Cohesin reconstitution and homologous recombination repair of DNA double-strand breaks in late mitosis
- Hospital Universitario Nuestra Señora de Candelaria, Instituto de Investigación Sanitaria de Canarias (IISC), Spain
- Instituto of Tecnologías Biomédicas, Universidad de La Laguna, Spain
- Department of Microbiology and Immunology, Columbia University Medical Center, United States
- Facultad de Ciencias de la Salud, Universidad Fernando Pessoa Canarias, Spain
Figures
Figure 1
Scc1 returns after double-strand breaks (DSBs) in late mitosis.
(A) Schematic of the experimental procedure. Cells in logarithmic growth phase were first arrested in telophase (Tel) by incubating them at 34°C for 3 hr (strains bear the cdc15-2 allele). Then, the culture was divided into three subcultures. One served as a mock control, and the other two were treated to generate DSBs, one with β-estradiol (to express the HO endonuclease) and the other with phleomycin. The strain is unable to repair the HO DSB break by HR-driven gene conversion (Δhmr Δhml). (B) Western blot against Scc1-3myc. This experiment compares Scc1-3myc levels in an asynchronous, G2- and telophase-blocked cultures. The leftmost lane (No tag) is a control strain for Scc1 without the 3myc epitope tag. Pgk1 protein served as a housekeeping. Ponceau S staining is also shown as a loading control. Asyn.: asynchronous. Tel: telophase. +Phle: 10 mg·ml–1 phleomycin. +HO: 2 μM β-estradiol. *: Unspecific band detected by the α-myc antibody just over the Scc1-3myc signal. (C) Like in (B) but against Smc1-6HA. (D) Like in (C) but against Smc3-6HA. (E) Quantification of Scc1-3myc and Smc1-6HA levels in all conditions (mean ± SEM, n = 3). Statistical comparisons are shown for selected pairs (**p < 0.01; one-way ANOVA, Tukey’s post hoc).
-
Figure 1—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig1-data1-v1.zip
-
Figure 1—source data 2
Uncropped blots in Figure 1B.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig1-data2-v1.pdf
-
Figure 1—source data 3
Uncropped blots in Figure 1C, D.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig1-data3-v1.pdf
-
Figure 1—source data 4
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig1-data4-v1.xlsx
Figure 2 with 3 supplements
Scc1 forms a reconstituted chromatin-bound cohesin complex after the HO double-strand break (DSB) in late mitosis.
Cells were treated as in Figure 1A. (A) Co-immunoprecipitation (co-IP) of the core cohesin complex. Smc1-6HA was used as the bait protein; the leftmost lane includes a control with an untagged Smc1. (B) Chromatin fractionation of the strain expressing Smc1-6HA and Scc1-3myc. Relative protein levels (to the mock sample) are indicated under the blots. Pgk1 and histone H3 (HH3) were included as reporters of the cytosolic and chromatin-bound fractions, respectively. The asterisk (*) indicates an unspecific band in the whole cell extract (WCE) that is absent from the chromatin-bound fraction. (C) Cohesin does not bind the HO DSB in telophase. Chromatin immunoprecipitation (ChIP) of Smc3-6HA with (+HO) and without (−HO) HO induction (mean ± SEM, n = 3).
-
Figure 2—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-data1-v1.zip
-
Figure 2—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-data2-v1.pdf
-
Figure 2—source data 3
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-data3-v1.xlsx
Figure 2—figure supplement 1
Co-immunoprecipitation (co-IP) of the core cohesin complex.
This is a biological replicate of the experiment shown in Figure 2A.
-
Figure 2—figure supplement 1—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-figsupp1-data1-v1.zip
-
Figure 2—figure supplement 1—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-figsupp1-data2-v1.pdf
Figure 2—figure supplement 2
Assessment of chromatin-bound cohesin after double-strand breaks (DSBs) in late mitosis.
Related to Figure 2B. (A) Optimization of the chromatin fractionation using the chromatin-bound pool of Smc3 (acetylated Smc3; acSmc3) and the histone H3 (HH3). The best results were obtained after three successive rounds of fractionation (pellet #3, P3; see Materials and methods). S, supernatant; P, pellet. (B) The strain expressing Smc3-6HA was subjected to the same experiment and chromatin fractionation performed in Figure 2B for Smc1-6HA and Scc1-3myc. Note that there are more chromatin-bound acSmc3 after DSBs, especially after the HO DSB.
-
Figure 2—figure supplement 2—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-figsupp2-data1-v1.zip
-
Figure 2—figure supplement 2—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-figsupp2-data2-v1.pdf
Figure 2—figure supplement 3
Chromatin immunoprecipitation (ChIP) of Smc3-6HA in G2/M.
Related to Figure 2C. The ChIP was performed upon cells arrested in G2/M with nocodazole and further subdivided into two subcultures, one in which the HO double-strand break (DSB) was generated (+HO) and one without the DSB (−HO). The strain is unable to repair the break by gene conversion (Δhmr Δhml), and the HO induction lasted 2 hr. Note the increase in Smc3 binding in the vicinity of HOcs after the DSB. This experiment was performed in parallel to the second repetition for Tel arrested cells shown in Figure 2C.
-
Figure 2—figure supplement 3—source data 1
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-figsupp3-data1-v1.xlsx
Figure 3 with 2 supplements
Homologous recombination (HR) repairs the HO double-strand break (DSB) in telophase.
(A, B) Resection in late mitosis is almost as efficient as in G2/M. Cells were arrested in G2/M or telophase (Tel), and then the HO DSB was generated by adding β-estradiol. Samples were taken at the indicated times to monitor the kinetics of resection. This strain is unable to repair the HO DSB break by HR-driven gene conversion (Δhmr Δhml). (A) Charts depicting the resection kinetics for two different amplicons located at 726 bp and 5.7 kb downstream the Hocs break (mean ± SEM, n = 3; fresected is the proportion of resected DNA). (B) Representative Western blots against Rad53 to follow the sensing of DNA damage detection in G2/M versus late mitosis. (C–F) Yeast cells use HR to repair the HO DSB in late mitosis. Cells were first blocked in telophase (Tel). Then, the HO DSB was generated by adding β-estradiol. After 1 hr, the β-estradiol was washed away, and samples were taken to monitor the repair for 3 hr. The strain can repair the HO DSB break by HR-driven gene conversion (Δhmr HML). (C) Schematic of the fragments obtained after a StyI digestion for both MATa and MATα sequences. The probe to detect the fragments by Southern blot is in blue. When the MATa locus is intact, the digestion gives rise to a 0.9 kb fragment. The HO cutting site (Hocs) is located within the StyI-digested MATa locus. Thus, the HO-driven DSB shortens the fragment to 0.7 kb. HR leads to a gene conversion to MATα, which results in the loss of a StyI restriction site and a new fragment of 1.8 kb. (D) Representative Western blot analyses for HO induction and subsequent degradation (tagged with Flag epitope) and the DSB sensing through Rad53 hyperphosphorylation. A Pgk1 Western blot served as a housekeeping, and Ponceau S staining of the membrane as a loading control for all lanes. The leftmost lane in the Ponceau S corresponds to the protein weight marker. (E) Representative Southern blot for the MAT switching assay in late mitosis. Alongside the MAT probe, a second probe against the ACT1 gene (1.1 kb fragment) was included for normalization. The MAT probe also recognizes an allele-independent MAT distal fragment (2.2 kb). (F) Quantification of relative band intensities in the MAT switching Southern blots (mean ± SEM, n = 3). Individual values were normalized to the ACT1 signals. Then, every lane was normalized to MATa at the arrest. Tel: telophase. +βE: β-estradiol addition.
-
Figure 3—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-data1-v1.zip
-
Figure 3—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-data2-v1.pdf
-
Figure 3—source data 3
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-data3-v1.xlsx
Figure 3—figure supplement 1
The principle of the qPCR resection assay.
Related to Figure 3A, B. (A) Schematic representation of the HO resection assay. Primers (blue arrows) are designed to amplify a sequence that contains a StyI target site adjacent to the HO cutting site (HOcs). When this restriction enzyme is used on the extracted genomic DNA, amplification is inhibited. If resection extends beyond the StyI site, StyI does not cut and the primers can amplify. (B) Summary table of the amplification yield obtained after the StyI digestion during HOcs resection.
Figure 3—figure supplement 2
Features of homologous recombination (HR) to repair the HOcs double-strand break (DSB) in late mitosis.
Related to Figure 3C–F. Cells were first blocked in the cdc15-2 arrest at 34°C for 3 hr (Tel). Then, the HO DSB was generated by adding β-estradiol. After 1 hr, the β-estradiol was washed away, and samples were taken to monitor the repair for 3 hr. (A–C) Kinetics of the HOcs DSB repair in yku70Δ. Yku70 is part of a conserved complex that recognizes a DSB and drives its repair toward non-homologous end joining (NHEJ). (D–F) Kinetics of the HOcs DSB repair in rad9Δ. Rad9 is a mediator in the DDC that promotes activation of the effector kinase Rad53. (G–I) Kinetics of the HOcs DSB repair in mre11Δ. Mre1 is part of the MRX complex, which tethers the DSB ends and facilitates end resection. (A, D, G) Representative Western blot analyses for HO induction and subsequent degradation (tagged with Flag epitope) and the DSB sensing through Rad53 hyperphosphorylation (note that Rad53 does not get hyperphosphorylated in rad9Δ). A PGK1 Western blot served as a housekeeping and Ponceau S staining of the membrane as a loading control for all lanes. The leftmost lane in the Ponceau S corresponds to the protein weight marker. (B, E, H) Representative Southern blots for the MAT switching assays in late mitosis. Alongside the MAT probe, a second probe against the ACT1 gene (1.1 kb fragment) was included for normalization. The MAT probe also recognizes an allele-independent MAT distal fragment (2.2 kb). (C, F, I) Quantification of relative band intensities in the MAT switching Southern blots (mean ± SEM, n = 3). Individual values were normalized to the ACT1 signals. Then, every lane was normalized to MATa at the arrest. Note that repair kinetics is similar to that of the wild type in Figure 3E, F. Tel: telophase. +βE: β-estradiol addition.
-
Figure 3—figure supplement 2—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-figsupp2-data1-v1.zip
-
Figure 3—figure supplement 2—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-figsupp2-data2-v1.pdf
-
Figure 3—figure supplement 2—source data 3
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-figsupp2-data3-v1.xlsx
Figure 4 with 1 supplement
Cohesin removal does not alter homologous recombination (HR) at the MAT locus in late mitosis.
(A) Serial dilution spot assay for the smc3:aid* strains. The fitness effect of Smc3-aid* degradation was tested in the smc3:aid* OsTIR1 strain in the presence of 8 mM IAA. The same strain without the ubiquitin-ligase OsTIR1 was also used as the control. (B–D) Cells of four strains with all possible combinations of the smc3:aid* and OsTIR1 pairs were treated as in Figure 1A but including a 1-hr IAA step between the cdc15-2 arrest and the induction of HO. Then, HO was induced for 1 hr with β-estradiol (1h+βE sample), after which it was washed off and the cells were allowed to recover from the double-strand break (DSB) for 2 hr (3h-βE sample). IAA and the Tel arrest were maintained throughout the experiment. (B) Representative Western blot of the four strains at the time of the arrest (Tel) and 1 hr after IAA addition (+IAA). Note the confirmation of the different genotypic combinations, as well as the Smc3-aid* decline after IAA addition. (C) Representative Southern blot for the MAT switching assay of the four strains in the presence of 8 mM IAA. Note that HO cutting is less efficient than without IAA (see Figure 3E, Figure 4—figure supplement 1B, C) but gene conversion is still possible after degrading Smc3-aid* in late mitosis. (D) Quantification of relative MAT switching (mean ± SEM, n = 3). Gene conversion to MATα in the 3h-βE sample was normalized to the cut HOcs in the 1h+βE sample. Then, gene conversion yield was normalized to the wild-type (no tagged Smc3, no OsTir1) strain. Tel: telophase. +βE: β-estradiol addition. −βE: β-estradiol removal. +IAA: indole-acetic acid. (E) Model of how DSBs reconstitute cohesin in late mitosis. The cohesin complex (Smc1–Smc3–Scc1) entraps sister chromatids before anaphase. (1) At anaphase onset, Esp1 (separase) is activated to cleave Scc1 and release sister chromatids for segregation. (2) If DSBs occur before cytokinesis, Scc1 returns and reconstitutes the cohesin complex. At least a fraction of the complex binds to chromatin. The reappearance of Scc1 likely occurs through the inhibition of Esp1 and/or post-translational protection of Scc1 by the DNA damage checkpoint.
-
Figure 4—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-data1-v1.zip
-
Figure 4—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-data2-v1.pdf
-
Figure 4—source data 3
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-data3-v1.xlsx
Figure 4—figure supplement 1
MAT switching yield of Smc3-aid* OsTIR1 upon IAA addition.
Cells were treated as in Figure 3D–F but including a 1-hr IAA step between the cdc15-2 arrest and the induction of HO. IAA was then maintained throughout the experiment. (A) Representative Western blot as in Figure 3D but also including Smc3-aid* decline after IAA addition. Note that the chromatin-bound acSmc3 is degraded as well. (B) Representative Southern blot for the MAT switching assay as in Figure 3E. (C) Quantification of relative band intensities for MAT switching Southern blots (mean ± SEM, n = 3). Values were normalized as in Figure 3F. The MAT switching in the wild-type strain without IAA is represented alongside for comparison. Note that there is a decrease in the cutting efficiency of HO (MATa levels remained higher) as well as in the gene conversion into MATα. However, these phenotypic changes are due to IAA rather than cohesin depletion (see Figure 4C). Tel: telophase. +βE: β-estradiol addition. +IAA: indole-acetic acid.
-
Figure 4—figure supplement 1—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-figsupp1-data1-v1.zip
-
Figure 4—figure supplement 1—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-figsupp1-data2-v1.pdf
-
Figure 4—figure supplement 1—source data 3
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-figsupp1-data3-v1.xlsx
Tables
Table 1
Strains used in this work.
| Strain | Relevant genotype* | Origin | Figure |
|---|---|---|---|
| FM2344 | (YPH499) MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 bar1-Δ; cdc15-2:9myc::Hph; HMLα ∆hmr::HIS3MX | Machín lab | (Parental) |
| LSY4319-1C | (W303) MATα leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15 RAD5 ∆hml ∆hmr; leu2-3::lexO4p:HO:FLAG:CYC1t::ACT1p:LexA-ER-B112-T:CYC1p::LEU2MX (pRG646) | Symington lab | (Parental) |
| FM2450 | LSY4319-1C; cdc15-2:9myc::Hph | This work | 3A, B |
| FM2520 | FM2450; SCC1:3myc::HIS3MX | This work | 1B, E |
| FM2531 | FM2344; leu2-3::lexO4p:HO:FLAG:CYC1t::ACT1p:LexA-ER-B112-T:CYC1p::LEU2MX | This work | 3D–F; 4B–D |
| FM2635 | FM2450; SMC1:6HA:HIS3MX | This work | 1C, E |
| FM2662 | FM2531; Δrad9::KanMX4 | This work | 3-fs2 |
| FM2663 | FM2531; Δyku70::KanMX4 | This work | 3-fs2 |
| FM2668 | FM2531; Δmre11::KanMX4 | This work | 3-fs2 |
| FM2672 | FM2531; SMC3:AID*:9myc::KanMX | This work | 4A–D |
| FM2674 | FM2450; SMC3:3HA::HIS3MX | This work | 1D; 2C; 2-fs2; 2-fs3 |
| FM2680 | FM2672; ura3-52::ADH1p:OsTIR1:9myc::URA3 | This work | 4A–D; 3-fs3 |
| FM3235 | FM2520; SMC1:6HA::NatNT2 | This work | 2A, B; 2-fs1 |
| FM3294 | FM2531; ura3-52::ADH1p:OsTIR1:9myc::URA3 | This work | 4B–D |
-
*
Semicolons separate genetic modifications obtained through sequential transformation steps. Intermediate strains are omitted.
Appendix 1—key resources table
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM2450 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM2520 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2531 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM2635 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2662 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2663 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2668 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2672 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM2674 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2680 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM3235 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM3294 | This work | See Table 1 | |
| Chemical compound, drug | Nocodazole | Sigma-Aldrich | M1404 | |
| Chemical compound, drug | Auxin 3-indol-acetic acid (IAA) | Sigma-Aldrich | I2886 | |
| Chemical compound, drug | Phleomycin | Sigma-Aldrich | P9564 | |
| Chemical compound, drug | β-Estradiol | Sigma-Aldrich | E8875 | |
| Chemical compound, drug | Trichloroacetic acid | Sigma-Aldrich | T4885 | |
| Chemical compound, drug | Ponceau S solution | PanReac AppliChem | A2935 | |
| Chemical compound, drug | ECL chemiluminescence reagent | GE Healthcare | RPN2232 | |
| Chemical compound, drug | EDTA-free protease inhibitor cocktail | Roche | 5892791001 | |
| Chemical compound, drug | PMSF | Roche | 10837091001 | |
| Chemical compound, drug | RNase A | Roche | 10109169001 | |
| Chemical compound, drug | Proteinase K | Roche | 3115879001 | |
| Chemical compound, drug | β-Mercaptoethanol | Sigma-Aldrich | M3148 | |
| Chemical compound, drug | Laemmli buffer | Bio-Rad | 1610747 | |
| Chemical compound, drug | Formaldehyde | Sigma-Aldrich | 47608 | |
| Chemical compound, drug | Glycine | Promega | H5073 | |
| Chemical compound, drug | NP-40 | Sigma-Aldrich | I8896 | |
| Chemical compound, drug | Triton X-100 | Promega | H5141 | |
| Chemical compound, drug | StyI-HF | NEB | R3500S | |
| Chemical compound, drug | Lyticase | Sigma-Aldrich | L4025 | |
| Chemical compound, drug | Phenol:chloroform | PanReac AppliChem | A0944 | |
| Chemical compound, drug | Fluorescein-12-dUTP Solution | Thermo Scientific | R0101 | |
| Chemical compound, drug | CDP-star | Amersham | RPN3682 | |
| Chemical compound, drug | Sucrose | PanReac AppliChem | 571621.1611 | |
| Commercial assay, kit | High Pure PCR product purification kit | Roche | 11732676001 | |
| Commercial assay, kit | Expand High Fidelity PCR System | Roche | 11732641001 | |
| Commercial assay, kit | PowerUp SYBR Green Master Mix | Thermo Scientific | A25741 | |
| Other | Low EEOO LS Agarose | PanReac AppliChem | 374114.1209 | |
| Other | Positively charged nylon membrane (Hybond-N+) | Amersham GE | RPN303B | |
| Other | PVFD membranes | Pall Corporation | PVM020C099 | |
| Other | Pierce Anti-HA Magnetic Beads | Thermo Fisher Scientific | 88836 | |
| Other | Dynabeads Protein G | Invitrogen | 10003D | |
| Other | Qubit 4 Fluorometer | Thermo Fisher Scientific | Q33227 | |
| Other | Real-Time PCR instrument | Bio-Rad | CFX384 | |
| Antibody | Mouse monoclonal anti-HA | Sigma-Aldrich | H9658; RRID:AB_260092 | 1:1000 |
| Antibody | Mouse monoclonal anti-myc | Sigma-Aldrich | M4439; RRID:AB_439694 | 1:5000 |
| Antibody | Mouse monoclonal anti-Pgk1 | Thermo Fisher Scientific | 22C5D8; RRID:AB_2532235 | 1:5000 |
| Antibody | Mouse monoclonal anti-miniaid | MBL | M214-3; RRID:AB_2890014 | 1:500 |
| Antibody | Mouse monoclonal anti-Rad53 | Abcam | ab166859; RRID:AB_2801547 | 1:1000 |
| Antibody | Horseradish peroxidase polyclonal goat anti-mouse | Promega | W4021; RRID:AB_430834 | 1:5000 to 1:10,000 |
| Antibody | anti-HA antibody | Roche | 11666606001; RRID:AB_514506 | For ChIP–qPCR |
| Antibody | Anti-fluorescein antibody coupled to alkaline phosphatase | Roche | 11426338910; RRID:AB_514504 | |
| Software, algorithm | BioProfile Bio1D | Vilber-Lourmat | v15.07 | Vilber-Lourmat Fusion Solo S chamber |
| Software, algorithm | Prism | GraphPad | v9; RRID:SCR_002798 | |
| Recombinant DNA reagent (plasmid) | pNHK53 | Kanemaki lab | ADH1p-OsTIR-9Myc (URA) | |
| Recombinant DNA reagent (plasmid) | pRG464 | Symington lab | LexA-TF-PlexOp:HO::LEU2 | |
| Sequence-based reagent | SMC1-S2 | This work | GTCGAAGATCATAACTTTGGACTTGAGCAATTACGCAGAACGTACGCTGCAGGTCGAC | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SMC1-S3 | This work | TTATTTGACGGGTTATAGCAGAGGTTGGTTTCATAGATTAATCGATGAATTCGAGCTCG | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SMC3-S2 | This work | AATCGGATTCATTAGAGGTAGCAATAAATTCGCTGAAGTCCGTACGCTGCAGGTCGAC | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SMC3-S3 | This work | ACTGATATTTTTATATACAAATCGTTTCAAATATCTCTTAATCGATGAATTCGAGCTCG | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SCC1-S2 | This work | ATCAGCTTATTGGGTCCACCAAGAAATCCCCTCGGCGTAACTAGGTTTTAATCGATGAATTCGAGCTCG | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SCC1-S3 | This work | ATATTAAAATAGACGCCAAACCTGCACTATTTGAAAGGTTTATCAATGCTCGTACGCTGCAGGTCGAC | PCR-primer for C-terminal tagging |
| Sequence-based reagent | cdc15-F(–132) | This work | TCTTTCCGCTTTTCTTGCTG | PCR-primer for allele transfer |
| Sequence-based reagent | cdc15-R(+3023) | This work | TGCGTTTTCAGTATTGGAAGG | PCR-primer for allele transfer |
| Sequence-based reagent | Rad9-F(–326) | This work | GCAGCTCCCCATCAAAATAA | PCR-primer for allele transfer |
| Sequence-based reagent | Rad9-R(+4158) | This work | TCATTACAAGATGCAAGCCTAAA | PCR-primer for allele transfer |
| Sequence-based reagent | yku70-F(–361) | This work | TCCGTTTTGACAACAGGTCACTTCT | PCR-primer for allele transfer |
| Sequence-based reagent | Yku70+300 | This work | CCACAAAGTAATTGTCAGGAAGTGGAAACCCTTG | PCR-primer for allele transfer |
| Sequence-based reagent | Mre11-F(–282) | This work | TCATTGTAGGCATGCACGTT | PCR-primer for allele transfer |
| Sequence-based reagent | Mre11-R(+2258) | This work | ACAAAAGAGCAAAGGCTGGA | PCR-primer for allele transfer |
| Sequence-based reagent | HO-150-F | This work | TCGTGGCGGAGGTTGTTTAT | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-150-R | This work | ACAAAAGAGGCAAGTAGATAAGGGT | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-500-F | This work | GGACGGATGACAAATGCACC | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-500-R | This work | TGAAGCCGAAGGTAACTAGCA | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-1.5kb-F | This work | ACATTTTCAATCAAGCTGCGGA | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-1.5kb-R | This work | AATGTCCAAAATTGGTGAAGCA | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-3kb-F | This work | GCAAGTGCCCATGCTAACTC | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-3kb-R | This work | CCTACCGCACCTTCTAAGCA | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-10kb-F | This work | TCCTTCGCAACTTTCCTCCC | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-10kb-R | This work | GTGTGACCATGGACGAGGAG | PCR-primer for ChIP–qPCR |
Additional files
Download links
A two-part list of links to download the article, or parts of the article, in various formats.
Downloads (link to download the article as PDF)
Open citations (links to open the citations from this article in various online reference manager services)
Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)
Cohesin reconstitution and homologous recombination repair of DNA double-strand breaks in late mitosis
eLife 13:RP92706.
https://doi.org/10.7554/eLife.92706.3
