Rescuable sleep and synaptogenesis phenotypes in a Drosophila model of O-GlcNAc transferase intellectual disability

Abstract
Editor's evaluation
Introduction
Results
Discussion
Materials and methods
Data availability
References
Article and author information

Abstract

O-GlcNAcylation is an essential intracellular protein modification mediated by O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA). Recently, missense mutations in OGT have been linked to intellectual disability, indicating that this modification is important for the development and functioning of the nervous system. However, the processes that are most sensitive to perturbations in O-GlcNAcylation remain to be identified. Here, we uncover quantifiable phenotypes in the fruit fly Drosophila melanogaster carrying a patient-derived OGT mutation in the catalytic domain. Hypo-O-GlcNAcylation leads to defects in synaptogenesis and reduced sleep stability. Both these phenotypes can be partially rescued by genetically or chemically targeting OGA, suggesting that a balance of OGT/OGA activity is required for normal neuronal development and function.

Editor's evaluation

This important study describes a model for O-GlcNac transferase (OGT) associated Intellectual Disability in Drosophila. The authors present convincing data showing that OGT mutant Drosophila exhibit defects in neuronal arborisation in development and behaviour (sleep) in adults. These results will be of interest to researchers and clinicians working on protein modifications and intellectual disability.

https://doi.org/10.7554/eLife.90376.sa0

Introduction

Intellectual disability (ID) is a disorder affecting around 1% of the population globally (McKenzie et al., 2016), characterised by an intelligence quotient lower than 70 accompanied by reduced adaptive behaviour (Salvador-Carulla et al., 2011). Recently, mutations in the X chromosome gene OGT were identified as causal for ID, a condition termed OGT congenital disorder of glycosylation (OGT-CDG) (Willems et al., 2017; Pravata et al., 2020b; Pravata et al., 2019; Pravata et al., 2020a; Vaidyanathan et al., 2017). Patients with OGT-CDG present with diverse signs of varying penetrance, such as microcephaly and white matter abnormalities, as well as non-neurological signs such as clinodactyly, facial dysmorphism, and developmental delay, manifesting as low birth weight and short stature (Pravata et al., 2020b). Beyond ID, non-morphological signs of pathogenic OGT mutations include behavioural problems as well as sleep abnormalities and epilepsy (Pravata et al., 2020b; Selvan et al., 2018).

OGT encodes a nucleocytoplasmic glycosyltransferase, O-linked β-N-acetyl glucosamine (O-GlcNAc) transferase (OGT), a multifunctional protein composed of two domains: a tetratricopeptide repeat (TPR) domain and a catalytic domain (Kreppel and Hart, 1999; Lubas et al., 1997; Kreppel et al., 1997). Mutations affecting either domain have been identified in patients with OGT-CDG, though clinical manifestation of the disorder does not appear to segregate with the domain affected (Pravata et al., 2020b), suggesting a common disease mechanism. The N-terminal TPR domain is believed to confer substrate specificity for the glycosyltransferase function of OGT (Iyer and Hart, 2003; Levine et al., 2018; Clarke et al., 2008) and is important for non-catalytic functions of the protein (Urso et al., 2020; Levine et al., 2021). The catalytic domain fulfils two known functions, the transfer of O-GlcNAc onto serine and threonine residues of nucleocytoplasmic proteins (O-GlcNAcylation) Torres and Hart, 1984; Holt et al., 1987, and the proteolytic activation of Host Cell Factor 1 (HCF-1) (Capotosti et al., 2011; Lazarus et al., 2013), a known ID-associated protein (Castro and Quintana, 2020). While the latter function of OGT potentially contributes to the pathogenicity of some OGT mutations (Pravata et al., 2019), not all patient mutations have been found to affect HCF-1 processing, neither in vitro nor when modelled in stem cells (Vaidyanathan et al., 2017; Selvan et al., 2018; Omelková et al., 2023). Overall, the role of altered O-GlcNAcylation in OGT-CDG pathogenicity remains an open question, as many of the other functions fulfilled by this protein have the potential to contribute to ID.

O-GlcNAcylation is a dynamic modification occurring on around 5000 proteins in the human proteome (Wulff-Fuentes et al., 2021). The dynamic nature of the modification is conferred by O-GlcNAcase (OGA), which opposes OGT, catalysing the removal of O-GlcNAc (Heckel et al., 1998; Gao et al., 2001). O-GlcNAcylation has been extensively implicated in neuronal development, functioning, and disease (Lee et al., 2021; Muha et al., 2021; Lagerlöf et al., 2017; Olivier-Van Stichelen et al., 2017; Chen et al., 2021; Kim et al., 2017) and is therefore likely to play a key role in the pathogenicity of OGT-CDG. The first evidence for the requirement for OGT in development was the study of Drosophila melanogaster OGT, super sex combs (sxc), as a Polycomb group (PcG) gene, amorphic mutations of which were found to result in defects in body segment determination (Ingham, 1984), a function later ascribed to its glycosyltransferase activity (Gambetta and Müller, 2014). The role of O-GlcNAcylation in PcG function is known to be important for normal neuronal development and highly sensitive to perturbations. For example, maternal hyperglycaemia can drive increased O-GlcNAcylation in the embryo altering neuronal maturation and differentiation patterns through altered PcG function (Parween et al., 2022). Multiple additional core developmental regulators have been found to require O-GlcNAcylation for appropriate function, with deregulation of the modification affecting stem cell maintenance through core pluripotency factors such as Sox2 (Kim et al., 2021a; Jang et al., 2012; Myers et al., 2016), cell fate determination through STAT3 (Fan et al., 2020), and Notch signalling (Chen et al., 2021) and neuronal morphogenesis through the protein kinase A signalling cascade (Francisco et al., 2009). Additionally, O-GlcNAcylation is known to play an important role in neuronal functioning related to memory formation (Muha et al., 2019; Taylor et al., 2014). For example, elevating O-GlcNAcylation in sleep-deprived zebrafish or mice can reverse memory defects associated with a lack of sleep (Lee et al., 2020; Kim et al., 2021b). The extent of the role of OGT in memory formation is not fully understood, although several proteins important for this process are modulated by O-GlcNAcylation, such as CREB (Rexach et al., 2012) or CRMP2 (Muha et al., 2019). Therefore, a key unanswered question regarding the aetiology of OGT-CDG is the contribution of the developmental roles of OGT relative to its role in the functioning of the adult nervous system.

With the large number of functionally O-GlcNAcylated proteins and thousands more which remain uncharacterised, identifying the most important processes controlled by O-GlcNAcylation remains challenging. Patient mutations in the catalytic domain present a unique opportunity to better understand processes most sensitive to defective O-GlcNAc cycling. Therefore, we set out to model catalytic domain ID mutations in Drosophila melanogaster and characterise their phenotypic effect. Drosophila OGT (DmOGT) is highly similar to its human ortholog, with 73% amino acid identity and a high degree of structural similarity (Mariappa et al., 2015). However, in the fly OGT does not catalyse HCF-1 proteolytic activation, a function fulfilled instead by taspase 1 (Capotosti et al., 2007), eliminating this function of OGT as a confounding variable in understanding the role of O-GlcNAcylation in ID. Previous work modelling OGT-CDG mutations in Drosophila has demonstrated that OGT-CDG catalytic domain mutations can reduce global O-GlcNAcylation in adult tissue (Pravata et al., 2019), which is linked with defects in habituation and synaptogenesis (Fenckova et al., 2022). Here, we demonstrate that a recently discovered ID-associated catalytic domain mutation in OGT (resulting in the amino acid substitution C921Y Omelková et al., 2023) can reduce O-GlcNAcylation throughout development in Drosophila, which can be rescued by genetically or pharmacologically abolishing or reducing OGA activity, respectively. We find a strong effect of sxc mutations on larval neuromuscular junction (NMJ) development, which can be partially reversed by inhibiting or abolishing OGA catalytic activity. Additionally, we demonstrate that a catalytic domain mutation in sxc can negatively impact sleep, reducing sleep bout duration. This phenotype can be rescued by abolishing OGA activity and partially reversed by inhibiting OGA in adulthood, suggesting that some aspects of OGT-CDG may not be developmental in origin.

Results

An OGT-CDG mutation reduces global O-GlcNAcylation throughout Drosophila development

To investigate the contribution of reduced O-GlcNAcylation to phenotypes relevant to OGT-CDG, catalytic domain mutations found in patients were modelled in Drosophila using CRISPR-Cas9 mutagenesis. The previously published sxc^N595K (equivalent to human N567K) Pravata et al., 2019 and the newly generated sxc^C941Y (equivalent to human C921Y) mutant strains were used to assay the effects of OGT-CDG mutations on global O-GlcNAcylation in adult flies. Consistent with previous reports, O-GlcNAcylation in lysates from adult heads was found to be significantly reduced in the sxc^N595K mutant compared to a control genotype (Figure 1A; Pravata et al., 2019). The newly generated sxc^C941Y mutant strain presented with a significantly more severe reduction in global O-GlcNAcylation, to roughly 40% of the control genotype. This reduction in O-GlcNAcylation was observed despite a modest, yet significant, increase in OGT protein relative to the control genotype. As the reduction in O-GlcNAcylation was modest in the sxc^N595K line, a previously generated catalytically dead mutant strain (sxc^K872M) was further characterised alongside the newly generated sxc^C941Y variant (Mariappa et al., 2018), to control for allele-specific effects. The sxc^K872M genotype was previously found to be recessive lethal at the late pupal stages (Mariappa et al., 2018); therefore, for this genotype O-GlcNAcylation and OGT levels were only assayed at embryonic and larval stages. Both sxc^C941Y and sxc^K872M stage 16–17 embryos present with significantly reduced O-GlcNAcylation and increased OGT (Figure 1B). As sxc^K872M embryos were derived from heterozygous parents, O-GlcNAcylation seen in these embryos is likely largely due to maternally contributed wildtype sxc gene product (Ingham, 1984; Sinclair et al., 2009). By the third-instar larval stage of development, the difference in O-GlcNAcylation between the sxc^C941Y and sxc^K872M genotypes is more pronounced. sxc^K872M larvae present with significantly lower O-GlcNAcylation than both the control and sxc^C941Y genotype (Figure 1C). O-GlcNAcylation in the sxc^C941Y larvae remains significantly reduced relative to the control genotype, as at all other stages of development assayed. Surprisingly, at this stage of development, sxc^C941Y larvae do not present with significantly elevated DmOGT protein levels. Strikingly, the mean DmOGT protein levels in sxc^K872M larvae are over eight times higher than in the control genotype.

Figure 1 with 1 supplement see all

Download asset Open asset

Variants affecting the calytic domain of OGT reduce O-GlcNAcylation throughout development.

(A) Representative western blot of *sxc^WT* (n = 8)*, sxc^C941Y* (n = 8), and *sxc^N595K* (n = 6) adult head lysates and quantification (mean ± standard deviation) of OGT and O-GlcNAcylation immunoreactivity normalised to the both the loading and genotype control. *Clostridium perfringens OGA* (CpOGA)-treated lanes demonstrate the specificity of the O-GlcNAc antibody (RL2) used compared to lysates treated with the OGA inhibitor GlcNAc statin G (GG). A significant intergroup difference in O-GlcNAcylation was observed (F(2,19) = 42.82, p<0.001), with post hoc analysis revealing a significant reduction in O-GlcNAcylation in both *sxc^N595K* (p_adj<0.05) and *sxc^C941Y* (p_adj<0.001) flies relative to the control genotype, and a significant difference between the mutant strains (p_adj<0.001). A significant intergroup difference was also observed for OGT levels (F(2,19) = 9.137, p<0.01); however, post hoc analysis revealed this was only due to a significant increase in OGT in *sxc^C941Y* flies (p_adj<0.01). (B) Representative western blot of *sxc^WT* (n = 6)*, sxc^C941Y* (n = 6), and *sxc^K872M* (n = 6) lysates from stage 16–17 embryos along with OGT and O-GlcNAc quantification. A significant decrease in O-GlcNAcylation (F(2,14) = 8.014, p<0.01) was observed for both *sxc^C941Y* (p_adj<0.01) and *sxc^K872M* (p_adj<0.05) embryos, accompanied by a significant increase in OGT (F(2,14) = 9.49, p<0.01) for both genotype (p_adj<0.01 and p_adj<0.05, respectively). (C) Representative western blot and quantification of lysates from *sxc^WT* (n = 6)*, sxc^C941Y* (n = 5), and *sxc^K872M* (n = 6) third-instar larvae, demonstrating a significant decrease in O-GlcNAcylation for both *sxc^C941Y* and *sxc^K872M* larvae (F(2,14) = 184.5, p<0.001, p_adj<0.001 and p_adj<0.001, respectively) and a decrease in OGT in *sxc^K872M* larvae (F(2,14) = 122.6, p<0.001, p_adj<0.001). *p<0.05, **p<0.01, ***p<0.001.

Figure 1—source data 1 Quantification of OGT and O-GlcNAc immunoreactivity normalised to the loading control and the mean value of the control (Figure 1A–C).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig1-data1-v3.xlsx
Download elife-90376-fig1-data1-v3.xlsx
Figure 1—source data 2 Raw images of scans of western blots (Figure 1A–C).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig1-data2-v3.zip
Download elife-90376-fig1-data2-v3.zip
Figure 1—source data 3 Uncropped scans of western blots with relevant bands/regions indicated (Figure 1A–C).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig1-data3-v3.zip
Download elife-90376-fig1-data3-v3.zip

To determine whether the phenotypic consequences of loss of O-GlcNAc transferase function in the sxc^C941Y mutant flies results in similar phenotypic consequences as a previously characterised Drosophila line carrying a hypomorphic mutation in sxc (sxc^H537A), flies were assayed for scutellar bristle development (Mariappa et al., 2018). sxc^C941Y flies were found to also present with an increased penetrance of ectopic bristles on the scutellum, with 31% of sxc^C941Y flies presenting with one or more additional bristles, while in the control genotype this only occurred in 8% of flies (Figure 1—figure supplement 1A). Taken together, these results demonstrate that hypo-GlcNAcylation due to OGT-CDG variants can be modelled in Drosophila. Further supporting the hypothesis that reduced OGT catalytic activity is causal in phenotypes seen in ID, a patient mutation modelled in Drosophila results in a similar phenotype as rational mutagenesis of a key DmOGT catalytic residue.

Pharmacological rescue of O-GlcNAc levels in sxc^C941Y flies

To evaluate whether reduced O-GlcNAcylation in sxc mutants with impaired catalytic activity can be rescued to control levels, we sought to elevate O-GlcNAcylation through both genetic and pharmacological means. First, to demonstrate that O-GlcNAcylation can be rescued in flies with impaired DmOGT catalytic activity by abolishing OGA activity, sxc mutant flies were crossed with an Oga knockout strain (Oga^KO) (Muha et al., 2020). When assayed by Western blot, we found that knocking out OGA led to a marked increase in O-GlcNAcylation in lysates from adult heads in the sxc^C941Y line, above levels seen in the control genotype (Figure 2A). To assay whether this rescue of O-GlcNAcylation could reverse a phenotype caused by reduced O-GlcNAc transferase activity, we compared the number of scutellar bristles in sxc^WT, sxc^C941Y, sxc^C941Y;Oga^KO, and Oga^KO flies. Surprisingly, we found that despite the Oga^KO allele having no effect on its own, sxc^C941Y;Oga^KO flies had an increased penetrance of ectopic scutellar bristles beyond what we observed for sxc^C941Y flies (Figure 1—figure supplement 1B).

Figure 2 with 1 supplement see all

Download asset Open asset

Genetic and phamacological rescue of O-GlcNAcylation in *sxc*^C941Y flies.

(A) Representative western blot (of three) of *sxc^WT, sxc^C941Y, sxc^C941Y;Oga^KO* and *Oga^KO* adult head lysates, immunolabelled with RL2 to detect O-GlcNAcylation and actin as a loading control. (B) Western blot and quantification of adult head lysates of *sxc^WT, sxc^C941Y* vehicle, *sxc^C941Y* fed 3 mM Thiamet G (TMG) and *sxc^C941Y* fed 5 mM TMG (n = 3), immunolabelled for O-GlcNAcylation using the RL2 antibody, OGT, and actin as a loading control. A significant intergroup difference was observed for both O-GlcNAcylation (F(3,8) = 20.86, p<0.001) and OGT (F(3,8) = 27.28, p<0.001) levels, with post hoc analysis revealing that O-GlcNAcylation and OGT levels were not significantly different between *sxc^WT* flies and *sxc^C941Y* flies fed 3 mM TMG (p_adj=0.75 and p_adj=0.57, respectively). Both *sxc^C941Y* flies fed a vehicle control and 5 mM TMG present with significantly different O-GlcNAcylation (p_adj<0.001 and p_adj<0.01, respectively) and OGT (p_adj<0.01 and p_adj<0.05, respectively) levels. (C) Western blot and quantification of third-instar larval lysates of *sxc^WT, sxc^C941Y* vehicle, *sxc^C941Y* fed 150 μM TMG and *sxc^C941Y* fed 200 μM TMG (n = 3), immunolabelled for O-GlcNAcylation using the RL2 antibody and actin as a loading control. O-GlcNAcylation significantly differed between groups (F(3,8) = 9.11, p<0.01), with both 150 μM and 200 μM TMG rescuing O-GlcNAcylation levels in *sxc^C941Y* larvae to be no longer significantly different relative to the control genotype (p_adj=0.31 and p_adj=0.98, respectively) and 200 μM TMG treatment significantly elevating O-GlcNAcylation relative to the untreated *sxc^C941Y* larvae (p_adj<0.05). *p<0.05, **p<0.01, ***p<0.001.

Figure 2—source data 1 Raw images of scans of Western blots (Figure 2A–C).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig2-data1-v3.zip
Download elife-90376-fig2-data1-v3.zip
Figure 2—source data 2 Uncropped scans of Western blots with relevant bands/regions indicated (Figure 2A–C).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig2-data2-v3.zip
Download elife-90376-fig2-data2-v3.zip

We next set out to identify concentrations at which the OGA inhibitor Thiamet G (TMG) (Yuzwa et al., 2008) would restore sxc^C941Y global O-GlcNAcylation to control levels. To elevate O-GlcNAcylation in adult Drosophila, young adult flies were placed on food supplemented with TMG for 72 hr prior to analysis by western blotting (Figure 2B). After assaying varying concentrations of OGA inhibitor, we found that global O-GlcNAcylation was rescued to control levels in sxc^C941Y flies fed 3 mM TMG for 72 hr. Paradoxically, a higher 5 mM concentration did not have the same effect. Flies fed this higher concentration of TMG were found to have significantly decreased global O-GlcNAcylation relative to the control genotype, though this appeared to be due to an alteration in the pattern of O-GlcNAcylation with some substrates retaining elevated O-GlcNAcylation relative to sxc^C941Y flies fed standard food (Figure 2—figure supplement 1). Accompanying elevated O-GlcNAcylation, TMG treatment resulted in decreased levels of DmOGT. For sxc^C941Y flies fed 3 mM TMG, DmOGT protein levels were rescued to control levels, while for flies fed 5 mM TMG, DmOGT decreased below levels seen in the control genotype. To assay whether the same pharmacological rescue could be performed during development, adults were allowed to lay eggs on food supplemented with TMG and the O-GlcNAcylation levels of their offspring were measured by western blot at the wandering third-instar stage (Figure 2C). Presumably due to differences in feeding behaviour, TMG concentrations required to rescue O-GlcNAcylation during the larval stages of development were much lower than for adults. At 150 μM TMG, O-GlcNAcylation in sxc^C941Y larvae was no longer significantly different from the control genotype, while O-GlcNAcylation in larvae fed 200 μM TMG was both significantly higher than in the sxc^C941Y larvae fed standard food and not significantly different from the control genotype. Overall, these results demonstrate that defective O-GlcNAc homeostasis in flies carrying an OGT-CDG mutation can be restored by reducing OGA activity through pharmacological inhibition.

sxc^C941Y flies possess a NMJ bouton phenotype

Previous research has identified an important role for O-GlcNAcylation in excitatory synapse function (Lagerlöf et al., 2017; Fenckova et al., 2022; Muha et al., 2020). To ascertain the contribution of this role of O-GlcNAcylation to ID, synaptic development was assayed at the larval NMJ. This synapse is an established model for mammalian central nervous system excitatory synapses and has been previously used to study the role of genes implicated in ID (Pan et al., 2004). To assay the effects of sxc mutations on NMJ morphology, type 1b NMJs of muscle 4 were visualised by immunostaining for the subsynaptic reticulum protein Discs large 1 (Dlg1) (Gan and Zhang, 2018) and with an anti-HRP antibody to visualise neuronal membranes (Fabini et al., 2001; Figure 3A). Upon quantification with a semiautomated ImageJ macro (Nijhof et al., 2016), several parameters measured were found to significantly differ between the NMJs in control genotype larvae and sxc^C941Y and the catalytically dead sxc^K872M larvae. The average NMJ area in sxc^WT larvae (mean ± standard deviation, 326 ± 52 μm²) was significantly higher than in both sxc^C941Y (278 ± 28 μm²) and sxc^K872M mutant larvae (198 ± 32 μm²), with a significant difference between the two sxc mutant groups. This phenotype was partially rescued in the sxc^C941Y;Oga^KO line (291 ± 39 μm²), relative to the control genotype, although the total area of the NMJs was not affected in the Oga^KO larvae (337 ± 32 μm²), consistent with previous research on Oga^KO larvae (Fenckova et al., 2022; Figure 3B). Total length was also significantly different between the control genotype (mean ± standard deviation, 115 ± 18 μm) and sxc^C941Y (93 ± 11 μm) and sxc^K872M larvae (74 ± 7 μm). This parameter was also partially rescued in sxc^C941Y;Oga^KO larvae (102 ± 14 μm) relative to sxc^WT larvae, while being unaffected in the Oga^KO genotype (115 ± 13 μm) (Figure 3C). Finally, bouton numbers were also significantly reduced in both sxc^C941Y (mean ± standard deviation, 15 ± 3) and sxc^K872M (12 ± 1) larvae, relative to the sxc^WT controls (19 ± 3). Unlike total area and length, this parameter remained significantly reduced in the sxc^C941Y;Oga^KO line (16 ± 2) relative to the control genotype (Figure 3D).

Figure 3 with 2 supplements see all

Download asset Open asset

Variants affecting the catalytic domain of OGT impair neuromuscular junction development.

(A) Representative images of larval neuromuscular junctions (NMJs) immunolabelled with anti-HRP (red), anti-Discs Large 1 (cyan) and both (scale bars 25 μm) for *sxc^WT* (n = 13)*, sxc^C941Y* (n = 19)*, sxc^C941Y;Oga^KO* (n = 14)*, sxc^K872M* (n = 8)*, sxc^K872M;Oga^KO* (n = 7), and *Oga^KO* (n = 13) larvae. In the *sxc^C941Y;Oga^KO* panel, the closed arrow indicates 1b boutons, analysed here, while the open arrow indicates an example of 1 s boutons, not analysed here. (B) Quantification of NMJ area (mean ± SD), which was found to be significantly different between genotypes (F(5,68) = 23.05, p<0.001). Relative to the *sxc^WT* control, both *sxc^C941Y* and *sxc^K872M* larvae presented with a smaller NMJ area (p_adj<0.01 and p_adj<0.001, respectively), which was partially rescued in the *sxc^C941Y;Oga^KO* strain (p_adj=0.14), though the *Oga^KO* larvae did not present with a significantly increased NMJ area (p_adj=0.97). (C) Quantification of NMJ length (mean ± SD), which was found to be significantly different between genotypes (F(5,68) = 17.75, p<0.001). Relative to the control genotype, both *sxc^C941Y* and *sxc^K872M* larvae presented with overall shorter NMJ length (p_adj<0.001 for both), while NMJ length was not significantly different in *sxc^C941Y;Oga^KO* larvae (p_adj=0.13), despite *Oga^KO* NMJ length not being affected (p_adj=0.99). (D) Bouton number (mean ± SD) is significantly reduced in *sxc^C941Y* and *sxc^K872M* larvae (F(5,68) = 18.11, p<0.001, p_adj<0.001 for both), and remains significantly reduced in *sxc^C941Y;Oga^KO* larvae (p_adj<0.05). Values for individual NMJs are represented as small grey points, with averages for each larva represented as larger coloured points. Descriptive and inferential statistics were performed on larval averages, *p<0.05, **p<0.01, ***p<0.001.

Figure 3—source data 1 Neuromuscular junction morphological parameters (Figure 3B–D).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig3-data1-v3.csv
Download elife-90376-fig3-data1-v3.csv

As O-GlcNAcylation has been shown to regulate overall body size (Sekine et al., 2010; Park et al., 2011) and NMJ area correlates with muscle size (Nijhof et al., 2016), we decided to measure muscle size in sxc^K872M larvae to determine whether changes in overall body growth could explain the NMJ phenotype we observed. No significant difference in muscle size was observed between sxc^WT and sxc^K872M larvae, and when NMJ area was normalised to muscle area, this parameter remained significantly reduced in sxc^K872M larvae (Figure 3—figure supplement 1A). Further, to ascertain whether loss of normal O-GlcNAcylation impairs NMJ bouton growth through pre-synaptic or post-synaptic mechanisms, wild type sxc was overexpressed either in neurons (elavL3-Gal4) or muscles (mhc-Gal4), in a DmOGT catalytically dead background (sxc^K872M). This demonstrated that overexpression of wild type sxc in sxc^K872M larval neurons could significantly increase NMJ total area, but not length or bouton number. By contrast, similar overexpression in muscle cells did not lead to any significant effect on NMJ morphology (Figure 3—figure supplement 2). Overall, growth of larval NMJs is broadly stunted in larvae modelling OGT-CDG and in larvae completely lacking OGT catalytic activity, with the phenotype partially rescued in the former by knocking out Oga. This is at odds with previously published research, which shows that both rationally designed hypomorphic mutants and ID mutations in the TPR domain result in increased growth at the NMJ (Fenckova et al., 2022). To address this disparity, we measured NMJ parameters in larvae of one of the genotypes previously assayed, sxc^H596F. We found that this mutation also results in a significant decrease in NMJ area (mean ± standard deviation, 260 ± 23 μm²) relative to the control genotype (304 ± 18 μm²), with a similar effect for length and bouton number, consistent with the other genotypes assayed here (Figure 3—figure supplement 1B–E).

Pharmacological rescue of OGT-CDG NMJ phenotypes

To determine whether the (partial) rescue of NMJ parameters by genetic ablation of OGA activity can be recapitulated by pharmacological means, larvae were fed 200 μM TMG to elevate O-GlcNAcylation to control levels, as previously determined (Figure 2C). As with knocking out Oga, elevating O-GlcNAcylation pharmacologically resulted in a partial rescue of NMJ parameters (Figure 4A). The total NMJ area in sxc^C941Y larvae treated with 200 μM TMG (mean ± standard deviation, 303 ± 40 μm²) was no longer significantly different relative to the control genotype (319 ± 31 μm²) while sxc^C941Y fed a vehicle control presented with reduced NMJ area relative to the control genotype (272 + 40 μm²) (Figure 4B). Unlike in sxc^C941Y;Oga^KO larvae, TMG inhibition in sxc^C941Y larvae did not significantly rescue NMJ length (median ± interquartile range, 106 ± 13 μm) relative to the control genotype (117 ± 9 μm), although a non-significant increase in length relative to sxc^C941Y larvae fed a vehicle was observed (95 μm ± 8) (Figure 4C). Similar to the OGA knockout experiment (Figure 3D), sxc^C941Y larvae fed 200 μM TMG presented with significantly fewer boutons per NMJ (mean ± standard deviation, 16 ± 2) relative to the control genotype (19 ± 2) without a significant difference relative to the sxc^C941Y larvae fed a vehicle control (15 ± 2) (Figure 4D). Overall, this demonstrates that pharmacological inhibition of OGA activity can partially rescue synaptogenesis in OGT-CDG mutant larvae.

Figure 4

Download asset Open asset

Thiamet G partially rescues neuromuscular junction defects in *sxc*^C941Y larvae.

(A) Representative images of neuromuscular junctions (NMJs) immunolabelled with anti-HRP (red), anti-Discs Large 1 (cyan), and both (scale bars 25 μm) for *sxc^WT* (n = 11)*, sxc^C941Y* (n = 14), and *sxc^C941Y* fed 200 μM TMG (n = 13). (B) NMJ area (mean ± SD) is significantly reduced in *sxc^C941Y* larvae fed a vehicle control (F(2,35) = 5.264, p=0.01, p_adj<0.01), relative *sxc^WT* larvae. sxc^C941Y larvae fed 200 μM TMG no longer present with a significant reduction in total NMJ area (p_adj=0.54). (C) Total NMJ length (median ± IQR) is significantly different between groups (Χ²(2) = 17.483, p<0.001); however, unlike total area, post hoc analysis demonstrates that this parameter remains significantly reduced compared to the *sxc^WT* control for both vehicle and TMG treated *sxc^C941Y* larvae (p_adj<0.001 and p_adj<0.01, respectively). (D) Quantification of bouton number (mean ± SD) demonstrated a significant intergroup difference (F(2,35) = 13.6, p<0.001), with both vehicle and TMG fed *sxc^C941Y* larvae presenting with significantly reduced bouton number (p_adj<0.001 and p_adj<0.01, respectively). Values for individual NMJs represented as small grey points, with averages for each larva represented as larger coloured points. Descriptive and inferential statistics were performed on larval averages, *p<0.05, **p<0.01, ***p<0.001.

Figure 4—source data 1 Neuromuscular junction morphological parameters (Figure 4B–D).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig4-data1-v3.csv
Download elife-90376-fig4-data1-v3.csv

Fragmented sleep in sxc^C941Y flies is reversible by normalising global O-GlcNAcylation

Patients with ID present with hyper-activity and sleep disturbances more often than the general population (Faraone et al., 2017; Köse et al., 2017). Several patients affected by OGT-CDG follow this pattern, presenting with sleep disturbances and behavioural abnormalities (Pravata et al., 2020b; Selvan et al., 2018). To assay whether activity and sleep are also disrupted in a Drosophila model of OGT-CDG, we used the Drosophila Activity Monitor (DAM) to measure these parameters (Figure 5A and B). In Drosophila research, sleep is commonly defined as a period of five or more minutes of quiescence, which is accurately measured by the DAM system (Donelson et al., 2012). Total activity of sxc^C941Y flies (median ± interquartile range, 1.25e3 ± 6.6e2 counts/24 hr) was not significantly different from the control genotype (1.23e3 ± 5.8e2 counts/24 hr). However, sxc^C941Y;Oga^KO flies were significantly less active than the control genotype (8.9e2 ± 3.9e2 counts/24 hr), despite the Oga^KO allele having no effect on total activity on its own (1.13e3 ± 5.7e2 counts/24 hr) (Figure 5C). By contrast, sxc^C941Y flies did present with reduced total sleep (mean ± standard deviation, 8.1e2 ± 1.8e2 min/24 hr), relative to the control genotype (9.4e2 ± 1.4e2 min/24 hr), which was rescued in sxc^C941Y;Oga^KO flies to wild type levels (9.7e2 ± 1.3e2 min/24 hr) (Figure 5D). Upon more detailed investigation, the nature of sleep disruption in the OGT-CDG flies was found to be due to a reduced duration of individual sleep bouts both during the day and night in these flies (median ± interquartile range, 28 ± 13 min and 39 ± 30 min, respectively) compared to the control genotype (42 ± 22 min and 75 ± 56 min, respectively). Mean sleep bout duration in sxc^C941Y flies is partially rescued by elevating global O-GlcNAcylation through knocking out Oga both during the day (32 ± 19 min) and at night (56 ± 40 min), although during both time periods sleep bout duration remained significantly reduced compared to the control genotype (Figure 5E). Upon further investigation of sleep bout duration, we found that the differences in sleep patterns between genotypes could be explained by the inability of sxc^C941Y flies to maintain longer sleep bouts. sxc^WT flies experience significantly more sleep bouts longer than 2 hr (median ± interquartile range 2.0 ± 1.0 bouts/24 hr) relative to sxc^C941Y flies (1 ± 1.3 bouts). This aspect of sleep is also rescued by knocking out Oga, with sxc^C941Y;Oga^KO flies no longer presenting with a significant decrease in number of sleep bouts longer than 2 hr (1.7 ± 1.3 bouts/24 hr) (Figure 5G). Accompanying decreased sleep bout duration, sxc^C941Y and sxc^C941Y;Oga^KO flies present with significantly more frequent sleep bouts during the day (mean ± standard deviation 13 ± 3 and 14 ± 5 bouts, respectively) and at night (14 ± 5 and 13 ± 5 bouts, respectively), compared to the control genotype (day: 11 ± 4 and night: 9 ± 4 bouts, respectively) (Figure 5F). These results indicate that the sleep defects in sxc^C941Y flies are only partially rescued by elevating global O-GlcNAcylation, with the modest rescue of sleep bout duration seen upon loss of OGA fully rescuing total sleep, in part due to sleep frequency remaining unaltered and above the control genotype levels.

Figure 5

Download asset Open asset

Fragmented sleep in a *Drosophila* model of OGT-CDG.

(A) Activity profile (mean ± SEM of activity counts in 30 min bins) for *sxc^WT* (n = 89)*, sxc^C941Y* (n = 94)*, sxc^C941Y;Oga^KO* (n = 74), and *Oga^KO* (n = 95) flies. (B) Sleep profile (mean ± SEM of sleep in 30 min bins) for genotypes as in (A). (**C–G**) Sleep parameters for genotypes in (A) and (B). (C) Total daily activity (median ± IQR) is significantly reduced in the *sxc^C941Y;Oga^KO* mutant strain relative to the control (Χ²(3) = 41.546, p<0.001, p_adj<0.001). (D) Total daily sleep (mean ± SD) is significantly reduced in *sxc^C941Y* flies relative to the control genotype (F(3,348) = 18.34, p<0.001, p_adj<0.001), while both *sxc^C941Y;Oga^KO* and *Oga^KO* flies do not have significantly altered total sleep (p_adj=0.58 and p_adj=0.99, respectively). (E) Mean sleep episode duration (median ± IQR) is significantly reduced in both *sxc^C941Y* and *sxc^C941Y;Oga^KO* flies relative to the control genotype during the day (Χ²(3) = 83.8, p<0.001, p_adj<0.001 and p_adj<0.01, respectively) and night (Χ²(3) = 52.0, p<0.001, p_adj<0.001 and p_adj<0.01, respectively). Mean sleep episode duration is significantly increased in *sxc^C941Y;Oga^KO* flies compared to *sxc^C941Y* flies both during the day and night (p_adj<0.05 and p_adj<0.001, respectively). (F) Daily number of sleep bouts (mean ± SD) is significantly elevated in both *sxc^C941Y* and *sxc^C941Y; Oga^KO* flies compared to the *sxc^WT* control (F(3,696) = 20.31 p<0.001, p_adj<0.001 for both) while time of day had no significant effect on the number of sleep bouts (F(1,696) = 0.099, p=0.75). Post hoc analysis revealed that relative to the *sxc^WT* control, the number of sleep bouts was significantly increased for *sxc^C941Y* and *sxc^C941Y;Oga^KO* flies both during the day (p_adj<0.01 and p_adj<0.001) and night (p_adj<0.001 and p_adj<0.001). (G) Daily number of sleep bouts longer than 2 hr (median ± IQR) is significantly lower in *sxc^C941Y* flies than the control genotype (Χ²(3) = 49.623, p<0.001, p_adj<0.001). Individual points represent mean values of measurements conducted over 3 days, for unique flies. *p<0.05, **p<0.01, ***p<0.001.

Figure 5—source data 1 Raw DAM data and associated metadata (Figure 5A–G).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig5-data1-v3.zip
Download elife-90376-fig5-data1-v3.zip
Figure 5—source data 2 SCAMP output for individual flies including total sleep, total activity, mean sleep bout duration, and sleep bout number averaged over 3 days (Figure 5C–F).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig5-data2-v3.xlsx
Download elife-90376-fig5-data2-v3.xlsx

To dissect developmental from non-developmental contributions to this sleep phenotype, we investigated whether elevating O-GlcNAcylation only in adulthood could rescue the sleep phenotype observed in sxc^C941Y flies. Adult sxc^C941Y flies were fed 3 mM TMG for 72 hr prior to and during activity monitoring. In this condition, OGT-CDG flies no longer presented with decreased overall sleep duration (Figure 6A). This may be explained by differences in fly food used during this assay, to accommodate the addition of TMG. However, other aspects of sleep remained disrupted in OGT-CDG flies. Both mean sleep duration (median ± interquartile range, day: 22 ± 10 min, night: 44 ± 26 min) and daily number of sleep bouts longer than 2 hr (median ± interquartile range, 1 ± 1 bouts/24 hr) remained significantly reduced compared to the sxc^WT control (day: 28 ± 13 min, night: 50 ± 43, 1.3 ± 1.0 bouts/24 hr, respectively). Additionally, as in previous experiments, sxc^C941Y flies presented with significantly more sleep bouts throughout the day (mean ± standard deviation, day: 17 ± 4 bouts, night: 15 ± 5 bouts) than the control genotype (day: 14 ± 4 bouts, night: 12 ± 4 bouts) (Figure 6B–D). Interestingly, these phenotypes were partially reversed by TMG feeding. Mean sleep bout duration in sxc^C941Y flies fed TMG was no longer significantly different from the control genotype both during the day and at night (26 ± 13 min and 44 ± 39 min, respectively), nor was the number of sleep bouts longer than 2 hr (1.3 ± 1.0 bouts/24 hr). The number of sleep bouts in sxc^C941Y flies fed TMG was also no longer significantly different than for the control genotype fed a vehicle control (day: 16 ± 3 bouts, night: 13 ± 4 bouts), although it remained non-significantly elevated relative to the control genotype. This rescue was not due to non-specific effects of TMG on feeding behaviour, such as aversion due to altered food taste, as neither genotype nor inclusion of TMG in food influenced total feeding (Figure 6—figure supplement 1). These results suggest that effects of OGT-CDG mutations may not be solely developmental, and that defective O-GlcNAc cycling in adulthood may be an important contributor to the pathogenesis of these mutations.

Figure 6 with 1 supplement see all

Download asset Open asset

Thiamet G partially rescues sleep in adult *sxc^C941Y* flies.

Sleep parameters for *sxc^WT* (n = 63), *sxc^C941Y* (n = 57), and *sxc^C941Y* flies fed 3 mM Thiamet G (TMG) (n = 60).(A) Total sleep (mean ± SD) is not significantly different between groups (F(2,177) = 0.249, p=0.78). (B) Mean sleep bout duration (median ± IQR) significantly differs between groups during the day (Χ²(2) = 12.854, p<0.01) and night (Χ²(2) = 6.5027, p<0.05), though it is only significantly reduced for *sxc^C941Y* flies fed the vehicle control (p_adj=0.001 and p_adj<0.05) and not TMG (p_adj=0.07, p_adj=0.48). (C) Daily number of sleep bouts is significantly different across groups (F(2,354) = 16.775, p<0.001) and times of day (F(2,354) = 37.446, p<0.001). Post hoc analysis reveals that compared to the *sxc^WT* genotype, *sxc^C941Y* flies fed a vehicle control present with significantly more sleep bouts both during the day and at night (p_adj<0.001 for both) while the same genotype fed TMG supplemented food did not present with a significantly different number of sleep bouts (p_adj=0.33 and p_adj=0.52). (D) The number of sleep bouts longer than 2 hr is significantly reduced in *sxc^C941Y* flies fed a vehicle control, but not TMG (Χ²(2) = 8.2491, p<0.05, p_adj<0.05 and p_adj=0.3, respectively). Individual points represent mean values of measurements conducted over 3 days, for unique flies. *p<0.05, **p<0.01, ***p<0.001.

Figure 6—source data 1 Raw DAM data and associated metadata (Figure 6A–D).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig6-data1-v3.zip
Download elife-90376-fig6-data1-v3.zip
Figure 6—source data 2 SCAMP output for individual flies including total sleep, mean sleep bout duration, and sleep bout number averaged over 3 days (Figure 6A–C).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig6-data2-v3.xlsx
Download elife-90376-fig6-data2-v3.xlsx
Figure 6—source data 3 OD625 of lysed flies fed food with Blue Dye no 1, either with or without Thiamet G.: https://cdn.elifesciences.org/articles/90376/elife-90376-fig6-data3-v3.csv
Download elife-90376-fig6-data3-v3.csv

Glial knockdown of sxc partially phenocopies sxc^C941Y fragmented sleep

Sleep in Drosophila and in humans is regulated by multiple cell types. To determine which cell types require normal O-GlcNAcylation to regulate sleep, we decided to knock down sxc in neurons and glia as both have been extensively implicated in this process (Shafer and Keene, 2021). Upon neuronal knockdown of sxc, no difference in total sleep (median ± interquartile range, 474 ± 228 min/24 hr) (Figure 7A) nor mean sleep bout duration (median ± interquartile range, day: 17 ± 10 min, night: 23 ± 14 min) (Figure 7B) was observed relative to the GAL4 control (total sleep 510 ± 232 min, mean sleep bout duration day: 11 ± 9 min, night: 28 ± 17 min). However, neuronal knockdown of sxc significantly affects sleep bout number, during the daytime decreasing (mean ± standard deviation, 8 ± 5 bouts) relative to both the elav GAL4 (12 ± 4 bouts) and UAS (12 ± 4 bouts) control lines (Figure 7C). Conversely, knockdown of sxc in glial cells resulted in a significant decrease in total daily sleep (median ± interquartile range, 690 ± 230 min/24 hr), relative to a GAL4 (800 ± 170 min/24 hr), and UAS control (960 ± 120 min/24 hr) (Figure 7A). As in sxc^C941Y flies, glial knockdown caused a decrease in the mean duration of sleep episodes (median ± interquartile range, day: 29 ± 26 min, night: 31 ± 19 min) compared with the control GAL4 (day: 38 ± 32 min, night: 46 ± 26 min) and UAS genotypes (day: 39 ± 24 min, night: 57 ± 40 min, Figure 7B); however, this effect is only significant during the night. Unlike in OGT-CDG flies, the number of sleep bouts was not significantly increased in flies expressing sxc RNAi in glial cells (mean ± standard deviation, day: 12 ± 6 bouts, night: 13 ± 5 bouts) relative to either control (GAL4: day: 12 ± 6 bouts, night: 11 ± 5 bouts, UAS: day: 12 ± 4 bouts, night: 10 ± 4 bouts; Figure 7C). Flies expressing sxc RNAi in glial cells presented with fewer sleep bouts longer than 2 hr (median ± interquartile range, 1.0 ± 1.3 bouts/24 hr), however, only relative to the UAS control group (2 ± 0.7 bouts/24 hr) and not the repo GAL4 line (1.3 ± 0.7 bouts/24 hr) (Figure 7D).

Figure 7

Download asset Open asset

Glial knockdown of *sxc* partially phenocopies *sxc*^C941Y sleep defects.

Quantification of sleep parameters in flies expressing *sxc* RNAi under the control of either the neuronal *elav* promoter (n = 42) or the glial *repo* promoter (n = 54). (A) Total sleep is significantly (χ²(4) = 105.98, p<0.001) reduced by *sxc* knockdown in glial cell, compared to both to the *repo >*GAL4 (n = 30, p_adj<0.01) and UAS (n = 45, p_adj<0.001) control lines. (B) Mean sleep episode duration is only significantly reduced in *repo*>*sxc* RNAi flies during the night, compared to both the UAS and GAL4 control lines (χ²(4) = 67.073, p<0.001, p_adj<0.001 and p_adj<0.05, respectively). (C) Daily number of sleep episodes is not significantly affected by genotype (F(4, 127) = 1.368, p=0.24); however, there is a significant effect of time of day on sleep (F(4, 127) = 5.656, p<0.05). There is also a significant interaction between genotype and time of day with regards to number of sleep bouts (F(4, 127) = 10.747, p<0.001), which can be explained by a significant decrease in number of sleep bouts during the day in neuronal *sxc* knockdown flies compared to both the *elav*>GAL4 (n = 29, p_adj<0.01) and UAS (p_adj<0.01) control lines. Conversely, neuronal *sxc* knockdown flies present with significantly more sleep bouts during the night, compared to these control lines (p_adj<0.05 and p_adj<0.01, respectively). (D) The daily number of sleep episodes longer than 2 hr is also reduced with glial *sxc* knockdown (χ²(4) = 81.215, p<0.001), but only compared to the UAS control line (p_adj<0.001) and not the GAL4 control line (p_adj=0.3). *p<0.05, **p<0.01, ***p<0.001.

Figure 7—source data 1 Raw DAM data and associated metadata (Figure 7A–H).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig7-data1-v3.zip
Download elife-90376-fig7-data1-v3.zip
Figure 7—source data 2 SCAMP output for individual flies including total sleep, mean sleep bout duration, and sleep bout number averaged over 3 days (Figure 7A–C).: https://cdn.elifesciences.org/articles/90376/elife-90376-fig7-data2-v3.xlsx
Download elife-90376-fig7-data2-v3.xlsx

Discussion

Many mutations in OGT causal in ID modelled previously do not result in a decrease in global O-GlcNAcylation either in embryonic stem cells or patient derived fibroblasts, in many cases due to feedback mechanisms reducing OGA protein levels (Willems et al., 2017; Pravata et al., 2019; Selvan et al., 2018). The cysteine to tyrosine substitution modelled here is one of only two patient mutations which has been shown to reduce global O-GlcNAcylation when introduced in mammalian cells (Pravata et al., 2020a; Omelková et al., 2023). Here, we have shown that patient mutations affecting the catalytic domain of OGT result in decreased O-GlcNAcylation in adult flies, corroborating previous results (Pravata et al., 2019). Expanding upon these results, we have demonstrated that an OGT-CDG catalytic domain mutation can reduce O-GlcNAcylation throughout development, despite a compensatory increase in total DmOGT protein. To assay O-GlcNAcylation levels, we used an antibody approach, yielding a coarse view of how OGT-CDG mutations affect the O-GlcNAcome, particularly given the known limitations and biases in using antibodies to detect this modification (Thompson et al., 2018). Though challenging, future research should expand on these results by quantitative analysis of changes to O-GlcNAcylation of specific protein substrates. When modelled in mouse embryonic stem cells, this mutation (C921Y in humans and mice) also results in an increase in OGT protein levels (Omelková et al., 2023). It is tempting to assert that increased OGT, as opposed to decreased OGA, is a homeostatic mechanism linked specifically to this mutation. However, in the fly, increased DmOGT protein levels appear to be a response commonly associated with decreased OGT catalytic activity, demonstrated here by the sxc^K872M mutant stain and in previous work (Pravata et al., 2019). While this increase in DmOGT protein levels was not explored in further detail, some evidence exists for post-transcriptional regulation of sxc expression through alternate splicing (Ashton-Beaucage et al., 2010), a mechanism known be involved in the control of OGT and OGA expression and O-GlcNAc homeostasis in mammalian cells (Tan et al., 2020). We have also shown that reduced catalytic activity of DmOGT as a result of modelling a patient mutation in sxc can phenocopy rational mutagenesis of a key catalytic residue (sxc^H537A) causing the growth of ectopic scutellar bristles (Mariappa et al., 2018). Also known as macrochaetae, the development of these sensory cells is well studied, particularly in the context of cell fate determination by lateral inhibition through Notch signalling (Parks et al., 1997), providing a tractable system for the understanding of the impacts of hypo-O-GlcNAcylation on cell fate determination. With reports of Notch signalling requiring appropriate O-GlcNAcylation (Chen et al., 2021), this phenotype presents an interesting system to research the contribution of the Notch signalling pathway to ID.

A key question regarding OGT-CDG is whether therapeutic approaches targeting OGA can raise O-GlcNAcylation and potentially ameliorate symptoms in this disorder, as previously proposed (Pravata et al., 2020b). Here, we show that normal global O-GlcNAcylation levels can be restored in sxc^C941Y adult flies through knockout out of Oga. Previous research has demonstrated that Oga^KO alleles can rescue phenotypes associated with reduced O-GlcNAcylation (Fenckova et al., 2022); however, here we present the first direct evidence that global O-GlcNAcylation can exceed control levels in DmOGT hypomorphic flies in the absence of OGA. While we did not see a concomitant rescue of the scutellar bristle phenotype seen in sxc^C941Y flies, this may occur as a consequence of unique kinetics of O-GlcNAcylation and removal of O-GlcNAc on various DmOGT substrates, that is, the dysregulation of the ratio of stoichiometries of modification of specific substrates may be exacerbated in the absence of OGA. Previous research has demonstrated this may occur in mammalian cells, with some O-GlcNAcylated proteins not affected by OGA inhibition in cancer cells (Hahne et al., 2013; Li et al., 2019). Alternatively, it may be that both the addition and timely removal of O-GlcNAc from specific proteins is required for normal scutellar bristle development.

Complete ablation of Oga expression is a blunt approach, elevating O-GlcNAcylation levels beyond those seen in the control genotype and is not a feasible therapeutic approach. Pharmacological approaches to inhibit OGA offer more precise control over the degree of O-GlcNAcase activity and are being actively pursued as potential treatments for neurodegenerative disorders (Bartolomé-Nebreda et al., 2021). Our experiments suggest that the potent OGA inhibitor TMG can be used to rescue global O-GlcNAcylation levels in sxc^C941Y flies to those of a genetic background control, at various stages of development. Interestingly, rescuing O-GlcNAcylation levels through OGA inhibition also restored OGT levels in sxc^C941Y flies. However, there is a clear difference in the pattern of O-GlcNAcylation visualised by immunoblotting in adult sxc^C941Y flies fed TMG relative to the control genotype. This incomplete rescue of O-GlcNAcylation may be consequential in phenotypic rescue. Additionally, a paradoxical effect was seen upon feeding higher doses of TMG. Because inhibition of OGA appears to reduce protein levels of OGT, global O-GlcNAc levels were not rescued at higher levels of TMG. However, specific immunoreactive bands appeared to maintain elevated levels of O-GlcNAc. This potentially indicates that mechanisms controlling OGT expression in response to O-GlcNAcylation levels are particularly sensitive to OGA activity, lowering OGT protein levels prior to O-GlcNAcylation stoichiometry rising on some OGT substrates.

Previous research has shown that alleles encoding hypomorphic variants of DmOGT result in overgrowth at the NMJ, and that TPR domain mutations modelling those seen in patients result in a similar phenotype (Fenckova et al., 2022). However, here, we observe the opposite effect, with both sxc^C941Y and sxc^K872M larvae presenting with smaller NMJs. This discrepancy is unlikely to be caused by allele-specific effects as this hypothesis was tested by assaying NMJ parameters in one of the hypomorphic mutants previously described and finding that this mutation (sxc^H596F) also results in stunted growth at the NMJ. While we utilised different markers to count boutons than in previous research (Fenckova et al., 2022), discrepancies in area and length of NMJs cannot be explained in this manner. Nonetheless, as in previous research on the effects of reduced OGT catalytic activity on NMJ morphology, knocking out Oga can partially rescue phenotypes at this type of synapse (Fenckova et al., 2022), while a lack of Oga on its own does not affect NMJ morphology. Previous research on the role of Oga in axonal outgrowth at the larval NMJ is contradictory, with one report indicating a lack of functional OGA protein increases NMJ morphological parameters such as area and another suggesting no effect on NMJ growth in the absence of OGA (Muha et al., 2020 Fenckova et al., 2022). Additionally, we also show that overall area of the NMJ can be elevated by overexpressing wild type sxc in neurons, in a DmOGT catalytically dead background (sxc^K872M). Surprisingly, other parameters (such as bouton number and NMJ length) were not elevated by such overexpression, neither when targeting neurons nor muscle cells. This phenotype can also be partially rescued through pharmacological means, through the use of TMG. This could serve as proof of principle that pharmacological intervention in OGT-CDG is possible. This is not an immediately obvious conclusion as it is possible that beyond the stoichiometry of the modification on individual substrates the timing of addition and removal of O-GlcNAcylation could be important for synaptic development and function. Together, these findings suggest that the NMJ phenotype caused by loss of normal O-GlcNAcylation is complex, and that potentially alternate mechanisms impair bouton addition (which may also affect NMJ length) and overall NMJ area, as the latter is more amenable to rescue across various approaches.

We also demonstrate a novel behavioural effect resulting from catalytic domain mutations in sxc. Normal O-GlcNAc cycling is required for maintenance of sleep in adult flies, and reduced DmOGT catalytic activity as a result of an OGT-CDG mutation results in shorter, more frequent sleep episodes. Previously, a patient with this condition was reported to suffer from sleep disturbances characterised by abnormal EEG during sleep and insomnia (Selvan et al., 2018). This is particularly relevant given that normal sleep is required for multiple cognitive processes, such as memory formation, both in flies and humans (Ly et al., 2018; Berry et al., 2015; Rasch and Born, 2013). Encouragingly, this phenotype can be partially rescued by knocking out OGA or by pharmacologically elevating O-GlcNAcylation in adult flies. However, it is important to note that the phenotype was not consistently detected across varying experimental conditions. Specifically, when sleep was assayed in OGT-CDG flies fed an alternate food type (to accommodate the addition of TMG) total sleep was not reduced in sxc^C941Y flies, despite bout duration and frequency being altered as for assays using standard Drosophila food. While not directly comparable, this may suggest that loss of OGT catalytic activity interacts with environmental factors such as dietary composition. Further investigation revealed that knocking down sxc in glial cells can result in a similar phenotype as the OGT-CDG mutation. While this does not rule out the involvement of neuronal cell types in this phenotype, the results presented here provide the first evidence for the potential involvement of non-neuronal cell types in OGT-CDG. Overall, these results could have important implications for our understanding of OGT-CDG, providing the first evidence that suggests that the disorder is not purely developmental and may be amenable to therapeutic approaches at later stages of life.

Materials and methods

Key resources table

Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information
Gene (Drosophila melanogaster)	sxc	FlyBase	FLYB: FBgn0261403
Gene (D. melanogaster)	Oga	FlyBase	FLYB: FBgn0261403
Strain, strain background (D. melanogaster)	w¹¹¹⁸ (VDRC60000)	Vienna Drosophila Resource Center	VDRC60000
Genetic reagent (D. melanogaster)	vas-Cas9	Bloomington Drosophila Stock Center	BL51323
Genetic reagent (D. melanogaster)	sxc^K872M	Mariappa et al., 2018	FLYB: FBal0340183
Genetic reagent (D. melanogaster)	Oga^KO	Muha et al., 2020	FLYB: FBal0361594
Genetic reagent (D. melanogaster)	sxc^N595K	Pravata et al., 2019	FLYB: FBal0352246
Genetic reagent (D. melanogaster)	sxc^H596F	Fenckova et al., 2022	FLYB: FBal0375027
Genetic reagent (D. melanogaster)	sxc RNAi	Vienna Drosophila Resource Center	VDRC110717
Genetic reagent (D. melanogaster)	elav-GAL4	Bloomington Drosophila Stock Center	BL8765
Genetic reagent (D. melanogaster)	repo-GAL4	Kind gift from Leeanne McGurk
Genetic reagent (D. melanogaster)	mhc- GAL4	Bloomington Drosophila Stock Center	BDSC_55133
Genetic reagent (D. melanogaster)	elavL3-GAL4	Kind gift from Leeanne McGurk	RRID:BDSC_8760
Genetic reagent (D. melanogaster)	UAS:sxc-HA	Mariappa et al., 2015
Antibody	RL2, anti-O-GlcNAc (mouse monoclonal)	Novus	Cat# NB300-524	1:1000
Antibody	Anti-OGT (rabbit polyclonal)	Abcam	Cat# ab-96718	1:1000
Antibody	Anti-Actin (rabbit polyclonal)	Sigma	Cat# A2066	1:5000
Antibody	Anti-Discs Large 1 (mouse polyclonal)	DSHB	RRID:AB_528203	1:25
Antibody	Anti-HRP conjugated to Alexa Fluor 647 (goat polyclonal)	Jackson ImmunoResearch	RRID:AB_528203	1:400
Antibody	Anti-rabbit IgG 680 infrared conjugated (donkey polyclonal)	LI-COR	RRID:AB_2716687	1:10,000
Antibody	Anti-mouse IgG 800 infrared conjugated (goat polyclonal)	LI-COR	RRID:AB_2687825	1:10,000
Antibody	Anti-mouse conjugated to Alexa Fluor 488 (donkey polyclonal)	Molecular Probes	A21202	1:400
Recombinant DNA reagent	pCFD3-dU63gRNA	Addgene
Peptide, recombinant protein	CpOGA (GST tagged)	Rao et al., 2006		Produced in-house
Chemical compound, drug	Thiamet G	SantaCruz	Cat# sc-224307
Chemical compound, drug	NuPage LDS	Thermo Fisher	Cat# NP0007
Chemical compound, drug	Dako mounting media	Agilent	Cat# S302380-2
Chemical compound, drug	GlcNAcstatin G	Dorfmueller et al., 2010		Produced in-house
Chemical compound, drug	Blue dye no. 1	Sigma	861146
Software, algorithm	Image Studio Lite	https://www.licor.com/bio/image-studio/
Software, algorithm	DAMFileScan113	https://www.trikinetics.com/
Software, algorithm	Python 3	https://www.python.org/
Software, algorithm	R (4.0.3)	https://www.r-project.org/
Software, algorithm	ImageJ-FIJI	https://imagej.net/software/fiji/
Software, algorithm	SCAMP	Donelson et al., 2012
Software, algorithm	Rethomics	Geissmann et al., 2019
Software, algorithm	Drosophila_NMJ_Morphometrics	Nijhof et al., 2016
Software, algorithm	WBplotProfile	This paper, Czajewski, 2024		Code can be obtained from: https://github.com/IgnacyCz/WBplotProfile
Other	Confocal microscope	Zeiss	710	Section ‘Neuromuscular junction immunohistochemistry’
Other	Confocal microscope	Zeiss	980	Section ‘Neuromuscular junction immunohistochemistry’ (Neuronal overexpression of sxc partially rescues neuromuscular junction defects caused by loss of OGT catalytic activity)
Other	Dissection microscope	Motic	SMZ-161	Section ‘Scutellar bristle assay’
Other	DAM2 monitor	trikinetics	https://trikinetics.com/	Section ‘Drosophila activity monitor’

CRIPSR-Cas9 mutagenesis

Request a detailed protocol

The gRNA sequence for generating the sxc C941Y flies was selected using the online tool Crispr.mit.edu. The optimal gRNA sequence was included in annealing oligos including overhangs compatible with cloning into the pCFD3-dU63gRNA plasmid previously cut with BpiI restriction enzyme. A 2 kb repair template for the region was generated from Drosophila Schneider 2 cell genomic DNA by PCR using GoTaq G2 Polymerase. The PCR product was cloned as a blunt product into the pTOPO-Blunt plasmid. Mutations were introduced into the template to include the C941Y mutation as well as silent mutations to remove the gRNA recognition sequence. This was carried out using the QuikChange kit from Stratagene and confirmed by DNA sequencing. The mutations removed the restriction site BseMI which is present in the gRNA sequence. sxc^C941Y mutant flies were generated by microinjection of vas-Cas9 embryos (BL51323) (Rainbow Transgenic Flies, Inc) with CRISPR reagents generated in-house, backcrossed to a w¹¹¹⁸ (VDRC60000) background and the mutated chromosome was balanced over Curly of Oster (CyO). Diagnostic digests were carried out on the resulting flies to first confirm the loss of the restriction site followed by sequencing of the PCR product. The correctness of the mutation was also confirmed through sequencing of the full-length sxc mRNA. Sequences of the oligonucleotides used here are listed in Table 1.

Table 1

List of oligonucleotides used in CRISPR-Cas9 mutagenesis section.

Designation	Sequence
gRNA annealing oligonucleotide (forward)	GTCGCTTGATACTCCTTTATGCAA
gRNA annealing oligonucleotide (reverse)	AAACTTGCATAAAGGAGTATCAAG
Repair template cloning primer (forward)	aaaGGATCCTTTCGACACAAAATCAGTCGAGAGTCTG
Repair template cloning primer (reverse)	aaaGCGGCCGCGGTAGCCAGCTGAGAGGCAGCCAC
Repair template mutagenesis primer 1 (silent) (forward)	GGGGTCAATTAGCTGATATATGTCTTGATACgCCgcTgTcgAATGGGCATACA ACATCTATGGACGTTTTG
Repair template mutagenesis primer 1 (silent) (reverse)	CAAAACGTCCATAGATGTTGTATGCCCATTcgAcAgcGGcGTATCAAGACATAT ATCAGCTAATTGACCCC
Repair template mutagenesis primer 2 (C941Y mutation) (forward)	GTCAATTAGCTGATATATacCTTGATACGCCGCTGTgtAATGGGCATACAACATCTATG
Repair template mutagenesis primer 2 (C941Y mutation) (reverse)	CATAGATGTTGTATGCCCATTacACAGCGGCGTATCAAGgtATATATCAGCTAATTGAC

Fly stocks and maintenance

Request a detailed protocol

Stocks were maintained on a 12:12 light dark cycle at 25°C on Nutri-Fly Bloomington Formulation fly food. Previously described sxc^K872M (Mariappa et al., 2018), sxc^N595K (Pravata et al., 2019), and sxc^H596F (Fenckova et al., 2022) mutant flies (2018) were used. Previously described Oga^KO flies (Muha et al., 2020) were used to generate sxc^C941Y;Oga^KO and sxc^K872M;Oga^KO stocks. The homozygous lethal sxc^K872M chromosome was balanced over a CyO chromosome carrying a GFP reporter (CyO, P{ActGFP.w[-]}CC2, BL9325). An isogenic w¹¹¹⁸ (VRDC60000) background strain was used as a control genetic background. To overexpress wild type sxc in an sxc^K872M background, sxc^K872M/CyO(GFP);mhc-Gal4 (generated using the w[*]; P{w[+mC]=Mhc-GAL4.K}2/TM3, Sb[1] line; BL55133) or sxc^K872M/CyO(GFP);elavL3-Gal4 (generated using the P{GAL4-elav.L}CG16779[3] line; RRID:BDSC_8760) were crossed with sxc^K872M/CyO(GFP);UAS:sxc-HA (generated using the previously described UAS:sxc-HA line; Mariappa et al., 2015). To knock down sxc in neurons or glia, the sxc RNAi line VDRC110717 was used and 10 of either virgin VDRC110717 or VRDC60000 females were crossed with five P{w[+mC]=GAL4elav.L}2/CyO (BL8765), p[w[mC]:repo-GAL4]/TM6b (kind gift from Leeanne McGurk), or VRDC60000 males and allowed to lay embryos for 5 days.

Drosophila tissue lysis and western blotting

Request a detailed protocol

For immunoblotting of adult head lysates, flies raised as described previously were anaesthetised with CO₂ and an equal number of 3–5-day-old male and female flies were snap frozen in liquid nitrogen. Heads were then severed from bodies by vortexing flies twice and collected using a paintbrush. To collect larval and embryonic lysates, homozygous 3–5-day-old females and males were allowed to lay embryos for 4 hr and 2 hr, respectively, on apple juice agar plates supplemented with yeast paste. For recessive lethal lines, heterozygous parents were crossed in the same manner. Embryos were collected 14 hr later and snap frozen on dry ice. For recessive lethal genotypes, homozygous embryos were collected based on the absence of a GFP fluorescent CyO balancer chromosome. For larval tissues, 24 hr after embryo collection, sxc mutant homozygous first-instar larvae were collected into vials containing Nutri-Fly Bloomington Formulation fly food at a density of 25 larvae per vial and aged to the wandering third-instar stage, when they were snap frozen on dry ice. For experiments in which specificity of the O-GlcNAc antibody was tested by prior incubation with Clostridium perfringens OGA CpOGA, heads were lysed in modified RIPA buffer to accommodate the pH optimum of CpOGA (Rao et al., 2006) (150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 25 mM citric acid pH 5.5) supplemented with a protease inhibitor cocktail (1 M benzamidine, 0.2 mM PMSF, 5 mM leupeptin). To validate specificity of O-GlcNAc detection, lysates were split with one group incubated with 2.5 μM GST tagged CpOGA to remove O-GlcNAc while the experimental group was incubated with 1 μM GlcNAcstatin G. Lysates were then incubated for 2 hr at room temperature, agitated at 300 RPM using a thermomixer (Eppendorf thermomixer comfort). The reaction was stopped by heating to 95°C with NuPAGE LDS Sample Buffer with 50 mM TCEP to a 1× concentration. Otherwise, collected tissues were lysed in 50 mM Tris- HCl (pH 8.0), 150 mM NaCl, 1% Triton-X 100, 4 mM sodium pyrophosphate, 5 mM NaF, 2 mM sodium orthovanadate, 1 mM EDTA, supplemented 1:100 with a protease inhibitor cocktail (1 M benzamidine, 0.2 mM PMSF, 5 mM leupeptin) and 1.5× NuPAGE LDS Sample Buffer with 50 mM TCEP. Protein concentration was estimated using a Pierce 660 assay (Thermo Scientific) supplemented with ionic detergent compatibility reagent (Thermo Scientific). 30 μg of protein per group were separated by gel electrophoresis (NuPage 4–12% Bis-Tris, Invitrogen) and transferred onto a nitrocellulose membrane (Amersham Protran 0.2 μm). Membranes were developed with the following primary antibodies: mouse anti-O-GlcNAc (RL2, 1:1000, Novus), rabbit anti-OGT (1:1000, Abcam, ab-96718), and rabbit anti-actin (1:5000, Sigma, A2066) and the following secondary antibodies: goat anti-mouse IgG 800 and donkey anti-rabbit IgG 680 infrared dye conjugated secondary antibodies (LI-COR, 1: 10,000). Western blots were analysed using Image Studio Lite.

Thiamet G feeding

Request a detailed protocol

Thiamet G (SantaCruz, sc-224307) was dissolved in PBS to a stock concentration of 100 mM. This stock was mixed with Drosophila instant food (Flystuff Nutri-Fly Food, Instant Formulation) to appropriate concentrations, to avoid heating Thiamet G. For experiments with adult flies, 1–3-day-old flies (males and females in equal proportion) were placed on food for 72 hr prior to snap freezing in liquid nitrogen. For larval feeding experiments, ten 0–3-day-old females were crossed with four males and allowed to lay embryos for 2 days. Wandering third-instar larvae were snap frozen on dry ice and lysed.

Effects of the addition of Thiamet G to food on adult feeding behaviour were assayed similarly to Wong et al., 2009. To age match flies, freshly eclosed adults were placed on standard food as described in ‘Fly stocks and maintenance’ for 2 days. Males were then transferred to vials with 1% agarose for 18 hr, to starve flies and later induce feeding. After starvation, flies were placed in either vehicle control vials (0.86% agarose, 5 mM sucrose, 3% PBS, 0.2% blue dye no. 1 [Sigma 861146]) or Thiamet G containing vials (0.86% agarose, 5 mM sucrose, 3% PBS, 3 mM Thiamet G, 0.2% blue dye no. 1) for 30 min. Ten flies per replicate were then ground with a pestle in 50 μL of water and centrifuged at 17,000 RCF for 15 min to remove debris. 35 μL of supernatant was then collected and absorbance at 625 nm was measured (NanoDrop One, Thermo Fisher Scientific).

NMJ immunohistochemistry

Request a detailed protocol

The NMJ assay was performed as in Nijhof et al., 2016. Larvae for this assay were obtained as described above. Male wandering third-instar larvae were dissected using the ‘open book’ technique Brent et al., 2009 followed by immediate fixation in 3.7% paraformaldehyde in phosphate buffered saline (pH 7.5) (PBS) for 25 min. Fixed larvae were either stored in PBS at 4°C for up to 48 hr or immediately processed further. Larval preparations were blocked using 5% normal donkey serum (NDS) in PBS and Triton-X (0.3%, PBST) for 2 hr at room temperature, followed by immunostaining using mouse anti-Discs Large 1 (1:25, Developmental Studies Hybridoma Bank, RRID:AB_528203) and goat anti-HRP conjugated to Alexa Fluor 647 (1:400, Jackson ImmunoResearch, RRID:AB_2338967) in 5% NDS PBST overnight at 4°C. Sections were washed four times for 10 min in PBST (0.5%), followed by 4 hr incubation with donkey anti-mouse Alexa Fluor 488 (1:400) in 5% NDS PBST at room temperature. Sections were washed as for primary antibodies, rinsed in PBS, and mounted using Dako Fluorescence Mounting Medium (Agilent). Images of type 1b NMJs of muscle 4 were obtained using either a Zeiss 710 or 980 confocal microscope using a ×10 objective (EC Plan Neofluar 0.3) (voxel size: 0.69 × 0.69 × 6.22 μm) for muscle area measurements and using a ×63 objective (Plan Apochromat 1.4 oil) to image individual junctions (voxel size: 0.196 × 0.196 × 0.91 μm). Image size for the former was 2048 × 2048 pixels and 688 × 688 for the latter. Both channels were acquired simultaneously. NMJ parameters were scored using a semi-automated macro by a researcher blind to the conditions (Neuromuscular Junction Morphometrics; Nijhof et al., 2016) with poorly annotated or damaged NMJs excluded from further analysis. Muscle area was manually measured using the polygon selection tool in ImageJ. Statistical analysis was performed on mean values for individual larvae for which three or more NMJs were accurately annotated.

Drosophila activity monitor

Request a detailed protocol

Drosophila activity was recorded using Trikinetics DAM2 monitors. 1–3-day-old male flies were used for all experiments. Briefly, male flies were anaesthetised using CO₂ and placed in DAM vials with Nutri-Fly Bloomington Formulation food. Experiments were performed at 25°C on a 12 hr:12 hr light:dark cycle, data were recorded for 3 days, after 2 days of acclimatisation. For TMG rescue experiments, food was prepared as described in ‘Thiamet G feeding’ and data were recorded 72 hr after placing flies on supplemented food. Data were pre-processed using DAMFileScan113 software and Sleep and Circadian Analysis MATLAB Program (SCAMP) (Donelson et al., 2012). Flies that ceased to move during the experimental window were presumed dead and excluded. For analysis of number of bouts longer than 2 hr, the raw output from the DAM system was analysed in R using the Rethomics packages (Geissmann et al., 2019).

Scutellar bristle assay

Request a detailed protocol

To assay scutellar bristle number, 8–10 young homozygous virgin females were mated with three males and allowed to lay embryos for 3 days to prevent overcrowding of larvae. Eclosed offspring were immobilised using CO₂ and scutellar bristles were counted using a Motic SMZ-161 microscope.

Western blot intensity profile

Request a detailed protocol

Intensity of O-GlcNAc immunoreactivity was calibrated to estimated molecular weight plotted using custom Python code (available at GitHub, copy archived at Czajewski, 2024). Briefly, images were imported using the PIL library (Umesh, 2012), converted to NumPy arrays (Harris et al., 2020), and molecular weight markers were identified as intensity peaks in a user-defined x-coordinate column of pixels. The SciPy (Virtanen et al., 2020) library was then used to fit a curve to identified molecular weight markers to infer molecular weights at y-pixel coordinates. This was then used to calibrate the x-axis for plotting (using the matplotlib library; Hunter, 2007) the relative intensity of immunolabelling across genotypes and conditions based on user defined x pixel coordinates defining protein lanes, normalised to loading controls.

Statistical analyses

Request a detailed protocol

All statistical analyses were performed in R (version 4.0.3). Data that satisfied assumptions regarding homoscedasticity and normality were analysed with a one-way ANOVA followed by Tukey’s HSD with Bonferroni correction. Otherwise, data were analysed using a Kruskal–Wallis rank sum test followed by pairwise comparisons using Wilcoxon rank sum test with continuity correction and p value adjustment using the Bonferroni method. Sleep architecture phenotypes which were analysed separately for data collected during the day and night were analysed by two-way ANOVA (sleep bout number) or by a Kruskal–Wallis rank sum test performed separately on the two time periods (mean sleep bout duration), followed by post hoc testing as above. One outlier was removed from analysis (sxc^N595K OGT and O-GlcNAcylation quantification), based on the criteria of falling more than 1.5 interquartile range beyond the 75 percentile. To balance the removal of this outlier, the minimum for this group was also removed.

Materials availability statement

Request a detailed protocol

All materials are available upon request.

Data availability

Code used to generate Figure 2 - Supplement 1 A and C is deposited in GitHub (copy archived at Czajewski, 2024). Upon publication, information regarding novel genotypes and phenotypes will be deposited in FlyBase. Newly generated genotypes are available upon request.

References

(2010) The exon junction complex controls the splicing of MAPK and other long intron-containing transcripts in Drosophila
Cell 143:251–262.

https://doi.org/10.1016/j.cell.2010.09.014
- PubMed
- Google Scholar
(2021) O-GlcNAcase inhibitors as potential therapeutics for the treatment of Alzheimer’s disease and related tauopathies: analysis of the patent literature
Expert Opinion on Therapeutic Patents 31:1117–1154.

https://doi.org/10.1080/13543776.2021.1947242
- PubMed
- Google Scholar
(2015) Sleep facilitates memory by blocking dopamine neuron-mediated forgetting
Cell 161:1656–1667.

https://doi.org/10.1016/j.cell.2015.05.027
- PubMed
- Google Scholar
(2009) Drosophila larval NMJ dissection
Journal of Visualized Experiments: JoVE 24:1107.

https://doi.org/10.3791/1107
- PubMed
- Google Scholar
(2007) Species selectivity of mixed-lineage leukemia/trithorax and HCF proteolytic maturation pathways
Molecular and Cellular Biology 27:7063–7072.

https://doi.org/10.1128/MCB.00769-07
- PubMed
- Google Scholar
1. Capotosti F
2. Guernier S
3. Lammers F
4. Waridel P
5. Cai Y
6. Jin J
7. Conaway JW
8. Conaway RC
9. Herr W
(2011) O-GlcNAc transferase catalyzes site-specific proteolysis of HCF-1
Cell 144:376–388.

https://doi.org/10.1016/j.cell.2010.12.030
- PubMed
- Google Scholar
1. Castro VL
2. Quintana AM
(2020) The role of HCFC1 in syndromic and non-syndromic intellectual disability
Medical Research Archives 8:2122.

https://doi.org/10.18103/mra.v8i6.2122
- PubMed
- Google Scholar
1. Chen J
2. Dong X
3. Cheng X
4. Zhu Q
5. Zhang J
6. Li Q
7. Huang X
8. Wang M
9. Li L
10. Guo W
11. Sun B
12. Shu Q
13. Yi W
14. Li X
(2021) Ogt controls neural stem/progenitor cell pool and adult neurogenesis through modulating Notch signaling
Cell Reports 34:108905.

https://doi.org/10.1016/j.celrep.2021.108905
- PubMed
- Google Scholar
(2008) Structural insights into mechanism and specificity of O-GlcNAc transferase
The EMBO Journal 27:2780–2788.

https://doi.org/10.1038/emboj.2008.186
- PubMed
- Google Scholar
Software
1. Czajewski I
(2024) WBplotProfile, version swh:1:rev:ce33e6b84ef34dd56fda509a8fc2e68cbfac9976
Software Heritage.

https://archive.softwareheritage.org/swh:1:dir:ff1678464f51cdc6cb048125f42319d95f362d9c;origin=https://github.com/IgnacyCz/WBplotProfile;visit=swh:1:snp:cba042190325882a913cbd43d50fa647c7fd8374;anchor=swh:1:rev:ce33e6b84ef34dd56fda509a8fc2e68cbfac9976
1. Donelson NC
2. Kim EZ
3. Slawson JB
4. Vecsey CG
5. Huber R
6. Griffith LC
(2012) High-resolution positional tracking for long-term analysis of Drosophila sleep and locomotion using the “tracker” program
PLOS ONE 7:e37250.

https://doi.org/10.1371/journal.pone.0037250
- PubMed
- Google Scholar
1. Dorfmueller HC
2. Borodkin VS
3. Schimpl M
4. Zheng X
5. Kime R
6. Read KD
7. van Aalten DMF
(2010) Cell-penetrant, nanomolar O-GlcNAcase inhibitors selective against lysosomal hexosaminidases
Chemistry & Biology 17:1250–1255.

https://doi.org/10.1016/j.chembiol.2010.09.014
- PubMed
- Google Scholar
(2001) Identification of core alpha 1,3-fucosylated glycans and cloning of the requisite fucosyltransferase cDNA from Drosophila melanogaster: potential basis of the neural anti-horseadish peroxidase epitope
The Journal of Biological Chemistry 276:28058–28067.

https://doi.org/10.1074/jbc.M100573200
- PubMed
- Google Scholar
1. Fan X
2. White CW
3. Maynard JC
4. Wheatley EG
5. Bieri G
6. Couthouis J
7. Burlingame AL
8. Villeda SA
(2020) Age-related loss of neural stem cell O-GlcNAc promotes a glial fate switch through STAT3 activation
PNAS 117:22214–22224.

https://doi.org/10.1073/pnas.2007439117
- PubMed
- Google Scholar
(2017) The Familial co-aggregation of attention-deficit/hyperactivity disorder and intellectual disability: a register-based family study
Journal of the American Academy of Child and Adolescent Psychiatry 56:167–174.

https://doi.org/10.1016/j.jaac.2016.11.011
- PubMed
- Google Scholar
(2022) Intellectual disability-associated disruption of O-GlcNAc cycling impairs habituation learning in Drosophila
PLOS Genetics 18:e1010159.

https://doi.org/10.1371/journal.pgen.1010159
- PubMed
- Google Scholar
1. Francisco H
2. Kollins K
3. Varghis N
4. Vocadlo D
5. Vosseller K
6. Gallo G
(2009) O-GLcNAc post-translational modifications regulate the entry of neurons into an axon branching program
Developmental Neurobiology 69:162–173.

https://doi.org/10.1002/dneu.20695
- PubMed
- Google Scholar
1. Gambetta MC
2. Müller J
(2014) O-GlcNAcylation prevents aggregation of the Polycomb group repressor polyhomeotic
Developmental Cell 31:629–639.

https://doi.org/10.1016/j.devcel.2014.10.020
- PubMed
- Google Scholar
1. Gan G
2. Zhang C
(2018) The precise subcellular localization of Dlg in the Drosophila larva body wall using improved pre-embedding immuno-EM
Journal of Neuroscience Research 96:467–480.

https://doi.org/10.1002/jnr.24139
- PubMed
- Google Scholar
1. Gao Y
2. Wells L
3. Comer FI
4. Parker GJ
5. Hart GW
(2001) Dynamic O-glycosylation of nuclear and cytosolic proteins: cloning and characterization of a neutral, cytosolic beta-N-acetylglucosaminidase from human brain
The Journal of Biological Chemistry 276:9838–9845.

https://doi.org/10.1074/jbc.M010420200
- PubMed
- Google Scholar
(2019) Rethomics: An R framework to analyse high-throughput behavioural data
PLOS ONE 14:e0209331.

https://doi.org/10.1371/journal.pone.0209331
- PubMed
- Google Scholar
1. Hahne H
2. Sobotzki N
3. Nyberg T
4. Helm D
5. Borodkin VS
6. van Aalten DMF
7. Agnew B
8. Kuster B
(2013) Proteome wide purification and identification of O-GlcNAc-modified proteins using click chemistry and mass spectrometry
Journal of Proteome Research 12:927–936.

https://doi.org/10.1021/pr300967y
- PubMed
- Google Scholar
1. Harris CR
2. Millman KJ
3. van der Walt SJ
4. Gommers R
5. Virtanen P
6. Cournapeau D
7. Wieser E
8. Taylor J
9. Berg S
10. Smith NJ
11. Kern R
12. Picus M
13. Hoyer S
14. van Kerkwijk MH
15. Brett M
16. Haldane A
17. Del Río JF
18. Wiebe M
19. Peterson P
20. Gérard-Marchant P
21. Sheppard K
22. Reddy T
23. Weckesser W
24. Abbasi H
25. Gohlke C
26. Oliphant TE
(2020) Array programming with NumPy
Nature 585:357–362.

https://doi.org/10.1038/s41586-020-2649-2
- PubMed
- Google Scholar
1. Heckel D
2. Comtesse N
3. Brass N
4. Blin N
5. Zang KD
6. Meese E
(1998) Novel immunogenic antigen homologous to hyaluronidase in meningioma
Human Molecular Genetics 7:1859–1872.

https://doi.org/10.1093/hmg/7.12.1859
- PubMed
- Google Scholar
1. Holt GD
2. Snow CM
3. Senior A
4. Haltiwanger RS
5. Gerace L
6. Hart GW
(1987) Nuclear pore complex glycoproteins contain cytoplasmically disposed O-linked N-acetylglucosamine
The Journal of Cell Biology 104:1157–1164.

https://doi.org/10.1083/jcb.104.5.1157
- PubMed
- Google Scholar
1. Hunter JD
(2007) Matplotlib: A 2D graphics environment
Computing in Science & Engineering 9:90–95.

https://doi.org/10.1109/MCSE.2007.55
- Google Scholar
1. Ingham PW
(1984) A gene that regulates the bithorax complex differentially in larval and adult cells of Drosophila
Cell 37:815–823.

https://doi.org/10.1016/0092-8674(84)90416-1
- PubMed
- Google Scholar
1. Iyer SPN
2. Hart GW
(2003) Roles of the tetratricopeptide repeat domain in o-glcnac ferase targeting and protein substrate specificity
Journal of Biological Chemistry 278:24608–24616.

https://doi.org/10.1074/jbc.M300036200
- Google Scholar
1. Jang H
2. Kim TW
3. Yoon S
4. Choi S-Y
5. Kang T-W
6. Kim S-Y
7. Kwon Y-W
8. Cho E-J
9. Youn H-D
(2012) O-GlcNAc regulates pluripotency and reprogramming by directly acting on core components of the pluripotency network
Cell Stem Cell 11:62–74.

https://doi.org/10.1016/j.stem.2012.03.001
- PubMed
- Google Scholar
1. Kim G
2. Cao L
3. Reece EA
4. Zhao Z
(2017) Impact of protein O-GlcNAcylation on neural tube malformation in diabetic embryopathy
Scientific Reports 7:11107.

https://doi.org/10.1038/s41598-017-11655-6
- PubMed
- Google Scholar
1. Kim DK
2. Lee J-S
3. Lee EY
4. Jang H
5. Han S
6. Kim HY
7. Hwang I-Y
8. Choi J-W
9. Shin HM
10. You HJ
11. Youn H-D
12. Jang H
(2021a) O-GlcNAcylation of Sox2 at threonine 258 regulates the self-renewal and early cell fate of embryonic stem cells
Experimental & Molecular Medicine 53:1759–1768.

https://doi.org/10.1038/s12276-021-00707-7
- PubMed
- Google Scholar
1. Kim S-M
2. Zhang S
3. Park J
4. Sung HJ
5. Tran T-DT
6. Chung C
7. Han I-O
(2021b) REM Sleep Deprivation Impairs Learning and Memory by Decreasing Brain O-GlcNAc Cycling in Mouse
Neurotherapeutics 18:2504–2517.

https://doi.org/10.1007/s13311-021-01094-7
- PubMed
- Google Scholar
(2017) Sleep problems in children with autism spectrum disorder and intellectual disability without autism spectrum disorder
Sleep Medicine 40:69–77.

https://doi.org/10.1016/j.sleep.2017.09.021
- PubMed
- Google Scholar
(1997) Dynamic glycosylation of nuclear and cytosolic proteins: cloning and characterization of a unique O-GlcNAc transferase with multiple tetratricopeptide repeats
The Journal of Biological Chemistry 272:9308–9315.

https://doi.org/10.1074/jbc.272.14.9308
- PubMed
- Google Scholar
1. Kreppel LK
2. Hart GW
(1999) Regulation of a cytosolic and nuclear O-GlcNAc transferase: role of the tetratricopeptide repeats
The Journal of Biological Chemistry 274:32015–32022.

https://doi.org/10.1074/jbc.274.45.32015
- PubMed
- Google Scholar
(2017) O-GlcNAc transferase regulates excitatory synapse maturity
PNAS 114:1684–1689.

https://doi.org/10.1073/pnas.1621367114
- PubMed
- Google Scholar
1. Lazarus MB
2. Jiang J
3. Kapuria V
4. Bhuiyan T
5. Janetzko J
6. Zandberg WF
7. Vocadlo DJ
8. Herr W
9. Walker S
(2013) HCF-1 is cleaved in the active site of O-GlcNAc transferase
Science 342:1235–1239.

https://doi.org/10.1126/science.1243990
- PubMed
- Google Scholar
1. Lee Y
2. Park J
3. Kim S-M
4. Nam K
5. Lee W
6. Cho H
7. Han I-O
(2020) Sleep deprivation impairs learning and memory by decreasing protein O-GlcNAcylation in the brain of adult zebrafish
FASEB Journal 34:853–864.

https://doi.org/10.1096/fj.201901399RR
- PubMed
- Google Scholar
1. Lee BE
2. Suh PG
3. Kim JI
(2021) O-GlcNAcylation in health and neurodegenerative diseases
Experimental & Molecular Medicine 53:1674–1682.

https://doi.org/10.1038/s12276-021-00709-5
- PubMed
- Google Scholar
1. Levine ZG
2. Fan C
3. Melicher MS
4. Orman M
5. Benjamin T
6. Walker S
(2018) O-GlcNAc Transferase recognizes protein substrates using an asparagine ladder in the tetratricopeptide repeat (TPR) superhelix
Journal of the American Chemical Society 140:3510–3513.

https://doi.org/10.1021/jacs.7b13546
- PubMed
- Google Scholar
1. Levine ZG
2. Potter SC
3. Joiner CM
4. Fei GQ
5. Nabet B
6. Sonnett M
7. Zachara NE
8. Gray NS
9. Paulo JA
10. Walker S
(2021) Mammalian cell proliferation requires noncatalytic functions of O-GlcNAc transferase
PNAS 118:e2016778118.

https://doi.org/10.1073/pnas.2016778118
- PubMed
- Google Scholar
1. Li J
2. Li Z
3. Duan X
4. Qin K
5. Dang L
6. Sun S
7. Cai L
8. Hsieh-Wilson LC
9. Wu L
10. Yi W
(2019) An Isotope-Coded Photocleavable probe for quantitative profiling of protein O-GlcNAcylation
ACS Chemical Biology 14:4–10.

https://doi.org/10.1021/acschembio.8b01052
- PubMed
- Google Scholar
1. Lubas WA
2. Frank DW
3. Krause M
4. Hanover JA
(1997) O-Linked GlcNAc transferase is a conserved nucleocytoplasmic protein containing tetratricopeptide repeats
The Journal of Biological Chemistry 272:9316–9324.

https://doi.org/10.1074/jbc.272.14.9316
- PubMed
- Google Scholar
1. Ly S
2. Pack AI
3. Naidoo N
(2018) The neurobiological basis of sleep: Insights from Drosophila
Neuroscience and Biobehavioral Reviews 87:67–86.

https://doi.org/10.1016/j.neubiorev.2018.01.015
- PubMed
- Google Scholar
(2015) Dual functionality of O-GlcNAc transferase is required for Drosophila development
Open Biology 5:150234.

https://doi.org/10.1098/rsob.150234
- PubMed
- Google Scholar
(2018) Effects of hypo-O-GlcNAcylation on Drosophila development
Journal of Biological Chemistry 293:7209–7221.

https://doi.org/10.1074/jbc.RA118.002580
- Google Scholar
(2016) Systematic review of the prevalence and incidence of intellectual disabilities: current trends and issues
Current Developmental Disorders Reports 3:104–115.

https://doi.org/10.1007/s40474-016-0085-7
- Google Scholar
1. Muha V
2. Williamson R
3. Hills R
4. McNeilly AD
5. McWilliams TG
6. Alonso J
7. Schimpl M
8. Leney AC
9. Heck AJR
10. Sutherland C
11. Read KD
12. McCrimmon RJ
13. Brooks SP
14. van Aalten DMF
(2019) Loss of CRMP2 O-GlcNAcylation leads to reduced novel object recognition performance in mice
Open Biology 9:190192.

https://doi.org/10.1098/rsob.190192
- PubMed
- Google Scholar
(2020) O-GlcNAcase contributes to cognitive function in Drosophila
Journal of Biological Chemistry 295:8636–8646.

https://doi.org/10.1074/jbc.RA119.010312
- Google Scholar
(2021) Loss of O-GlcNAcase catalytic activity leads to defects in mouse embryogenesis
The Journal of Biological Chemistry 296:100439.

https://doi.org/10.1016/j.jbc.2021.100439
- PubMed
- Google Scholar
1. Myers SA
2. Peddada S
3. Chatterjee N
4. Friedrich T
5. Tomoda K
6. Krings G
7. Thomas S
8. Maynard J
9. Broeker M
10. Thomson M
11. Pollard K
12. Yamanaka S
13. Burlingame AL
14. Panning B
(2016) SOX2 O-GlcNAcylation alters its protein-protein interactions and genomic occupancy to modulate gene expression in pluripotent cells
eLife 5:e10647.

https://doi.org/10.7554/eLife.10647
- PubMed
- Google Scholar
(2016) A New fiji-based algorithm that systematically quantifies nine synaptic parameters provides insights into Drosophila NMJ morphometry
PLOS Computational Biology 12:e1004823.

https://doi.org/10.1371/journal.pcbi.1004823
- PubMed
- Google Scholar
(2017) Nutrient-driven O-linked N-acetylglucosamine (O-GlcNAc) cycling impacts neurodevelopmental timing and metabolism
Journal of Biological Chemistry 292:6076–6085.

https://doi.org/10.1074/jbc.M116.774042
- Google Scholar
Preprint
1. Omelková M
2. Fenger CD
3. Murray M
4. Hammer TB
5. Pravata VM
6. Bartual SG
7. Czajewski I
8. Bayat A
9. Ferenbach AT
10. Stavridis MP
11. van Aalten DMF
(2023) An O-GlcNAc Transferase pathogenic variant that affects pluripotent stem cell self-renewal
bioRxiv.

https://doi.org/10.1101/2023.03.13.531514
- Google Scholar
1. Pan L
2. Zhang YQ
3. Woodruff E
4. Broadie K
(2004) The Drosophila fragile X gene negatively regulates neuronal elaboration and synaptic differentiation
Current Biology 14:1863–1870.

https://doi.org/10.1016/j.cub.2004.09.085
- PubMed
- Google Scholar
1. Park S
2. Park S-H
3. Baek JY
4. Jy YJ
5. Kim KS
6. Roth J
7. Cho JW
8. Choe K-M
(2011) Protein O-GlcNAcylation regulates Drosophila growth through the insulin signaling pathway
Cellular and Molecular Life Sciences 68:3377–3384.

https://doi.org/10.1007/s00018-011-0640-7
- PubMed
- Google Scholar
(1997) The dynamics of neurogenic signalling underlying bristle development in Drosophila melanogaster
Mechanisms of Development 63:61–74.

https://doi.org/10.1016/s0925-4773(97)00675-8
- PubMed
- Google Scholar
(2022) Nutrient sensitive protein O-GlcNAcylation modulates the transcriptome through epigenetic mechanisms during embryonic neurogenesis
Life Science Alliance 5:e202201385.

https://doi.org/10.26508/lsa.202201385
- PubMed
- Google Scholar
1. Pravata VM
2. Muha V
3. Gundogdu M
4. Ferenbach AT
5. Kakade PS
6. Vandadi V
7. Wilmes AC
8. Borodkin VS
9. Joss S
10. Stavridis MP
11. van Aalten DMF
(2019) Catalytic deficiency of O-GlcNAc transferase leads to X-linked intellectual disability
PNAS 116:14961–14970.

https://doi.org/10.1073/pnas.1900065116
- PubMed
- Google Scholar
(2020a) A missense mutation in the catalytic domain of O-GlcNAc transferase links perturbations in protein O-GlcNAcylation to X-linked intellectual disability
FEBS Letters 594:717–727.

https://doi.org/10.1002/1873-3468.13640
- PubMed
- Google Scholar
1. Pravata VM
2. Omelková M
3. Stavridis MP
4. Desbiens CM
5. Stephen HM
6. Lefeber DJ
7. Gecz J
8. Gundogdu M
9. Õunap K
10. Joss S
11. Schwartz CE
12. Wells L
13. van Aalten DMF
(2020b) An intellectual disability syndrome with single-nucleotide variants in O-GlcNAc transferase
European Journal of Human Genetics 28:706–714.

https://doi.org/10.1038/s41431-020-0589-9
- PubMed
- Google Scholar
(2006) Structural insights into the mechanism and inhibition of eukaryotic O-GlcNAc hydrolysis
The EMBO Journal 25:1569–1578.

https://doi.org/10.1038/sj.emboj.7601026
- PubMed
- Google Scholar
1. Rasch B
2. Born J
(2013) About sleep’s role in memory
Physiological Reviews 93:681–766.

https://doi.org/10.1152/physrev.00032.2012
- PubMed
- Google Scholar
1. Rexach JE
2. Clark PM
3. Mason DE
4. Neve RL
5. Peters EC
6. Hsieh-Wilson LC
(2012) Dynamic O-GlcNAc modification regulates CREB-mediated gene expression and memory formation
Nature Chemical Biology 8:253–261.

https://doi.org/10.1038/nchembio.770
- PubMed
- Google Scholar
1. Salvador-Carulla L
2. Reed GM
3. Vaez-Azizi LM
4. Cooper SA
5. Martinez-Leal R
6. Bertelli M
7. Adnams C
8. Cooray S
9. Deb S
10. Akoury-Dirani L
11. Girimaji SC
12. Katz G
13. Kwok H
14. Luckasson R
15. Simeonsson R
16. Walsh C
17. Munir K
18. Saxena S
(2011) Intellectual developmental disorders: towards a new name, definition and framework for “mental retardation/intellectual disability” in ICD-11
World Psychiatry 10:175–180.

https://doi.org/10.1002/j.2051-5545.2011.tb00045.x
- PubMed
- Google Scholar
(2010) Blocking O-linked GlcNAc cycling in Drosophila insulin-producing cells perturbs glucose-insulin homeostasis
The Journal of Biological Chemistry 285:38684–38691.

https://doi.org/10.1074/jbc.M110.155192
- PubMed
- Google Scholar
1. Selvan N
2. George S
3. Serajee FJ
4. Shaw M
5. Hobson L
6. Kalscheuer V
7. Prasad N
8. Levy SE
9. Taylor J
10. Aftimos S
11. Schwartz CE
12. Huq AM
13. Gecz J
14. Wells L
(2018) O-GlcNAc transferase missense mutations linked to X-linked intellectual disability deregulate genes involved in cell fate determination and signaling
The Journal of Biological Chemistry 293:10810–10824.

https://doi.org/10.1074/jbc.RA118.002583
- PubMed
- Google Scholar
1. Shafer OT
2. Keene AC
(2021) The regulation of Drosophila sleep
Current Biology 31:R38–R49.

https://doi.org/10.1016/j.cub.2020.10.082
- PubMed
- Google Scholar
(2009) Drosophila O-GlcNAc transferase (OGT) is encoded by the Polycomb group (PcG) gene, super sex combs (sxc)
PNAS 106:13427–13432.

https://doi.org/10.1073/pnas.0904638106
- PubMed
- Google Scholar
1. Tan Z-W
2. Fei G
3. Paulo JA
4. Bellaousov S
5. Martin SES
6. Duveau DY
7. Thomas CJ
8. Gygi SP
9. Boutz PL
10. Walker S
(2020) O-GlcNAc regulates gene expression by controlling detained intron splicing
Nucleic Acids Research 48:5656–5669.

https://doi.org/10.1093/nar/gkaa263
- Google Scholar
1. Taylor EW
2. Wang K
3. Nelson AR
4. Bredemann TM
5. Fraser KB
6. Clinton SM
7. Puckett R
8. Marchase RB
9. Chatham JC
10. McMahon LL
(2014) O-GlcNAcylation of AMPA receptor GluA2 is associated with a novel form of long-term depression at hippocampal synapses
The Journal of Neuroscience 34:10–21.

https://doi.org/10.1523/JNEUROSCI.4761-12.2014
- PubMed
- Google Scholar
(2018) Methods for the detection, study, and dynamic profiling of O-GlcNAc glycosylation
Methods in Enzymology 598:101–135.

https://doi.org/10.1016/bs.mie.2017.06.009
- PubMed
- Google Scholar
1. Torres CR
2. Hart GW
(1984)
Topography and polypeptide distribution of terminal N-acetylglucosamine residues on the surfaces of intact lymphocytes: evidence for O-linked GlcNAc

The Journal of Biological Chemistry 259:3308–3317.
- PubMed
- Google Scholar
Software
1. Umesh P
(2012) Image processing in python, version 23
CSI Communications.

https://scholar.google.co.in/citations?user=A2RaoBAAAAAJ&hl=en
1. Urso SJ
2. Comly M
3. Hanover JA
4. Lamitina T
(2020) The O-GlcNAc transferase OGT is a conserved and essential regulator of the cellular and organismal response to hypertonic stress
PLOS Genetics 16:e1008821.

https://doi.org/10.1371/journal.pgen.1008821
- PubMed
- Google Scholar
1. Vaidyanathan K
2. Niranjan T
3. Selvan N
4. Teo CF
5. May M
6. Patel S
7. Weatherly B
8. Skinner C
9. Opitz J
10. Carey J
11. Viskochil D
12. Gecz J
13. Shaw M
14. Peng Y
15. Alexov E
16. Wang T
17. Schwartz C
18. Wells L
(2017) Identification and characterization of a missense mutation in the O-linked β-N-acetylglucosamine (O-GlcNAc) transferase gene that segregates with X-linked intellectual disability
The Journal of Biological Chemistry 292:8948–8963.

https://doi.org/10.1074/jbc.M116.771030
- PubMed
- Google Scholar
1. Virtanen P
2. Gommers R
3. Oliphant TE
4. Haberland M
5. Reddy T
6. Cournapeau D
7. Burovski E
8. Peterson P
9. Weckesser W
10. Bright J
11. van der Walt SJ
12. Brett M
13. Wilson J
14. Millman KJ
15. Mayorov N
16. Nelson ARJ
17. Jones E
18. Kern R
19. Larson E
20. Carey CJ
21. Polat İ
22. Feng Y
23. Moore EW
24. VanderPlas J
25. Laxalde D
26. Perktold J
27. Cimrman R
28. Henriksen I
29. Quintero EA
30. Harris CR
31. Archibald AM
32. Ribeiro AH
33. Pedregosa F
34. van Mulbregt P
35. SciPy 1.0 Contributors
(2020) SciPy 1.0: fundamental algorithms for scientific computing in Python
Nature Methods 17:261–272.

https://doi.org/10.1038/s41592-019-0686-2
- PubMed
- Google Scholar
(2017) Mutations in N-acetylglucosamine (O-GlcNAc) transferase in patients with X-linked intellectual disability
Journal of Biological Chemistry 292:12621–12631.

https://doi.org/10.1074/jbc.M117.790097
- Google Scholar
(2009) Quantification of food intake in Drosophila
PLOS ONE 4:e6063.

https://doi.org/10.1371/journal.pone.0006063
- PubMed
- Google Scholar
(2021) The human O-GlcNAcome database and meta-analysis
Scientific Data 8:25.

https://doi.org/10.1038/s41597-021-00810-4
- PubMed
- Google Scholar
1. Yuzwa SA
2. Macauley MS
3. Heinonen JE
4. Shan X
5. Dennis RJ
6. He Y
7. Whitworth GE
8. Stubbs KA
9. McEachern EJ
10. Davies GJ
11. Vocadlo DJ
(2008) A potent mechanism-inspired O-GlcNAcase inhibitor that blocks phosphorylation of tau in vivo
Nature Chemical Biology 4:483–490.

https://doi.org/10.1038/nchembio.96
- PubMed
- Google Scholar

Article and author information

Author details

Ignacy Czajewski

Division of Molecular, Cell and Developmental Biology, School of Life Sciences, University of Dundee, Dundee, United Kingdom

Contribution
Conceptualization, Formal analysis, Validation, Investigation, Visualization, Methodology, Writing – original draft

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-1661-5806
Bijayalaxmi Swain

Section of Neurobiology and DANDRITE, Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark

Contribution
Investigation

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0003-0885-0395
Jiawei Xu

Section of Neurobiology and DANDRITE, Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark

Contribution
Investigation

Competing interests
No competing interests declared
Laurin McDowall

Division of Molecular, Cell and Developmental Biology, School of Life Sciences, University of Dundee, Dundee, United Kingdom

Contribution
Data curation, Investigation, Methodology

Competing interests
No competing interests declared
Andrew T Ferenbach
1. Division of Molecular, Cell and Developmental Biology, School of Life Sciences, University of Dundee, Dundee, United Kingdom
2. Section of Neurobiology and DANDRITE, Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark
Contribution
Investigation, Methodology, Writing - review and editing

Competing interests
No competing interests declared
Daan MF van Aalten
1. Division of Molecular, Cell and Developmental Biology, School of Life Sciences, University of Dundee, Dundee, United Kingdom
2. Section of Neurobiology and DANDRITE, Department of Molecular Biology and Genetics, Aarhus University, Aarhus, Denmark
Contribution
Conceptualization, Resources, Formal analysis, Supervision, Funding acquisition, Investigation, Project administration, Writing - review and editing

For correspondence
daan@mbg.au.dk

Competing interests
No competing interests declared

"This ORCID iD identifies the author of this article:" 0000-0002-1499-6908

Funding

Wellcome Trust (110061)

Daan MF van Aalten

Novo Nordisk Foundation (NNF21OC0065969)

Daan MF van Aalten

National Centre for the Replacement Refinement and Reduction of Animals in Research (T001682)

Ignacy Czajewski

Villum Fonden (Villum Investigator 00054496)

Daan MF van Aalten

The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. For the purpose of Open Access, the authors have applied a CC BY public copyright license to any Author Accepted Manuscript version arising from this submission.

Acknowledgements

This work was funded by a Wellcome Trust Investigator Award (110061), a Novo Nordisk Foundation Laureate award (NNF21OC0065969), and a Villum Fonden Investigator (00054496) to DMFvA, and a PhD studentship from the National Centre for the Replacement, Refinement and Reduction of Animals in Research (NC3Rs, award number T001682).

Supported in part by the Danish Research Institute of Translational Neuroscience – DANDRITE of the Nordic-EMBL Partnership for Molecular Medicine and Lundbeckfonden. We also thank Leeanne McGurk and Jens Januschke for their feedback as well as past and current members of our laboratory for their input, including Hannah Smith, Marta Murray, Veronica Pravata, and Conor Mitchell.

Copyright

This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Mendeley

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Ignacy Czajewski
Bijayalaxmi Swain
Jiawei Xu
Laurin McDowall
Andrew T Ferenbach
Daan MF van Aalten

(2024)

Rescuable sleep and synaptogenesis phenotypes in a Drosophila model of O-GlcNAc transferase intellectual disability

eLife 13:e90376.

https://doi.org/10.7554/eLife.90376

Categories and tags

Research organism

D. melanogaster

Share this article

Cite this article

Variants affecting the calytic domain of OGT reduce O-GlcNAcylation throughout development.

Figure 1—source data 1

Figure 1—source data 2

Figure 1—source data 3

Genetic and phamacological rescue of O-GlcNAcylation in sxcC941Y flies.

Figure 2—source data 1

Figure 2—source data 2

Variants affecting the catalytic domain of OGT impair neuromuscular junction development.

Figure 3—source data 1

Thiamet G partially rescues neuromuscular junction defects in sxcC941Y larvae.

Figure 4—source data 1

Fragmented sleep in a Drosophila model of OGT-CDG.

Figure 5—source data 1

Figure 5—source data 2

Thiamet G partially rescues sleep in adult sxcC941Y flies.

Figure 6—source data 1

Figure 6—source data 2

Figure 6—source data 3

Glial knockdown of sxc partially phenocopies sxcC941Y sleep defects.

Figure 7—source data 1

Figure 7—source data 2

List of oligonucleotides used in CRISPR-Cas9 mutagenesis section.

Author details

Ignacy Czajewski

Contribution

Competing interests

Bijayalaxmi Swain

Contribution

Competing interests

Jiawei Xu

Contribution

Competing interests

Laurin McDowall

Contribution

Competing interests

Andrew T Ferenbach

Contribution

Competing interests

Daan MF van Aalten

Contribution

For correspondence

Competing interests

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

Categories and tags

Research organism

Further reading

Genetic and phamacological rescue of O-GlcNAcylation in sxc^C941Y flies.

Thiamet G partially rescues neuromuscular junction defects in sxc^C941Y larvae.

Thiamet G partially rescues sleep in adult sxc^C941Y flies.

Glial knockdown of sxc partially phenocopies sxc^C941Y sleep defects.