase intellectual disability
eLife 13:e90376.
https://doi.org/10.7554/eLife.90376
  2. Download BibTeX
  3. Download .RIS
7 figures, 2 tables and 1 additional file

Figures

Figure 1 with 1 supplement
Download asset Open asset
Variants affecting the calytic domain of OGT reduce O-GlcNAcylation throughout development.

(A) Representative western blot of sxcWT (n = 8), sxcC941Y (n = 8), and sxcN595K (n = 6) adult head lysates and quantification (mean ± standard deviation) of OGT and O-GlcNAcylation immunoreactivity normalised to the both the loading and genotype control. Clostridium perfringens OGA (CpOGA)-treated lanes demonstrate the specificity of the O-GlcNAc antibody (RL2) used compared to lysates treated with the OGA inhibitor GlcNAc statin G (GG). A significant intergroup difference in O-GlcNAcylation was observed (F(2,19) = 42.82, p<0.001), with post hoc analysis revealing a significant reduction in O-GlcNAcylation in both sxcN595K (padj<0.05) and sxcC941Y (padj<0.001) flies relative to the control genotype, and a significant difference between the mutant strains (padj<0.001). A significant intergroup difference was also observed for OGT levels (F(2,19) = 9.137, p<0.01); however, post hoc analysis revealed this was only due to a significant increase in OGT in sxcC941Y flies (padj<0.01). (B) Representative western blot of sxcWT (n = 6), sxcC941Y (n = 6), and sxcK872M (n = 6) lysates from stage 16–17 embryos along with OGT and O-GlcNAc quantification. A significant decrease in O-GlcNAcylation (F(2,14) = 8.014, p<0.01) was observed for both sxcC941Y (padj<0.01) and sxcK872M (padj<0.05) embryos, accompanied by a significant increase in OGT (F(2,14) = 9.49, p<0.01) for both genotype (padj<0.01 and padj<0.05, respectively). (C) Representative western blot and quantification of lysates from sxcWT (n = 6), sxcC941Y (n = 5), and sxcK872M (n = 6) third-instar larvae, demonstrating a significant decrease in O-GlcNAcylation for both sxcC941Y and sxcK872M larvae (F(2,14) = 184.5, p<0.001, padj<0.001 and padj<0.001, respectively) and a decrease in OGT in sxcK872M larvae (F(2,14) = 122.6, p<0.001, padj<0.001). *p<0.05, **p<0.01, ***p<0.001.

Figure 1—source data 1

Quantification of OGT and O-GlcNAc immunoreactivity normalised to the loading control and the mean value of the control (Figure 1A–C).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig1-data1-v3.xlsx
Figure 1—source data 2

Raw images of scans of western blots (Figure 1A–C).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig1-data2-v3.zip
Figure 1—source data 3

Uncropped scans of western blots with relevant bands/regions indicated (Figure 1A–C).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig1-data3-v3.zip
Figure 1—figure supplement 1
Download asset Open asset
Penetrance of supernumerary scutellar bristles in sxcC941Y flies.

(A) Quantification of the number of bristles on the scutellum of sxcWT (n = 566) and sxcC941Y (n = 344) flies, represented as a percentage of total flies included in quantification. (B) As for (A), comparing the number of bristles for sxcWT (n = 136), sxcC941Y (n = 123), sxcC941Y;OgaKO (n = 83), and OgaKO flies (n = 92).

Figure 1—figure supplement 1—source data 1

Quantification of scutellar bristle number (Figure 1—figure supplement 1).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig1-figsupp1-data1-v3.xlsx
Figure 2 with 1 supplement
Download asset Open asset
Genetic and phamacological rescue of O-GlcNAcylation in sxcC941Y flies.

(A) Representative western blot (of three) of sxcWT, sxcC941Y, sxcC941Y;OgaKO and OgaKO adult head lysates, immunolabelled with RL2 to detect O-GlcNAcylation and actin as a loading control. (B) Western blot and quantification of adult head lysates of sxcWT, sxcC941Y vehicle, sxcC941Y fed 3 mM Thiamet G (TMG) and sxcC941Y fed 5 mM TMG (n = 3), immunolabelled for O-GlcNAcylation using the RL2 antibody, OGT, and actin as a loading control. A significant intergroup difference was observed for both O-GlcNAcylation (F(3,8) = 20.86, p<0.001) and OGT (F(3,8) = 27.28, p<0.001) levels, with post hoc analysis revealing that O-GlcNAcylation and OGT levels were not significantly different between sxcWT flies and sxcC941Y flies fed 3 mM TMG (padj=0.75 and padj=0.57, respectively). Both sxcC941Y flies fed a vehicle control and 5 mM TMG present with significantly different O-GlcNAcylation (padj<0.001 and padj<0.01, respectively) and OGT (padj<0.01 and padj<0.05, respectively) levels. (C) Western blot and quantification of third-instar larval lysates of sxcWT, sxcC941Y vehicle, sxcC941Y fed 150 μM TMG and sxcC941Y fed 200 μM TMG (n = 3), immunolabelled for O-GlcNAcylation using the RL2 antibody and actin as a loading control. O-GlcNAcylation significantly differed between groups (F(3,8) = 9.11, p<0.01), with both 150 μM and 200 μM TMG rescuing O-GlcNAcylation levels in sxcC941Y larvae to be no longer significantly different relative to the control genotype (padj=0.31 and padj=0.98, respectively) and 200 μM TMG treatment significantly elevating O-GlcNAcylation relative to the untreated sxcC941Y larvae (padj<0.05). *p<0.05, **p<0.01, ***p<0.001.

Figure 2—source data 1

Raw images of scans of Western blots (Figure 2A–C).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig2-data1-v3.zip
Figure 2—source data 2

Uncropped scans of Western blots with relevant bands/regions indicated (Figure 2A–C).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig2-data2-v3.zip
Figure 2—figure supplement 1
Download asset Open asset
Non-isometric increase in O-GlcNAcylation in Thiamet G fed flies.

(A) Log2 fraction of linear profile of O-GlcNAc immunoreactivity from the western blot in Figure 2B of sxcC941Y vehicle (CY untreated), 3 mM Thiamet G (TMG) (CY 3 mM TMG), and 5 mM TMG (CY 5 mM TMG) relative to the sxcWT control (normalised to a loading control). Generated using a custom Python script to calibrate molecular weights to a curve fitted to the protein ladder. (B) Coomassie stain of lysates used for the Western blot in Figure 2B, and linear profile as in (A, C).

Figure 3 with 2 supplements
Download asset Open asset
Variants affecting the catalytic domain of OGT impair neuromuscular junction development.

(A) Representative images of larval neuromuscular junctions (NMJs) immunolabelled with anti-HRP (red), anti-Discs Large 1 (cyan) and both (scale bars 25 μm) for sxcWT (n = 13), sxcC941Y (n = 19), sxcC941Y;OgaKO (n = 14), sxcK872M (n = 8), sxcK872M;OgaKO (n = 7), and OgaKO (n = 13) larvae. In the sxcC941Y;OgaKO panel, the closed arrow indicates 1b boutons, analysed here, while the open arrow indicates an example of 1 s boutons, not analysed here. (B) Quantification of NMJ area (mean ± SD), which was found to be significantly different between genotypes (F(5,68) = 23.05, p<0.001). Relative to the sxcWT control, both sxcC941Y and sxcK872M larvae presented with a smaller NMJ area (padj<0.01 and padj<0.001, respectively), which was partially rescued in the sxcC941Y;OgaKO strain (padj=0.14), though the OgaKO larvae did not present with a significantly increased NMJ area (padj=0.97). (C) Quantification of NMJ length (mean ± SD), which was found to be significantly different between genotypes (F(5,68) = 17.75, p<0.001). Relative to the control genotype, both sxcC941Y and sxcK872M larvae presented with overall shorter NMJ length (padj<0.001 for both), while NMJ length was not significantly different in sxcC941Y;OgaKO larvae (padj=0.13), despite OgaKO NMJ length not being affected (padj=0.99). (D) Bouton number (mean ± SD) is significantly reduced in sxcC941Y and sxcK872M larvae (F(5,68) = 18.11, p<0.001, padj<0.001 for both), and remains significantly reduced in sxcC941Y;OgaKO larvae (padj<0.05). Values for individual NMJs are represented as small grey points, with averages for each larva represented as larger coloured points. Descriptive and inferential statistics were performed on larval averages, *p<0.05, **p<0.01, ***p<0.001.

Figure 3—source data 1

Neuromuscular junction morphological parameters (Figure 3B–D).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig3-data1-v3.csv
Figure 3—figure supplement 1
Download asset Open asset
Reduced neuromuscular junction growth is not due to reduced muscle size nor allele dependent.

(A) Muscle area from sxcWT (n = 9, mean ± standard deviation 0.036 ± 0.005 mm2) and sxcK872M (n = 7, 0.033 ± 0.004 mm2, F(1,14) = 1.297, p=0.27) larvae is not significantly different. When normalised to muscle area, neuromuscular junction (NMJ) area in sxcK872M larvae (0.0052 + 0.0004 µm2/µm2) is significantly reduced compared to sxcWT larvae (0.0071 ± 0.0012 µm2/µm2, F(1,14) = 16.82, p<0.01). (B) Representative images of larval NMJs immunolabelled with anti-HRP (red), anti-Discs Large 1 (cyan), and both (scale bars 25 μm) for sxcWT and sxcH596F larvae. (B–D) Quantification of NMJ parameters quantified using a semi-automated ImageJ plugin for sxcWT (n = 9) and sxcH596F (n = 9) larvae, area (sxcWT: 304 ± 18 µm2, sxcH596F: 260 ± 23 µm2, F(1,16) = 20.54, p<0.001) (B), length (sxcWT: 111 ± 12.8 µm, sxcH596F: 94.2 ± 12.3 µm, F(1,16) = 7.694, p<0.05) (C), and bouton number (sxcWT: 18.5 ± 1.7, sxcH596F: 16.3 ± 1.9, F(1,16) = 6.864, p<0.05) (D) are all significantly different between the two genotypes. Values for individual NMJs are represented by small grey points, with averages for each larva represented as larger coloured points. Descriptive and inferential statistics were performed on larval averages. *p<0.05, **p<0.01, ***p<0.001.

Figure 3—figure supplement 1—source data 1

Neuromuscular junction morphological parameters (Figure 3—figure supplement 1A–E).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig3-figsupp1-data1-v3.xlsx
Figure 3—figure supplement 2
Download asset Open asset
Neuronal overexpression of sxc partially rescues neuromuscular junction defects caused by loss of OGT catalytic activity.

(A) Representative images of neuromuscular junction (NMJ) Discs large 1 immunostaining of sxcK872M; elavL3>Gal4 (elav>Gal4, n = 5), sxcK872M; elavL3>Gal4/UAS:sxc (elav>sxc, n = 7), sxcK872M; mhc>Gal4 (mhc>Gal4, n = 5), sxcK872M; mhc>Gal4/UAS:sxc (mhc>sxc, n = 5), and sxcK872M; UAS:sxc-HA (uas:sxc, n = 6) larvae (scale bars 25 μm). (B) NMJ area (mean ± SD) is significantly increased in elav>sxc (246 ± 20 µm2) larvae compared to the Gal4 control (elav>Gal4: 180 ± 37 µm2) (F(4,23) = 5.484, p<0.01, padj<0.05) and relative to uas:sxc larvae (170 ± 32 µm2, padj<0.01). Conversely, sxc overexpression in muscle cells (mhc>sxc: 198 ± 30 µm2) had no effect relative to the Gal4 control (mhc>Gal4: 201 ± 39 µm2) (padj = 0.99). (C) NMJ length was not significantly affected by genotype (F(4,23) = 2.073, p=0.12) (elav>Gal4: 70 ± 13 µm, elav>sxc: 70 ± 11 µm, mhc>Gal4: 58 ± 12 µm, mhc>sxc: 57 ± 13 µm, uas:sxc: 58 ± 10 µm). (D) NMJ bouton number was not significantly affected by genotype (F(4,23) = 2.028, p=0.12) (elav>Gal4: 11.8 ± 1.6, elav>sxc: 11.7 ± 2.6, mhc>Gal4: 9.4 ± 1.7, mhc>sxc: 9.4 ± 2.1, uas:sxc: 10.7 ± 1.2). Values for individual NMJs represented as small grey points, with averages for each larva represented as larger coloured points. Descriptive and inferential statistics were performed on larval averages, *p<0.05, **p<0.01.

Figure 3—figure supplement 2—source data 1

Neuromuscular junction morphological parameters (Figure 3—figure supplement 2B–D).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig3-figsupp2-data1-v3.csv
Figure 4
Download asset Open asset
Thiamet G partially rescues neuromuscular junction defects in sxcC941Y larvae.

(A) Representative images of neuromuscular junctions (NMJs) immunolabelled with anti-HRP (red), anti-Discs Large 1 (cyan), and both (scale bars 25 μm) for sxcWT (n = 11), sxcC941Y (n = 14), and sxcC941Y fed 200 μM TMG (n = 13). (B) NMJ area (mean ± SD) is significantly reduced in sxcC941Y larvae fed a vehicle control (F(2,35) = 5.264, p=0.01, padj<0.01), relative sxcWT larvae. sxcC941Y larvae fed 200 μM TMG no longer present with a significant reduction in total NMJ area (padj=0.54). (C) Total NMJ length (median ± IQR) is significantly different between groups (Χ2(2) = 17.483, p<0.001); however, unlike total area, post hoc analysis demonstrates that this parameter remains significantly reduced compared to the sxcWT control for both vehicle and TMG treated sxcC941Y larvae (padj<0.001 and padj<0.01, respectively). (D) Quantification of bouton number (mean ± SD) demonstrated a significant intergroup difference (F(2,35) = 13.6, p<0.001), with both vehicle and TMG fed sxcC941Y larvae presenting with significantly reduced bouton number (padj<0.001 and padj<0.01, respectively). Values for individual NMJs represented as small grey points, with averages for each larva represented as larger coloured points. Descriptive and inferential statistics were performed on larval averages, *p<0.05, **p<0.01, ***p<0.001.

Figure 4—source data 1

Neuromuscular junction morphological parameters (Figure 4B–D).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig4-data1-v3.csv
Figure 5
Download asset Open asset
Fragmented sleep in a Drosophila model of OGT-CDG.

(A) Activity profile (mean ± SEM of activity counts in 30 min bins) for sxcWT (n = 89), sxcC941Y (n = 94), sxcC941Y;OgaKO (n = 74), and OgaKO (n = 95) flies. (B) Sleep profile (mean ± SEM of sleep in 30 min bins) for genotypes as in (A). (C–G) Sleep parameters for genotypes in (A) and (B). (C) Total daily activity (median ± IQR) is significantly reduced in the sxcC941Y;OgaKO mutant strain relative to the control (Χ2(3) = 41.546, p<0.001, padj<0.001). (D) Total daily sleep (mean ± SD) is significantly reduced in sxcC941Y flies relative to the control genotype (F(3,348) = 18.34, p<0.001, padj<0.001), while both sxcC941Y;OgaKO and OgaKO flies do not have significantly altered total sleep (padj=0.58 and padj=0.99, respectively). (E) Mean sleep episode duration (median ± IQR) is significantly reduced in both sxcC941Y and sxcC941Y;OgaKO flies relative to the control genotype during the day (Χ2(3) = 83.8, p<0.001, padj<0.001 and padj<0.01, respectively) and night (Χ2(3) = 52.0, p<0.001, padj<0.001 and padj<0.01, respectively). Mean sleep episode duration is significantly increased in sxcC941Y;OgaKO flies compared to sxcC941Y flies both during the day and night (padj<0.05 and padj<0.001, respectively). (F) Daily number of sleep bouts (mean ± SD) is significantly elevated in both sxcC941Y and sxcC941Y; OgaKO flies compared to the sxcWT control (F(3,696) = 20.31 p<0.001, padj<0.001 for both) while time of day had no significant effect on the number of sleep bouts (F(1,696) = 0.099, p=0.75). Post hoc analysis revealed that relative to the sxcWT control, the number of sleep bouts was significantly increased for sxcC941Y and sxcC941Y;OgaKO flies both during the day (padj<0.01 and padj<0.001) and night (padj<0.001 and padj<0.001). (G) Daily number of sleep bouts longer than 2 hr (median ± IQR) is significantly lower in sxcC941Y flies than the control genotype (Χ2(3) = 49.623, p<0.001, padj<0.001). Individual points represent mean values of measurements conducted over 3 days, for unique flies. *p<0.05, **p<0.01, ***p<0.001.

Figure 5—source data 1

Raw DAM data and associated metadata (Figure 5A–G).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig5-data1-v3.zip
Figure 5—source data 2

SCAMP output for individual flies including total sleep, total activity, mean sleep bout duration, and sleep bout number averaged over 3 days (Figure 5C–F).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig5-data2-v3.xlsx
Figure 6 with 1 supplement
Download asset Open asset
Thiamet G partially rescues sleep in adult sxcC941Y flies.

Sleep parameters for sxcWT (n = 63), sxcC941Y (n = 57), and sxcC941Y flies fed 3 mM Thiamet G (TMG) (n = 60).(A) Total sleep (mean ± SD) is not significantly different between groups (F(2,177) = 0.249, p=0.78). (B) Mean sleep bout duration (median ± IQR) significantly differs between groups during the day (Χ2(2) = 12.854, p<0.01) and night (Χ2(2) = 6.5027, p<0.05), though it is only significantly reduced for sxcC941Y flies fed the vehicle control (padj=0.001 and padj<0.05) and not TMG (padj=0.07, padj=0.48). (C) Daily number of sleep bouts is significantly different across groups (F(2,354) = 16.775, p<0.001) and times of day (F(2,354) = 37.446, p<0.001). Post hoc analysis reveals that compared to the sxcWT genotype, sxcC941Y flies fed a vehicle control present with significantly more sleep bouts both during the day and at night (padj<0.001 for both) while the same genotype fed TMG supplemented food did not present with a significantly different number of sleep bouts (padj=0.33 and padj=0.52). (D) The number of sleep bouts longer than 2 hr is significantly reduced in sxcC941Y flies fed a vehicle control, but not TMG (Χ2(2) = 8.2491, p<0.05, padj<0.05 and padj=0.3, respectively). Individual points represent mean values of measurements conducted over 3 days, for unique flies. *p<0.05, **p<0.01, ***p<0.001.

Figure 6—source data 1

Raw DAM data and associated metadata (Figure 6A–D).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig6-data1-v3.zip
Figure 6—source data 2

SCAMP output for individual flies including total sleep, mean sleep bout duration, and sleep bout number averaged over 3 days (Figure 6A–C).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig6-data2-v3.xlsx
Figure 6—source data 3

OD625 of lysed flies fed food with Blue Dye no 1, either with or without Thiamet G.

https://cdn.elifesciences.org/articles/90376/elife-90376-fig6-data3-v3.csv
Figure 6—figure supplement 1
Download asset Open asset
Thiamet G supplementation does not alter total feeding in adult flies.

Optical density at 625 nm (OD625) of lysates from adult sxcC941Y flies fed blue dye no.1 in food along with either 3 mM Thiamet G (TMG) or a vehicle control, and the control genotype. No significant effect was detected in this experiment (F(2,36) = 0.34, p=0.714). There was neither an effect of genotype on dye ingestion (padj=0.85) nor was there an effect of adding 3 mM TMG to food of sxcC941Y flies (padj=0.95).

Figure 7
Download asset Open asset
Glial knockdown of sxc partially phenocopies sxcC941Y sleep defects.

Quantification of sleep parameters in flies expressing sxc RNAi under the control of either the neuronal elav promoter (n = 42) or the glial repo promoter (n = 54). (A) Total sleep is significantly (χ2(4) = 105.98, p<0.001) reduced by sxc knockdown in glial cell, compared to both to the repo >GAL4 (n = 30, padj<0.01) and UAS (n = 45, padj<0.001) control lines. (B) Mean sleep episode duration is only significantly reduced in repo>sxc RNAi flies during the night, compared to both the UAS and GAL4 control lines (χ2(4) = 67.073, p<0.001, padj<0.001 and padj<0.05, respectively). (C) Daily number of sleep episodes is not significantly affected by genotype (F(4, 127) = 1.368, p=0.24); however, there is a significant effect of time of day on sleep (F(4, 127) = 5.656, p<0.05). There is also a significant interaction between genotype and time of day with regards to number of sleep bouts (F(4, 127) = 10.747, p<0.001), which can be explained by a significant decrease in number of sleep bouts during the day in neuronal sxc knockdown flies compared to both the elav>GAL4 (n = 29, padj<0.01) and UAS (padj<0.01) control lines. Conversely, neuronal sxc knockdown flies present with significantly more sleep bouts during the night, compared to these control lines (padj<0.05 and padj<0.01, respectively). (D) The daily number of sleep episodes longer than 2 hr is also reduced with glial sxc knockdown (χ2(4) = 81.215, p<0.001), but only compared to the UAS control line (padj<0.001) and not the GAL4 control line (padj=0.3). *p<0.05, **p<0.01, ***p<0.001.

Figure 7—source data 1

Raw DAM data and associated metadata (Figure 7A–H).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig7-data1-v3.zip
Figure 7—source data 2

SCAMP output for individual flies including total sleep, mean sleep bout duration, and sleep bout number averaged over 3 days (Figure 7A–C).

https://cdn.elifesciences.org/articles/90376/elife-90376-fig7-data2-v3.xlsx

Tables

Key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Drosophila melanogaster)sxcFlyBaseFLYB: FBgn0261403
Gene (D. melanogaster)OgaFlyBaseFLYB: FBgn0261403
Strain, strain background (D. melanogaster)w1118 (VDRC60000)Vienna Drosophila Resource CenterVDRC60000
Genetic reagent (D. melanogaster)vas-Cas9Bloomington Drosophila Stock CenterBL51323
Genetic reagent (D. melanogaster)sxcK872MMariappa et al., 2018FLYB: FBal0340183
Genetic reagent (D. melanogaster)OgaKOMuha et al., 2020FLYB: FBal0361594
Genetic reagent (D. melanogaster)sxcN595KPravata et al., 2019FLYB: FBal0352246
Genetic reagent (D. melanogaster)sxcH596FFenckova et al., 2022FLYB: FBal0375027
Genetic reagent (D. melanogaster)sxc RNAiVienna Drosophila Resource CenterVDRC110717
Genetic reagent (D. melanogaster)elav-GAL4Bloomington Drosophila Stock CenterBL8765
Genetic reagent (D. melanogaster)repo-GAL4Kind gift from Leeanne McGurk
Genetic reagent (D. melanogaster)mhc- GAL4Bloomington Drosophila Stock CenterBDSC_55133
Genetic reagent (D. melanogaster)elavL3-GAL4Kind gift from Leeanne McGurkRRID:BDSC_8760
Genetic reagent (D. melanogaster)UAS:sxc-HAMariappa et al., 2015
AntibodyRL2, anti-O-GlcNAc (mouse monoclonal)NovusCat# NB300-5241:1000
AntibodyAnti-OGT (rabbit polyclonal)AbcamCat# ab-967181:1000
AntibodyAnti-Actin (rabbit polyclonal)SigmaCat# A20661:5000
AntibodyAnti-Discs Large 1 (mouse polyclonal)DSHBRRID:AB_5282031:25
AntibodyAnti-HRP conjugated to Alexa Fluor 647 (goat polyclonal)Jackson ImmunoResearchRRID:AB_5282031:400
AntibodyAnti-rabbit IgG 680 infrared conjugated (donkey polyclonal)LI-CORRRID:AB_27166871:10,000
AntibodyAnti-mouse IgG 800 infrared conjugated (goat polyclonal)LI-CORRRID:AB_26878251:10,000
AntibodyAnti-mouse conjugated to Alexa Fluor 488 (donkey polyclonal)Molecular ProbesA212021:400
Recombinant DNA reagentpCFD3-dU63gRNAAddgene
Peptide, recombinant proteinCpOGA (GST tagged)Rao et al., 2006Produced in-house
Chemical compound, drugThiamet GSantaCruzCat# sc-224307
Chemical compound, drugNuPage LDSThermo FisherCat# NP0007
Chemical compound, drugDako mounting mediaAgilentCat# S302380-2
Chemical compound, drugGlcNAcstatin GDorfmueller et al., 2010Produced in-house
Chemical compound, drugBlue dye no. 1Sigma861146
Software, algorithmImage Studio Litehttps://www.licor.com/bio/image-studio/
Software, algorithmDAMFileScan113https://www.trikinetics.com/
Software, algorithmPython 3https://www.python.org/
Software, algorithmR (4.0.3)https://www.r-project.org/
Software, algorithmImageJ-FIJIhttps://imagej.net/software/fiji/
Software, algorithmSCAMPDonelson et al., 2012
Software, algorithmRethomicsGeissmann et al., 2019
Software, algorithmDrosophila_NMJ_MorphometricsNijhof et al., 2016
Software, algorithmWBplotProfileThis paper, Czajewski, 2024Code can be obtained from: https://github.com/IgnacyCz/WBplotProfile
OtherConfocal microscopeZeiss710Section ‘Neuromuscular junction immunohistochemistry’
OtherConfocal microscopeZeiss980Section ‘Neuromuscular junction immunohistochemistry’ (Neuronal overexpression of sxc partially rescues neuromuscular junction defects caused by loss of OGT catalytic activity)
OtherDissection microscopeMoticSMZ-161Section ‘Scutellar bristle assay’
OtherDAM2 monitortrikineticshttps://trikinetics.com/Section ‘Drosophila activity monitor’
Table 1
List of oligonucleotides used in CRISPR-Cas9 mutagenesis section.
DesignationSequence
gRNA annealing oligonucleotide (forward)GTCGCTTGATACTCCTTTATGCAA
gRNA annealing oligonucleotide (reverse)AAACTTGCATAAAGGAGTATCAAG
Repair template cloning primer (forward)aaaGGATCCTTTCGACACAAAATCAGTCGAGAGTCTG
Repair template cloning primer (reverse)aaaGCGGCCGCGGTAGCCAGCTGAGAGGCAGCCAC
Repair template mutagenesis primer 1 (silent) (forward)GGGGTCAATTAGCTGATATATGTCTTGATACgCCgcTgTcgAATGGGCATACA
ACATCTATGGACGTTTTG
Repair template mutagenesis primer 1 (silent) (reverse)CAAAACGTCCATAGATGTTGTATGCCCATTcgAcAgcGGcGTATCAAGACATAT
ATCAGCTAATTGACCCC
Repair template mutagenesis primer 2 (C941Y mutation) (forward)GTCAATTAGCTGATATATacCTTGATACGCCGCTGTgtAATGGGCATACAACATCTATG
Repair template mutagenesis primer 2 (C941Y mutation) (reverse)CATAGATGTTGTATGCCCATTacACAGCGGCGTATCAAGgtATATATCAGCTAATTGAC

Additional files

MDAR checklist
https://cdn.elifesciences.org/articles/90376/elife-90376-mdarchecklist1-v3.docx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Ignacy Czajewski
  2. Bijayalaxmi Swain
  3. Jiawei Xu
  4. Laurin McDowall
  5. Andrew T Ferenbach
  6. Daan MF van Aalten
(2024)
Rescuable sleep and synaptogenesis phenotypes in a Drosophila model of O-GlcNAc transferase intellectual disability
eLife 13:e90376.
https://doi.org/10.7554/eLife.90376