Cohesin reconstitution and homologous recombination repair of DNA double-strand breaks in late mitosis
eLife Assessment
This study provides convincing evidence that homologous recombination can occur in telophase-arrested cells, independently of cohesin subunits Smc 1-3. These findings are valuable as they point to investigate the role of cohesins re-association with chromatin in the allelic inter-sister repair by homologous recombination.
https://doi.org/10.7554/eLife.92706.3.sa0Valuable: Findings that have theoretical or practical implications for a subfield
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Convincing: Appropriate and validated methodology in line with current state-of-the-art
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
The cohesin complex maintains sister chromatid cohesion from S phase to anaphase onset. Cohesin also plays roles in chromosome structure and DNA repair. In yeast, the cohesin subunit Scc1 is cleaved at anaphase onset to allow segregation in an orderly manner, although some residual cohesin subunits remain to maintain chromosome structure. Efficient DNA double-strand break (DSB) repair by homologous recombination (HR) with the sister chromatid also depends on cohesin. Here, we have examined the role of residual cohesin in DSB repair in telophase (late mitosis). We have found that Scc1 returns in telophase after DSBs and that it partially reconstitutes a chromatin-bound cohesin complex with Smc1 and an acetylated pool of Smc3 after a single HO-induced DSB at the MAT locus. However, this new cohesin is neither required for the HR-driven MAT switching nor binds to the MAT locus after the DSB.
Introduction
Cell survival and genome integrity depend on the faithful segregation of chromosomes in anaphase. From the S phase until the anaphase onset, the highly conserved cohesin complex plays an essential role in the structural maintenance of sister chromatids. Cohesin is a multiprotein complex composed in yeast of Smc1, Smc3, Scc1 (also known as Mcd1), Scc3, and Pds5 subunits (Hirano, 2000; Michaelis et al., 1997; Sjögren and Nasmyth, 2001). At the core of the complex, Smc1, Smc3, and Scc1 form a heterotrimeric ring that embraces and holds the replicated sister chromatids together and well-aligned until reaching G2/M (Díaz-Martínez et al., 2008; Koshland and Guacci, 2000; Laloraya et al., 2000; Michaelis et al., 1997; Strunnikov et al., 1993). Cohesin subunits are loaded onto chromosomes in G1 by the Scc2–Scc3 complex (Ciosk et al., 2000). When cells enter S phase, the acetyl-transferase Eco1 acetylates Smc3, which inhibits the ATPase activity of Smc1–Smc3 heads and prevents the opening of the Smc3–Scc1 interface (Çamdere et al., 2015; Chan et al., 2012; Huber et al., 2016; Murayama and Uhlmann, 2015; Ström et al., 2007; Unal et al., 2007). This embraces the nascent sister chromatids and establishes cohesion (Uhlmann and Nasmyth, 1998). Once sister chromatids are ready for segregation, the APCCdc20 (Anaphase Promoting Complex associated with its regulatory cofactor Cdc20) initiates anaphase by degrading securin/Pds1, so that the separase/Esp1 becomes active. Separase then cleaves the Scc1 subunit by proteolysis, releasing sister chromatids from cohesion (Cohen-Fix et al., 1996; Michaelis et al., 1997; Nasmyth and Haering, 2009; Uhlmann et al., 1999; Yamamoto et al., 1996). The fragmented Scc1 is then rapidly degraded (Rao et al., 2001), while a pool of Smc1–Smc3 dimers appears to remain through anaphase (Renshaw et al., 2010; Tanaka et al., 1999). This pool, however, becomes loose as Smc3 is deacetylated by Hos1 in anaphase (Chan et al., 2012; Huber et al., 2016; Murayama and Uhlmann, 2015). Interestingly, some cohesin-dependent cohesion remains at chromosome arms during anaphase, suggesting that residual cohesin is present despite separase activation (Djeghloul et al., 2020; Garcia-Luis et al., 2022; Renshaw et al., 2010).
In addition to its role in sister chromatid cohesion, cohesin has also been involved in chromosome structure and DNA repair. On the one hand, cohesin can hold two DNA segments within the same chromatin forming an extruded loop (Lazar-Stefanita et al., 2017; Rao et al., 2017; Schalbetter et al., 2017). On the other hand, DNA double-strand breaks (DSBs) produce the so-called damage-induced cohesion (DI-cohesion) (Kim et al., 2010). Following DNA damage, cohesin is recruited and accumulated both along 50–100 kb surrounding the DSB site and genome-wide (Ström et al., 2004; Unal et al., 2004). The cohesin recruitment creates a firm anchoring of two well-aligned sister chromatids, which in turn facilitates DSB repair by homologous recombination (HR) (Covo et al., 2010; Hou et al., 2022; Phipps and Dubrana, 2022). In this regard, DNA damage kinases such as Mec1 and Chk1 phosphorylate Scc1 to initiate the cohesion establishment in post-replicative cells (Heidinger-Pauli et al., 2008).
HR is a DSB repair mechanism that uses a homologous template for restoring the original broken DNA. HR is highly reliable when the correct template is used, which in mitotic cells is the sister chromatid. Hence, HR is the preferred repair mechanism from S to G2/M, when the sister chromatid is available in close proximity (Langerak and Russell, 2011; Mathiasen and Lisby, 2014; Symington et al., 2014). Before DNA replication, in G1, the alternative error-prone non-homologous end joining (NHEJ) is used instead. Cells coordinate the choice of either NHEJ or HR based on the activity of cyclin-dependent kinase (CDK). Low CDK keeps cells in G1 and favors NHEJ, whereas high CDK is present in S and G2/M and activates HR. Noticeably, there is a paradox in this link between high CDK and HR. In the cell cycle window that spans from anaphase to the telophase-to-G1 transition (we will refer to this window as late mitosis), high CDK is set to favor HR despite a sister chromatid not being in proximity (Machín and Ayra-Plasencia, 2020). In a previous study, we showed that sister loci can indeed move closer and coalesce, and that HR still appears important for DSB survival in late mitosis (Ayra-Plasencia and Machín, 2019). Considering all these observations, we wondered whether the residual cohesin is affected by DSBs in late mitosis (telophase) and whether this cohesin pool is important for HR repair.
Results and discussion
Scc1 becomes stable after DSBs in late mitosis
At the anaphase onset, Esp1 cleaves Scc1, opening the cohesin ring and releasing sister chromatids from cohesion. Thereafter, Scc1 needs to be translated de novo since cleaved fragments are unstable and degraded by the proteasome (Rao et al., 2001). However, it is known that activation of Esp1 can be blocked by DDC kinases (Yam et al., 2020). In addition, DDC kinases also phosphorylate Scc1 to facilitate DI-cohesion at a post-replicative stage (Heidinger-Pauli et al., 2008). Thus, it is feasible that DSB generation in late mitosis can stabilize de novo Scc1 as well as rendering it cohesive. Noteworthy, Smc1 and Smc3 subunits remain attached to chromatin after segregation (Garcia-Luis et al., 2022; Renshaw et al., 2010; Tanaka et al., 1999).
To assess how cohesin subunits behave after DSBs in late mitosis, cdc15-2 strains that bear Scc1 tagged with myc epitopes and Smc1/3 tagged with HA epitopes were first blocked in telophase at 34°C for 3 hr (Tel) (Figure 1A). The cdc15-2 allele encodes a conditionally thermosensitive Cdc15 kinase, which drives telophase-to-G1 transition (Machín and Ayra-Plasencia, 2020). These strains also harbor an inducible HO endonuclease, which cuts the HO cutting site (HOcs) at the MAT locus in chromosome III. The HO gene is under the control of a promoter system that responds to β-estradiol (lexO4p:HO:plus LexA-ER-B112-T) (Gnügge and Symington, 2020; Ottoz et al., 2014). In wild-type strains, the HO DSB is repaired by HR with the intramolecular ectopic loci HMR and HML. The locus selection depends on the MAT allele (the MATa HO DSB repairs with HML) and results in a gene conversion (e.g., from MATa to MATα). In order to undoubtedly attribute the effects on cohesin to the DSB and not to downstream events of the repair process, we used a set of strains unable to repair the HO-mediated DSB (Δhml Δhmr double mutant). After the Tel arrest, the cultures were divided into three. The first subculture served as a mock control, the second was used to generate the single HO DSB (+HO), and the third was used to generate multiple random DSBs by means of the radiomimetic drug phleomycin (+phle). Noteworthy, these latter DSBs are repairable in principle. Incubation of the subcultures was prolonged at 34°C for 2 extra hours.
Scc1 returns after double-strand breaks (DSBs) in late mitosis.
(A) Schematic of the experimental procedure. Cells in logarithmic growth phase were first arrested in telophase (Tel) by incubating them at 34°C for 3 hr (strains bear the cdc15-2 allele). Then, the culture was divided into three subcultures. One served as a mock control, and the other two were treated to generate DSBs, one with β-estradiol (to express the HO endonuclease) and the other with phleomycin. The strain is unable to repair the HO DSB break by HR-driven gene conversion (Δhmr Δhml). (B) Western blot against Scc1-3myc. This experiment compares Scc1-3myc levels in an asynchronous, G2- and telophase-blocked cultures. The leftmost lane (No tag) is a control strain for Scc1 without the 3myc epitope tag. Pgk1 protein served as a housekeeping. Ponceau S staining is also shown as a loading control. Asyn.: asynchronous. Tel: telophase. +Phle: 10 mg·ml–1 phleomycin. +HO: 2 μM β-estradiol. *: Unspecific band detected by the α-myc antibody just over the Scc1-3myc signal. (C) Like in (B) but against Smc1-6HA. (D) Like in (C) but against Smc3-6HA. (E) Quantification of Scc1-3myc and Smc1-6HA levels in all conditions (mean ± SEM, n = 3). Statistical comparisons are shown for selected pairs (**p < 0.01; one-way ANOVA, Tukey’s post hoc).
-
Figure 1—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig1-data1-v1.zip
-
Figure 1—source data 2
Uncropped blots in Figure 1B.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig1-data2-v1.pdf
-
Figure 1—source data 3
Uncropped blots in Figure 1C, D.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig1-data3-v1.pdf
-
Figure 1—source data 4
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig1-data4-v1.xlsx
The presence or absence of Scc1-3myc, Smc1-6HA, and Smc3-6HA was checked by Western blot. As controls, we included asynchronous samples from the same strains, before the telophase arrest, as well as a parallel arrest at G2/M by the drug nocodazole (Nz). As expected, Smc1, Smc3, and Scc1 bands were detected in both cycling (asyn) cells and cells blocked in G2/M (Figure 1B–D). The Scc1 signal disappeared almost entirely when cells were arrested in telophase and remained low in the mock control 2 hr later. Strikingly, full-length Scc1 was restored after single and multiple DSBs generation (Figure 1B, E). Compared to the mock condition, phleomycin treatment increased Scc1 levels fivefold, reaching approximately half of the levels observed in G2/M. In the case of HO DSBs, Scc1 levels surpassed those of the mock by more than 15-fold and were even higher than in G2/M. In contrast, Smc1 and Smc3 levels remained more stable in both types of DSBs (Figure 1B–D).
The cohesin complex is reconstituted and binds to chromatin after the HO DSBs in telophase
The above findings suggest that the cohesin complex could be newly formed and loaded onto the breaks, promoting DI-cohesion, which could in turn ease the recombinational events. To assess whether cohesin subunits are reassembled after DSB induction in telophase, we performed a co-immunoprecipitation (co-IP) experiment using Smc1-6HA as the bait protein in a strain that also expresses Scc1-3myc (Figure 2A, Figure 2—figure supplement 1). In our experimental setup, in addition to the anti-HA and anti-myc antibodies, we included an antibody for the acetylated form of Smc3 at lysine residues K112 and K113 (acSmc3), which have been linked to the chromatin-bound pool of the Smc1–Smc3 dimer (Beckouët et al., 2010; Minamino et al., 2015; Rolef Ben-Shahar et al., 2008; Unal et al., 2008). In asynchronous cultures, both Scc1-3myc and acSmc3 co-immunoprecipitated with Smc1-6HA, indicating that we were able to pull down the chromatin-bound pool (acetylated Smc3) of the canonical Smc1–Smc3–Scc1 complex. A parallel co-IP using untagged Smc1 did not recover the other subunits, confirming the specificity of the interaction. As expected, Scc1 was not detected in the pull-down under the mock condition (no DSBs); however, it was recovered after generation of the HO DSB. Surprisingly, this was not the case when random DSBs were induced by phleomycin. Incidentally, acSmc3 appeared as two bands in the asynchronous culture but as a single upper band in all telophase conditions, suggesting a difference in posttranslational modifications at this cell cycle stage.
Scc1 forms a reconstituted chromatin-bound cohesin complex after the HO double-strand break (DSB) in late mitosis.
Cells were treated as in Figure 1A. (A) Co-immunoprecipitation (co-IP) of the core cohesin complex. Smc1-6HA was used as the bait protein; the leftmost lane includes a control with an untagged Smc1. (B) Chromatin fractionation of the strain expressing Smc1-6HA and Scc1-3myc. Relative protein levels (to the mock sample) are indicated under the blots. Pgk1 and histone H3 (HH3) were included as reporters of the cytosolic and chromatin-bound fractions, respectively. The asterisk (*) indicates an unspecific band in the whole cell extract (WCE) that is absent from the chromatin-bound fraction. (C) Cohesin does not bind the HO DSB in telophase. Chromatin immunoprecipitation (ChIP) of Smc3-6HA with (+HO) and without (−HO) HO induction (mean ± SEM, n = 3).
-
Figure 2—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-data1-v1.zip
-
Figure 2—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-data2-v1.pdf
-
Figure 2—source data 3
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig2-data3-v1.xlsx
The reconstitution of the complex and the detection of the acetylated form of Smc3 prompted us to confirm whether the newly formed Scc1 was bound to chromatin, since the coexistence of two pools could not be ruled out based on the co-IP experiments alone. For instance, a soluble Smc1–Smc3–Scc1 complex could coexist with a chromatin-bound Smc1–acSmc3 dimer, which could represent up to 30% of the total Smc1–Smc3 in anaphase (Beckouët et al., 2010). To this end, we performed biochemical fractionation of the chromatin-bound proteins, observing an increase in all cohesin subunits in the chromatin fraction after the HO DSB (Figure 2B, Figure 2—figure supplement 2). The increase was approximately twofold for Smc1–acSmc3 and up to sevenfold for Scc1. These results confirmed that the new Scc1 binds to a reconstituted chromatin-bound cohesin complex following the HO DSB. In contrast, this chromatin recruitment was not observed after phleomycin treatment. The differences in co-IP and fractionation due to the source and nature of the DSBs are intriguing. In this experimental setup, the HO DSB is irreparable, whereas DSBs caused by phleomycin can eventually be repaired by anaphase regression and sister loci coalescence (Ayra-Plasencia and Machín, 2019). In addition, the HO DSB leaves clean ends that can be easily resected, while the DSBs after phleomycin are chemically modified and require extended processing.
Next, we used chromatin immunoprecipitation (ChIP) to investigate whether the HO DSB recruits more cohesin to the vicinity of the HOcs. This recruitment has been reported during DSBs that exert a G2/M arrest by the DDC (Scherzer et al., 2022; Ström et al., 2004). Because the level of Scc1 changes so dramatically after the HO DSB, we selected one of the subunits that does not for the ChIP. An Smc3-HA strain unable to repair the HO DSB (Δhml Δhmr double mutant) was arrested in both G2/M and telophase. We confirmed an increase in the Smc3-bound pool around the HOcs in G2/M after the DSB (Figure 2—figure supplement 3); however, such an increase was not observed in telophase (Figure 2C). We thus conclude that the core of the cohesin SMCs (Smc1–Smc3) is not further recruited to the HO DSB in late mitosis. This lack of local recruitment could be due to several non-exclusive scenarios, including the inability to increase the acSmc3 pools by Eco1, whose levels drop after G2/M (Lyons and Morgan, 2011), as well as condensin binding to chromosome arms during anaphase (Leonard et al., 2015), which might act as an eviction barrier for cohesin loading. However, reassembly of the full cohesin complex at residual Smc1–acSmc3 dimers may shift the organization of the surrounding chromosome regions and impinge on the HO DSB repair in telophase.
The HO-mediated DSB is efficiently repaired by HR in late mitosis
In a previous report, we showed from both genetic and cytological points of view that HR was still active in late mitosis (Ayra-Plasencia and Machín, 2019). Having observed that cohesin is reconstituted and chromatin-bound after the HO DSB in telophase, we next wondered about the functional role of the complex in this context.
We first tested whether the HO-induced DSB is efficiently resected into 3′ ssDNA tails in late mitosis. Resection is necessary to form the protruding 3′ Rad51 nucleoprotein filaments that invade the donor homologous sequence to restore the break by HR (Peng et al., 2021; Symington, 2016). To confirm and quantitate the formation of ssDNA flanking the HOcs, we used a qPCR approach whereby primers can only amplify a target DNA cut with the restriction enzyme StyI if the target has been rendered single-stranded by resection (Figure 3—figure supplement 1; Gnügge et al., 2018; Zierhut and Diffley, 2008). We used the Δhml Δhmr double mutant to hamper the normal HR flow from resection to invasion and thus boost ssDNA detection. Two different locations downstream of the HOcs were monitored to determine both the initial resection (0.7 kb from HOcs) and the kinetics further away (5.7 kb). In addition, cells arrested in either G2/M or telophase were directly compared to each other. Cells were first arrested for 3 hr, the HO was induced afterwards, and samples were taken every hour during a 4 hr time course while sustaining the HO induction (Figure 3A). As expected, cells in G2/M efficiently resected the HOcs ends. The time to reach half of the maximum resection (t1/2) was ~1 hr at 0.7 kb and ~2.5 hr at 5.7 kb from the DSB, respectively. Resection in telophase was only slightly delayed at 0.7 kb (t1/2 ~ 1.5 hr), whereas the delay was more pronounced at 5.7 kb (t1/2 ~ 3.5 hr). The delay may be due to either the fact that CDK activity in late mitosis, though still high, is slightly inferior to that at G2/M or the different chromosome compaction degrees between the arrests. Together with the samples for the qPCR, samples for Western blot of Rad53 were taken. Rad53 is an effector kinase of the DDC that gets activated by hyperphosphorylation after being recruited to the 3′ ssDNA overhangs (Branzei and Foiani, 2006). In agreement with the resection profile, Rad53 hyperphosphorylation occurred in late mitosis, although with ~1 h delay (Figure 3B). This delay is also consistent with previous studies on Rad53 activation upon an unrepairable HO DSB (Pellicioli et al., 2001).
Homologous recombination (HR) repairs the HO double-strand break (DSB) in telophase.
(A, B) Resection in late mitosis is almost as efficient as in G2/M. Cells were arrested in G2/M or telophase (Tel), and then the HO DSB was generated by adding β-estradiol. Samples were taken at the indicated times to monitor the kinetics of resection. This strain is unable to repair the HO DSB break by HR-driven gene conversion (Δhmr Δhml). (A) Charts depicting the resection kinetics for two different amplicons located at 726 bp and 5.7 kb downstream the Hocs break (mean ± SEM, n = 3; fresected is the proportion of resected DNA). (B) Representative Western blots against Rad53 to follow the sensing of DNA damage detection in G2/M versus late mitosis. (C–F) Yeast cells use HR to repair the HO DSB in late mitosis. Cells were first blocked in telophase (Tel). Then, the HO DSB was generated by adding β-estradiol. After 1 hr, the β-estradiol was washed away, and samples were taken to monitor the repair for 3 hr. The strain can repair the HO DSB break by HR-driven gene conversion (Δhmr HML). (C) Schematic of the fragments obtained after a StyI digestion for both MATa and MATα sequences. The probe to detect the fragments by Southern blot is in blue. When the MATa locus is intact, the digestion gives rise to a 0.9 kb fragment. The HO cutting site (Hocs) is located within the StyI-digested MATa locus. Thus, the HO-driven DSB shortens the fragment to 0.7 kb. HR leads to a gene conversion to MATα, which results in the loss of a StyI restriction site and a new fragment of 1.8 kb. (D) Representative Western blot analyses for HO induction and subsequent degradation (tagged with Flag epitope) and the DSB sensing through Rad53 hyperphosphorylation. A Pgk1 Western blot served as a housekeeping, and Ponceau S staining of the membrane as a loading control for all lanes. The leftmost lane in the Ponceau S corresponds to the protein weight marker. (E) Representative Southern blot for the MAT switching assay in late mitosis. Alongside the MAT probe, a second probe against the ACT1 gene (1.1 kb fragment) was included for normalization. The MAT probe also recognizes an allele-independent MAT distal fragment (2.2 kb). (F) Quantification of relative band intensities in the MAT switching Southern blots (mean ± SEM, n = 3). Individual values were normalized to the ACT1 signals. Then, every lane was normalized to MATa at the arrest. Tel: telophase. +βE: β-estradiol addition.
-
Figure 3—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-data1-v1.zip
-
Figure 3—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-data2-v1.pdf
-
Figure 3—source data 3
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig3-data3-v1.xlsx
Once resection begins, cells are normally committed to recombine because long ssDNA fragments do not work as efficient substrates for NHEJ. In our haploid strain, HR at the MAT locus after the HO-driven DSB implies the gene conversion from the MATa to the MATα allele, whereas repair by NHEJ results in reconstitution of the MATa allele (Figure 3C; Yamaguchi and Haber, 2021). This gene conversion can be detected by Southern blot because of a restriction fragment length polymorphism for StyI. Cells that are in G1 can barely repair the HO DSB, whereas those in G2/M do so through HR (Ira et al., 2004). To check whether HR was efficient at the HO DSB in late mitosis, we performed an experimental setup similar to the one shown above, but with two important differences. On the one hand, the strain retains the HML locus, enabling HR if engaged, and on the other hand, the HO endonuclease was transiently induced by 1 h β-estradiol pulse, allowing time for the complete repair of the induced DSB. Samples were taken at the time of the arrest, after the pulse, and all through the repair window. We confirmed by Western blot that HO (HO tagged with the Flag epitope) is produced after the pulse and is rapidly degraded afterwards (Figure 3D, HO-Flag blot). Rad53 hyperphosphorylation followed the ~1 hr delay shown above and became prominent by the time the DSB inducer had been removed (Figure 3D, Rad53 blot), suggesting extensive resection even in this repairable setup. The Southern blot showed that (1) most MATa locus in the cell population has been efficiently cut after the HO pulse (Figure 3E, F; decrease of the MATa band intensity and rise of that of the cut HOcs); and (2) most DSBs are repaired afterwards exclusively through HR (Figure 3E, F; drop of the HO cut band intensity and rise of that of the MATα). No signs of DSB repair by NHEJ were observed (the remaining MATa band stays constant throughout). This was further confirmed by measuring the repair kinetics of a derivative strain deficient in NHEJ (yku70Δ; Figure 3—figure supplement 2A–C), and is consistent with our previous studies with a HR-deficient rad52Δ strain (Medina-Suárez et al., 2024). Interestingly, HR kinetics were not altered in cells unable to activate the DDC (rad9Δ; Figure 3—figure supplement 2D–F) or to tether the DSB ends (mre11Δ; Figure 3—figure supplement 2G–I). These results are also consistent with previous studies in G2/M cells, in which HR-driven repair of the HO DSB appeared more robust than other types of DSBs (Lazzaro et al., 2008; Moreau et al., 2001).
Overall, we concluded that HR is the chosen repair pathway in late mitosis. This is in agreement with predictions based on CDK activity and also fits well with the genetic and cytological data we have obtained before (Ayra-Plasencia and Machín, 2019; Machín and Ayra-Plasencia, 2020; Medina-Suárez et al., 2024). By contrast, this emphasizes the paradoxes of having HR in the context of mostly segregated sister chromatids and without the cohesin complex holding them together as expected. We have now explored the second paradox further as we have just shown that cohesin is reconstituted after DSBs in telophase, and DI-cohesion appears important for efficient DSB repair by HR (Hou et al., 2022; Phipps and Dubrana, 2022).
The MAT switching in late mitosis does not depend on cohesin
In cells arrested in cdc15-2, the Smc1–Smc3 pool mostly resides at centromeres where it brings together adjacent regions in both chromosome arms (Garcia-Luis et al., 2022). Of note, this configuration could favor the physical interaction in cis of the MAT and the HML loci (Piazza et al., 2021), which may in turn promote a rapid and efficient HR-driven MAT switching. Thus, we tested whether MAT switching was dependent on this residual centromeric cohesin. To this aim, we tagged the Smc3 subunit with the auxin-mediated degron system (aid*). To check that the system was working correctly, a serial dilution spot assay was carried out (Figure 4A). The strain expressing Smc3-aid* was plated on YPDA and YPDA plus 8 mM of the auxin indole-acetic acid (IAA). Alongside, we also plated a derivative strain where we had removed the preceptive F-box protein OsTIR1, which forms the functional ubiquitin ligase responsible for targeting the aid* for degradation upon IAA addition (Morawska and Ulrich, 2013). Since cohesin is an essential complex for vegetative growth, the lack of growth in the SMC3-AID* OsTIR1 strain strongly points out that Smc3-aid* is degraded efficiently.
Cohesin removal does not alter homologous recombination (HR) at the MAT locus in late mitosis.
(A) Serial dilution spot assay for the smc3:aid* strains. The fitness effect of Smc3-aid* degradation was tested in the smc3:aid* OsTIR1 strain in the presence of 8 mM IAA. The same strain without the ubiquitin-ligase OsTIR1 was also used as the control. (B–D) Cells of four strains with all possible combinations of the smc3:aid* and OsTIR1 pairs were treated as in Figure 1A but including a 1-hr IAA step between the cdc15-2 arrest and the induction of HO. Then, HO was induced for 1 hr with β-estradiol (1h+βE sample), after which it was washed off and the cells were allowed to recover from the double-strand break (DSB) for 2 hr (3h-βE sample). IAA and the Tel arrest were maintained throughout the experiment. (B) Representative Western blot of the four strains at the time of the arrest (Tel) and 1 hr after IAA addition (+IAA). Note the confirmation of the different genotypic combinations, as well as the Smc3-aid* decline after IAA addition. (C) Representative Southern blot for the MAT switching assay of the four strains in the presence of 8 mM IAA. Note that HO cutting is less efficient than without IAA (see Figure 3E, Figure 4—figure supplement 1B, C) but gene conversion is still possible after degrading Smc3-aid* in late mitosis. (D) Quantification of relative MAT switching (mean ± SEM, n = 3). Gene conversion to MATα in the 3h-βE sample was normalized to the cut HOcs in the 1h+βE sample. Then, gene conversion yield was normalized to the wild-type (no tagged Smc3, no OsTir1) strain. Tel: telophase. +βE: β-estradiol addition. −βE: β-estradiol removal. +IAA: indole-acetic acid. (E) Model of how DSBs reconstitute cohesin in late mitosis. The cohesin complex (Smc1–Smc3–Scc1) entraps sister chromatids before anaphase. (1) At anaphase onset, Esp1 (separase) is activated to cleave Scc1 and release sister chromatids for segregation. (2) If DSBs occur before cytokinesis, Scc1 returns and reconstitutes the cohesin complex. At least a fraction of the complex binds to chromatin. The reappearance of Scc1 likely occurs through the inhibition of Esp1 and/or post-translational protection of Scc1 by the DNA damage checkpoint.
-
Figure 4—source data 1
Original blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-data1-v1.zip
-
Figure 4—source data 2
Uncropped blots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-data2-v1.pdf
-
Figure 4—source data 3
Values for plots.
- https://cdn.elifesciences.org/articles/92706/elife-92706-fig4-data3-v1.xlsx
Next, we used this strain to degrade Smc3 after cells have been arrested in late mitosis and before the HO DSB. After IAA addition, there was a clear decline in Smc3-aid* levels, including the chromatin-bound acSmc3-aid* pool (Figure 4—figure supplement 1A). After Smc3 depletion, a 1-hr pulse of HO expression was applied, which allowed us to follow both DSB generation and its subsequent repair without residual cohesin. More than 90% of the Smc3-aid* had disappeared by the time the HO promoter was shut down (Figure 4—figure supplement 1A). The addition of IAA drastically delayed gene conversion from MATa to MATα (Figure 4—figure supplement 1B,C), although the cut efficiency was lower than in the wild type in the absence of auxin (~50% MATa remained uncut in the SMC3:aid* OsTIR1 strain). Also, the detection of DNA damage through Rad53 phosphorylation seems fainter and slightly delayed (Figure 4—figure supplement 1). To unequivocally determine whether MAT switching kinetics were affected by Smc3 depletion, and not by an off-target effect of IAA, we compared strains that could either degrade or retain Smc3 in the presence of IAA. Four isogenic strains were analyzed, comprising all possible combinations of Smc3-aid* and OsTir1, as confirmed by Western blot (Figure 4B; Tel samples). The addition of IAA-induced Smc3-aid* degradation only in the strain co-expressing OsTIR1 (Figure 4B; +IAA samples). In the wild-type strain (no tagged Smc3 and no OsTIR1), the cutting efficiency of HOcs and the yield of gene conversion to MATα were both reduced in the presence of IAA, confirming that IAA itself negatively impacts MAT switching (Figure 4C, compared two leftmost lanes with Figure 3E). However, when the yield of the MAT conversion after the recovery time was normalized to the cut HOcs when HO was repressed, no significant differences were observed among the four strains (Figure 4C, D). We therefore conclude that the core of the cohesin complex is not required for the HR-driven repair of the HO DSB in telophase. Of note, it was previously reported that cohesin was not required for the MAT switching in G2/M-arrested cells, despite it being essential for efficient post-replicative DSB repair (Unal et al., 2004).
Conclusions and perspectives
In this work, we have addressed whether HR was molecularly efficient in yeast cells arrested in late mitosis. We have used the well-established MAT switching system and found that HR is indeed working in late mitosis, complementing previous results that pointed in this direction both genetically and cytologically (Ayra-Plasencia and Machín, 2019). In addition, we have addressed the paradox of having HR in a cell mitotic stage with no sister chromatid cohesion. Our results suggest that residual cohesin, or at least residual chromatin-bound Smc1–Smc3 dimers, are complemented by incorporating de novo Scc1 (Figure 4E). This fact suggests that chromosome structure may undergo significant changes after late DSBs. The nature of these changes remains unexplored, and we cannot currently rule out that some kind of DI-cohesion could be established, perhaps globally. Alternatively, telophase chromatin may acquire new intramolecular loops as it occurs in G2/M-arrested cells (Piazza et al., 2021). Either of these may favor repair by HR with the intact sister or intramolecularly, although it seems still dispensable for MAT switching at this late cell cycle stage. Further research will be needed to confirm these hypotheses, as well as the whereabouts of cohesin and the consequences for late segregation after DSB repair.
Materials and methods
Strains and experimental conditions
Request a detailed protocolTable 1 contains the S. cerevisiae strains used in this work. Genetic backgrounds are either W303 or YPH499. Strain construction was performed by lithium acetate-based transformation on pre-made frozen competent cells (Knop et al., 1999).
Strains used in this work.
| Strain | Relevant genotype* | Origin | Figure |
|---|---|---|---|
| FM2344 | (YPH499) MATa ura3-52 lys2-801 ade2-101 trp1-Δ63 his3-Δ200 leu2-Δ1 bar1-Δ; cdc15-2:9myc::Hph; HMLα ∆hmr::HIS3MX | Machín lab | (Parental) |
| LSY4319-1C | (W303) MATα leu2-3,112 trp1-1 can1-100 ura3-1 ade2-1 his3-11,15 RAD5 ∆hml ∆hmr; leu2-3::lexO4p:HO:FLAG:CYC1t::ACT1p:LexA-ER-B112-T:CYC1p::LEU2MX (pRG646) | Symington lab | (Parental) |
| FM2450 | LSY4319-1C; cdc15-2:9myc::Hph | This work | 3A, B |
| FM2520 | FM2450; SCC1:3myc::HIS3MX | This work | 1B, E |
| FM2531 | FM2344; leu2-3::lexO4p:HO:FLAG:CYC1t::ACT1p:LexA-ER-B112-T:CYC1p::LEU2MX | This work | 3D–F; 4B–D |
| FM2635 | FM2450; SMC1:6HA:HIS3MX | This work | 1C, E |
| FM2662 | FM2531; Δrad9::KanMX4 | This work | 3-fs2 |
| FM2663 | FM2531; Δyku70::KanMX4 | This work | 3-fs2 |
| FM2668 | FM2531; Δmre11::KanMX4 | This work | 3-fs2 |
| FM2672 | FM2531; SMC3:AID*:9myc::KanMX | This work | 4A–D |
| FM2674 | FM2450; SMC3:3HA::HIS3MX | This work | 1D; 2C; 2-fs2; 2-fs3 |
| FM2680 | FM2672; ura3-52::ADH1p:OsTIR1:9myc::URA3 | This work | 4A–D; 3-fs3 |
| FM3235 | FM2520; SMC1:6HA::NatNT2 | This work | 2A, B; 2-fs1 |
| FM3294 | FM2531; ura3-52::ADH1p:OsTIR1:9myc::URA3 | This work | 4B–D |
-
*
Semicolons separate genetic modifications obtained through sequential transformation steps. Intermediate strains are omitted.
Strains were cultured overnight in the YPD medium (10 g·l−1 yeast extract, 20 g·l−1 peptone, and 20 g·l−1 glucose) with moderate shaking (180 rpm). The day after, 10–100 μl of grown cells were diluted into a flask containing an appropriate YPD volume and grown overnight at 25°C again. Finally, the exponentially growing culture was adjusted to OD600 = 0.5 to start the experiment.
In general, cells were first arrested in late mitosis by incubating the culture at 34°C for 3 hr (all strains carry the cdc15-2 thermosensitive allele). Then, the culture was split in two, one subculture remained untreated (mock), and DSBs were generated in the second one. When a G2/M arrest was required, 15 µg·ml−1 nocodazole (Nz; Sigma-Aldrich, M1404) was added to the asynchronous culture, which was then incubated at 25°C for 3 hr (with a 7.5 µg·ml−1 Nz shot at 2 hr). To conditionally degrade the Smc3-aid* variant, 8 mM of the auxin 3-indol-acetic acid (IAA; Sigma-Aldrich, I2886) was added to the arrested cells 1 hr prior to generating DSBs.
DSB generation was accomplished by incubating the culture for 1–3 hr with either 10 µg·ml−1 phleomycin (random DSBs) or 2 μM of β-estradiol (HO-driven DSBs). For the HOcs DSB, the corresponding strain harbors an integrative system based on a β-estradiol inducible promoter (Ottoz et al., 2014). These strains were constructed by transforming with the pRG464 plasmid.
Western blot for protein levels and phosphorylation
Request a detailed protocolWestern blotting was performed as reported before (Ayra-Plasencia and Machín, 2019). The trichloroacetic acid method was used for protein extraction. Total protein was quantified in a Qubit 4 Fluorometer (Thermo Fisher Scientific, Q33227). Proteins were resolved in 7.5% SDS–PAGE gels and transferred to PVDF membranes (Pall Corporation, PVM020C099). The membrane was stained with Ponceau S solution (PanReac AppliChem, A2935) as a loading reference. The following primary antibodies were used for immunoblotting: mouse monoclonal α-HA (1:1000; Sigma-Aldrich, H9658), mouse monoclonal α-myc (1: 5000; Sigma-Aldrich, M4439), mouse monoclonal α-Pgk1 (1:5000; Thermo Fisher Scientific, 22C5D8), mouse monoclonal α-miniaid (1:500; MBL, M214-3), mouse monoclonal α-Flag (1:5000; Sigma-Aldrich, F3165), mouse monoclonal α-Rad53 (1:1000; Abcam, ab166859), and mouse monoclonal α-acSmc3 (1:5000; a gift from Katsuhiko Shirahige). The secondary antibody was a horseradish peroxidase polyclonal goat anti-mouse (from 1:5000 to 1:10,000, depending on the primary antibody; Promega, W4021). Proteins were detected with the ECL chemiluminescence reagent (GE Healthcare, RPN2232), and visualized in a Vilber-Lourmat Fusion Solo S chamber.
Co-IP for the reassembly of the cohesin complex
Request a detailed protocolFor co-IP assays, approximately 100 OD₆₀₀ units from the corresponding conditions were collected. Cell disruption was performed by resuspending the frozen pellets in 200 μl of Buffer A (50 mM HEPES-Na, 150 mM KCl, 1.5 mM MgCl₂, 0.5 mM DTT, 0.5% Triton X-100, 1× EDTA-free protease inhibitor cocktail) together with glass beads. Samples were vortexed vigorously for 5 min, and additional lysis cycles were performed as needed, allowing 1 min incubation on ice between rounds. Lysates were transferred to a clean tube. 400 μl of Buffer A was used to wash the beads and pooled with the lysates. Samples were then centrifuged (12,000 rpm, 5 min, 4°C), and the clarified lysates were transferred to new tubes. An aliquot of 70 μl was saved as whole cell extract for Western blot analysis. The remaining lysate was incubated with pre-equilibrated Pierce Anti-HA Magnetic Beads (Thermo Fisher Scientific; 88836) for 2 hr at 4°C on a rotating wheel. After incubation, beads were placed on a magnetic rack and washed five times with 200 μl of IPP150 buffer (10 mM Tris-Cl pH 7.5, 150 mM NaCl, 0.5% Triton X-100).
For elution, beads were resuspended in 25 μl of 1× SR buffer (8% SDS, 0.5 M Tris-Cl pH 6.8) and incubated at 37°C for 4 min. The supernatant was collected using a magnetic rack and transferred to a new tube containing 8.3 μl of 4× SS buffer (20% sucrose, 0.05% bromophenol blue, 0.1% sodium azide) supplemented with β-mercaptoethanol. Samples were boiled for 2 min at 95°C, centrifuged (max speed, 30 s), and analyzed by SDS–PAGE and Western blotting.
Chromatin fractionation for the chromatin-bound cohesin
Request a detailed protocolBiochemical fractionation of cells was performed as described before with little modifications (Cuevas-Bermúdez et al., 2020). Briefly, cells were collected and resuspended in 400 µl of buffer 1 (20 mM HEPES pH 8, 60 mM KCl, 15 mM NaCl, 10 mM MgCl2, 1 mM CaCl2, 0.8% Triton X-100, 1.25 M sucrose, 0.5 mM spermine). Breakage of cell walls was done by adding ~200 mg of glass beads and vortexing for 4 min. After centrifuging at 500 × g for 5 min, supernatant was transferred to a new tube and 40 µl were kept as Input. Samples were centrifuged at 18,000 × g for 20 min, the supernatant was kept as S1, whereas the pellet was resuspended in 200 µl of Buffer 1 (50 µl were saved as P1). Samples were centrifuged again at 18,000 × g for 20 min, the supernatant was kept as S2, and the pellet was resuspended in 200 µl of buffer 2 (20 mM HEPES pH 7.6, 45 mM NaCl, 7.5 mM MgCl2, 20 mM EDTA pH 8, 10% glycerol, 1% NP-40, 2 M urea, 0.5 M sucrose, protease inhibitors) and 50 µl were saved as P2. Finally, samples were centrifuged one last time at the same conditions, keeping the supernatant as S3, and the pellet was resuspended in 50 µl of Laemmli buffer, constituting the chromatin-enriched fraction (P3).
ChIP–qPCR for the cohesin loading onto the HO DSB
Request a detailed protocolFor ChIP–qPCR, a total of 100 OD600 units of the treated cultures were collected and crosslinked with 1.4% formaldehyde for 15 min. Crosslinking was quenched with glycine (final concentration 125 mM) for 7 min. Cells were harvested by centrifugation (4000 rpm, 1 min), washed with PBS, transferred to screw-cap tubes, and frozen at –80°C.
Frozen pellets were resuspended in 300 μl of IP buffer (150 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM EDTA, 1% Triton X-100, 0.05% NP-40) supplemented with 1 mM PMSF and protease inhibitor cocktail (EDTA-free, Roche). Disruption was performed by bead beating with 500 μl of glass beads using a Bertin Precellys homogenizer for nine 20 s cycles at hard setting. Lysates were transferred to new tubes and supplemented with an additional 100 μl of IP buffer containing PMSF and protease inhibitors. Samples were clarified by centrifugation (15,000 rpm, 10 min, 4°C). Pellets were resuspended in 1 ml IP buffer with PMSF and protease inhibitors and sonicated in a Diagenode Bioruptor Plus (30 cycles: 30 s ON 30 s OFF, high power, 4°C). After sonication, samples were centrifuged (15,000 rpm, 10 min), and the supernatant was collected. A 200-μl aliquot was reserved as input. Input DNA was precipitated with 0.3 M sodium acetate and 2.5 volumes of cold ethanol, centrifuged (15,000 rpm, 30 min), washed with 70% ethanol, and air-dried.
For immunoprecipitation, 400 μl of the sonicated chromatin was incubated with 40 μg of anti-HA antibody (Roche, 11666606001) in the Bioruptor at low power for 30 min (30 s ON/30 s OFF cycles). Antibody–chromatin complexes were pelleted (13,000 rpm, 5 min), and the supernatant was incubated with 60 μl of Dynabeads Protein G (Invitrogen), pre-equilibrated in IP buffer, then incubated for 2 hr at 4°C on a rotating wheel, and finally washed five times with IP buffer using a magnetic rack.
Both input and IP samples were resuspended in de-crosslinking buffer (1× TE, 1% SDS, 10 μg·ml–1 RNase A, 1 mg·ml–1 proteinase K) and incubated overnight at 65°C and purified using High Pure PCR product purification kit (Roche) for the qPCR.
qPCR for DSB resection
Request a detailed protocolIn the resection experiments, qPCR was performed on genomic DNA (gDNA) extracted by the glass beads/phenol method (Hoffman and Winston, 1987). Experimental details on the resection assay can be found in Gnügge et al., 2018. Briefly, each gDNA sample was divided into two, and one aliquot was digested with StyI-HF (NEB, R3500S). Then, qPCR reactions were mounted using the PowerUp SYBR Green Master Mix (Thermo Scientific, A25741) and run in a Bio-Rad CFX384 Real-Time PCR instrument (10 µl final volume in 384-well block plates).
Resection was calculated as a normalized fraction (fresected) to that of the HOcs effectively cut by HO (f). These two parameters were calculated by their corresponding formulas (Gnügge et al., 2018).
Southern blot for the MAT switching assay
Request a detailed protocolIn this case, gDNA was extracted by digesting with 50 U lyticase (Sigma-Aldrich, L4025) a cell pellet previously resuspended in 200 µl of digestion buffer (1% SDS, 100 mM NaCl, 50 mM Tris-HCl, and 10 mM EDTA). Then, the gDNA was phase separated by phenol:chloroform (PanReac AppliChem, A0944), precipitated with ethanol, resuspended in TE 1X with 10 μg·ml–1 RNase A, precipitated again, and resuspended in TE 1X. Then, the gDNA was digested with StyI, the restriction fragments separated on a 1.2% low EEOO LS Agarose gel, and finally Southern blotted. Southern blot was carried out by a saline downwards transference onto a positively charged nylon membrane (Hybond-N+, Amersham-GE; RPN303B) (García-Luis and Machín, 2014). DNA probes against ACT1 and MAT loci were made using Fluorescein-12-dUTP Solution (ThermoFisher; R0101) and the Expand High Fidelity PCR System (Roche; 11732641001). Hybridization with fluorescein-labeled probes was performed overnight at 68°C. The following day, the membrane was incubated with an anti-fluorescein antibody coupled to alkaline phosphatase (Roche; 11426338910), and the chemiluminescent signal detected using CDP-star (Amersham; RPN3682). Blots were visualized in a Vilber-Lourmat Fusion Solo S chamber.
For band quantification, each individual band was normalized to the ACT1 signal in the lane. Then, a second normalization to the MATa band at the arrest was performed. To determine the yield of gene conversion to MATα specifically, the MATα band after recovery from the DSB (2–3 hr after β-estradiol removal) was normalized to the amount of the cut HOcs band immediately before recovery (1 hr after β-estradiol addition).
Data representation and statistics
Request a detailed protocolThree types of graphs were used to represent the data: bar charts, marker line graphs, and box plots. In box plots, the center line represents the medians, box limits represent the 25th and 75th percentiles, the whiskers extend to the 5th and 95th percentiles, and the dots represent outliers. Error bars in all bar and line charts represent the SEM of three independent biological replicates. Individual values are also represented as dots in the bar charts. GraphPad Prism 9 was used for generating the charts and for statistical analysis. Differences between experimental data points were generally estimated using the Mann–Whitney U test for box plots and one-way ANOVA with Tukey post hoc for bar charts.
Appendix 1
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM2450 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM2520 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2531 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM2635 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2662 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2663 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2668 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2672 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM2674 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM2680 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, W303) | FM3235 | This work | See Table 1 | |
| Strain, strain background (Saccharomyces cerevisiae, YPH499) | FM3294 | This work | See Table 1 | |
| Chemical compound, drug | Nocodazole | Sigma-Aldrich | M1404 | |
| Chemical compound, drug | Auxin 3-indol-acetic acid (IAA) | Sigma-Aldrich | I2886 | |
| Chemical compound, drug | Phleomycin | Sigma-Aldrich | P9564 | |
| Chemical compound, drug | β-Estradiol | Sigma-Aldrich | E8875 | |
| Chemical compound, drug | Trichloroacetic acid | Sigma-Aldrich | T4885 | |
| Chemical compound, drug | Ponceau S solution | PanReac AppliChem | A2935 | |
| Chemical compound, drug | ECL chemiluminescence reagent | GE Healthcare | RPN2232 | |
| Chemical compound, drug | EDTA-free protease inhibitor cocktail | Roche | 5892791001 | |
| Chemical compound, drug | PMSF | Roche | 10837091001 | |
| Chemical compound, drug | RNase A | Roche | 10109169001 | |
| Chemical compound, drug | Proteinase K | Roche | 3115879001 | |
| Chemical compound, drug | β-Mercaptoethanol | Sigma-Aldrich | M3148 | |
| Chemical compound, drug | Laemmli buffer | Bio-Rad | 1610747 | |
| Chemical compound, drug | Formaldehyde | Sigma-Aldrich | 47608 | |
| Chemical compound, drug | Glycine | Promega | H5073 | |
| Chemical compound, drug | NP-40 | Sigma-Aldrich | I8896 | |
| Chemical compound, drug | Triton X-100 | Promega | H5141 | |
| Chemical compound, drug | StyI-HF | NEB | R3500S | |
| Chemical compound, drug | Lyticase | Sigma-Aldrich | L4025 | |
| Chemical compound, drug | Phenol:chloroform | PanReac AppliChem | A0944 | |
| Chemical compound, drug | Fluorescein-12-dUTP Solution | Thermo Scientific | R0101 | |
| Chemical compound, drug | CDP-star | Amersham | RPN3682 | |
| Chemical compound, drug | Sucrose | PanReac AppliChem | 571621.1611 | |
| Commercial assay, kit | High Pure PCR product purification kit | Roche | 11732676001 | |
| Commercial assay, kit | Expand High Fidelity PCR System | Roche | 11732641001 | |
| Commercial assay, kit | PowerUp SYBR Green Master Mix | Thermo Scientific | A25741 | |
| Other | Low EEOO LS Agarose | PanReac AppliChem | 374114.1209 | |
| Other | Positively charged nylon membrane (Hybond-N+) | Amersham GE | RPN303B | |
| Other | PVFD membranes | Pall Corporation | PVM020C099 | |
| Other | Pierce Anti-HA Magnetic Beads | Thermo Fisher Scientific | 88836 | |
| Other | Dynabeads Protein G | Invitrogen | 10003D | |
| Other | Qubit 4 Fluorometer | Thermo Fisher Scientific | Q33227 | |
| Other | Real-Time PCR instrument | Bio-Rad | CFX384 | |
| Antibody | Mouse monoclonal anti-HA | Sigma-Aldrich | H9658; RRID:AB_260092 | 1:1000 |
| Antibody | Mouse monoclonal anti-myc | Sigma-Aldrich | M4439; RRID:AB_439694 | 1:5000 |
| Antibody | Mouse monoclonal anti-Pgk1 | Thermo Fisher Scientific | 22C5D8; RRID:AB_2532235 | 1:5000 |
| Antibody | Mouse monoclonal anti-miniaid | MBL | M214-3; RRID:AB_2890014 | 1:500 |
| Antibody | Mouse monoclonal anti-Rad53 | Abcam | ab166859; RRID:AB_2801547 | 1:1000 |
| Antibody | Horseradish peroxidase polyclonal goat anti-mouse | Promega | W4021; RRID:AB_430834 | 1:5000 to 1:10,000 |
| Antibody | anti-HA antibody | Roche | 11666606001; RRID:AB_514506 | For ChIP–qPCR |
| Antibody | Anti-fluorescein antibody coupled to alkaline phosphatase | Roche | 11426338910; RRID:AB_514504 | |
| Software, algorithm | BioProfile Bio1D | Vilber-Lourmat | v15.07 | Vilber-Lourmat Fusion Solo S chamber |
| Software, algorithm | Prism | GraphPad | v9; RRID:SCR_002798 | |
| Recombinant DNA reagent (plasmid) | pNHK53 | Kanemaki lab | ADH1p-OsTIR-9Myc (URA) | |
| Recombinant DNA reagent (plasmid) | pRG464 | Symington lab | LexA-TF-PlexOp:HO::LEU2 | |
| Sequence-based reagent | SMC1-S2 | This work | GTCGAAGATCATAACTTTGGACTTGAGCAATTACGCAGAACGTACGCTGCAGGTCGAC | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SMC1-S3 | This work | TTATTTGACGGGTTATAGCAGAGGTTGGTTTCATAGATTAATCGATGAATTCGAGCTCG | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SMC3-S2 | This work | AATCGGATTCATTAGAGGTAGCAATAAATTCGCTGAAGTCCGTACGCTGCAGGTCGAC | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SMC3-S3 | This work | ACTGATATTTTTATATACAAATCGTTTCAAATATCTCTTAATCGATGAATTCGAGCTCG | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SCC1-S2 | This work | ATCAGCTTATTGGGTCCACCAAGAAATCCCCTCGGCGTAACTAGGTTTTAATCGATGAATTCGAGCTCG | PCR-primer for C-terminal tagging |
| Sequence-based reagent | SCC1-S3 | This work | ATATTAAAATAGACGCCAAACCTGCACTATTTGAAAGGTTTATCAATGCTCGTACGCTGCAGGTCGAC | PCR-primer for C-terminal tagging |
| Sequence-based reagent | cdc15-F(–132) | This work | TCTTTCCGCTTTTCTTGCTG | PCR-primer for allele transfer |
| Sequence-based reagent | cdc15-R(+3023) | This work | TGCGTTTTCAGTATTGGAAGG | PCR-primer for allele transfer |
| Sequence-based reagent | Rad9-F(–326) | This work | GCAGCTCCCCATCAAAATAA | PCR-primer for allele transfer |
| Sequence-based reagent | Rad9-R(+4158) | This work | TCATTACAAGATGCAAGCCTAAA | PCR-primer for allele transfer |
| Sequence-based reagent | yku70-F(–361) | This work | TCCGTTTTGACAACAGGTCACTTCT | PCR-primer for allele transfer |
| Sequence-based reagent | Yku70+300 | This work | CCACAAAGTAATTGTCAGGAAGTGGAAACCCTTG | PCR-primer for allele transfer |
| Sequence-based reagent | Mre11-F(–282) | This work | TCATTGTAGGCATGCACGTT | PCR-primer for allele transfer |
| Sequence-based reagent | Mre11-R(+2258) | This work | ACAAAAGAGCAAAGGCTGGA | PCR-primer for allele transfer |
| Sequence-based reagent | HO-150-F | This work | TCGTGGCGGAGGTTGTTTAT | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-150-R | This work | ACAAAAGAGGCAAGTAGATAAGGGT | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-500-F | This work | GGACGGATGACAAATGCACC | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-500-R | This work | TGAAGCCGAAGGTAACTAGCA | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-1.5kb-F | This work | ACATTTTCAATCAAGCTGCGGA | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-1.5kb-R | This work | AATGTCCAAAATTGGTGAAGCA | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-3kb-F | This work | GCAAGTGCCCATGCTAACTC | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-3kb-R | This work | CCTACCGCACCTTCTAAGCA | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-10kb-F | This work | TCCTTCGCAACTTTCCTCCC | PCR-primer for ChIP–qPCR |
| Sequence-based reagent | HO-10kb-R | This work | GTGTGACCATGGACGAGGAG | PCR-primer for ChIP–qPCR |
Data availability
All data generated or analyzed during this study are included in the manuscript and supporting files; source data files have been provided for all figures.
References
-
The Rad53 signal transduction pathway: Replication fork stabilization, DNA repair, and adaptationExperimental Cell Research 312:2654–2659.https://doi.org/10.1016/j.yexcr.2006.06.012
-
Chromosome cohesion – rings, knots, orcs and fellowshipJournal of Cell Science 121:2107–2114.https://doi.org/10.1242/jcs.029132
-
Processing of DNA double-strand breaks in yeastMethods in Enzymology 600:1–24.https://doi.org/10.1016/bs.mie.2017.11.007
-
Chromosome cohesion, condensation, and separationAnnual Review of Biochemistry 69:115–144.https://doi.org/10.1146/annurev.biochem.69.1.115
-
Cohesin in DNA damage response and double-strand break repairCritical Reviews in Biochemistry and Molecular Biology 57:333–350.https://doi.org/10.1080/10409238.2022.2027336
-
Genome-wide reinforcement of cohesin binding at pre-existing cohesin sites in response to ionizing radiation in human cellsThe Journal of Biological Chemistry 285:22784–22792.https://doi.org/10.1074/jbc.M110.134577
-
Sister chromatid cohesion: the beginning of a long and beautiful relationshipCurrent Opinion in Cell Biology 12:297–301.https://doi.org/10.1016/s0955-0674(00)00092-2
-
Chromosomal addresses of the cohesin component Mcd1pThe Journal of Cell Biology 151:1047–1056.https://doi.org/10.1083/jcb.151.5.1047
-
Regulatory networks integrating cell cycle control with DNA damage checkpoints and double-strand break repairPhilosophical Transactions of the Royal Society of London. Series B, Biological Sciences 366:3562–3571.https://doi.org/10.1098/rstb.2011.0070
-
Cell cycle regulation of homologous recombination in Saccharomyces cerevisiaeFEMS Microbiology Reviews 38:172–184.https://doi.org/10.1111/1574-6976.12066
-
Esco1 acetylates cohesin via a mechanism different from that of Esco2Current Biology 25:1694–1706.https://doi.org/10.1016/j.cub.2015.05.017
-
Cohesin: its roles and mechanismsAnnual Review of Genetics 43:525–558.https://doi.org/10.1146/annurev-genet-102108-134233
-
Monitoring 5’-end resection at site-specific double-strand breaks by southern blot analysisMethods in Molecular Biology 2196:245–255.https://doi.org/10.1007/978-1-0716-0868-5_20
-
Cohesin regulates homology search during recombinational DNA repairNature Cell Biology 23:1176–1186.https://doi.org/10.1038/s41556-021-00783-x
-
SMC complexes differentially compact mitotic chromosomes according to genomic contextNature Cell Biology 19:1071–1080.https://doi.org/10.1038/ncb3594
-
Recruitment of Scc2/4 to double-strand breaks depends on γH2A and DNA end resectionLife Science Alliance 5:e202101244.https://doi.org/10.26508/lsa.202101244
-
Mechanism and regulation of DNA end resection in eukaryotesCritical Reviews in Biochemistry and Molecular Biology 51:195–212.https://doi.org/10.3109/10409238.2016.1172552
-
Monitoring gene conversion in budding yeast by southern blot analysisMethods in Molecular Biology 2153:221–238.https://doi.org/10.1007/978-1-0716-0644-5_16
-
Pds1p is required for faithful execution of anaphase in the yeast, Saccharomyces cerevisiaeThe Journal of Cell Biology 133:85–97.https://doi.org/10.1083/jcb.133.1.85
Article and author information
Author details
Funding
Ministerio de Ciencia, Innovación y Universidades (BFU2017-83954-R)
- Félix Machín
Ministerio de Ciencia, Innovación y Universidades (PID2021-123716OB-I00)
- Félix Machín
National Institutes of Health (NIH R35 GM126997)
- Lorraine S Symington
The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.
Acknowledgements
We are grateful to Katsuhiko Shirahige for the anti-acSmc3 antibody. We would like to thank other members from Machín’s and Symington’s labs for enriching and fruitful discussion. This work was supported by the Spanish Ministry of Science, Innovation and Universities (MICIU/AEI/10.13039/501100011033; research grants BFU2017-83954-R and PID2021-123716OB-I00 to FM; co-funded by the EU-ERDF 'A way of making Europe') and the National Institutes of Health (research grant NIH R35 GM126997 to LS). The Agencia Canaria de Investigación, Innovación y Sociedad de la Información (ACIISI) supported SM-S through a predoctoral fellowship (TESIS2020010028; co-funded by the ESF+), and the Servicio Público de Empleo Estatal (SEPE) supported EH-C through an INVESTIGO program contract (co-funded by the ESF+).
Version history
- Preprint posted:
- Sent for peer review:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.92706. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Ayra Plasencia, Medina-Suárez et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 2,230
- views
-
- 148
- downloads
-
- 2
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.
Citations by DOI
-
- 2
- citations for umbrella DOI https://doi.org/10.7554/eLife.92706