1. Cell Biology
  2. Microbiology and Infectious Disease

A conserved cell-pole determinant organizes proper polar flagellum formation

  1. Erick E Arroyo-Pérez  Is a corresponding author
  2. John C Hook
  3. Alejandra Alvarado
  4. Stephan Wimmi
  5. Timo Glatter
  6. Kai Thormann  Is a corresponding author
  7. Simon Ringgaard
  1. Max Planck Institute for Terrestrial Microbiology, Department of Ecophysiology, Germany
  2. Department of Biology I, Microbiology, Ludwig-Maximilians-Universität München, Germany
  3. Department of Microbiology and Molecular Biology, Justus-Liebig-Universität Giessen, Germany
  4. Interfaculty Institute of Microbiology and Infection Medicine Tübingen, Bacterial Metabolomics, University of Tübingen, Germany
  5. Institute for Biological Physics, University of Cologne, Germany
  6. Core Facility for Mass Spectrometry and Proteomics, Max Planck Institute for Terrestrial Microbiology, Germany
https://doi.org/10.7554/eLife.93004.3
Share this article
Cite this article
  1. Erick E Arroyo-Pérez
  2. John C Hook
  3. Alejandra Alvarado
  4. Stephan Wimmi
  5. Timo Glatter
  6. Kai Thormann
  7. Simon Ringgaard
(2024)
A conserved cell-pole determinant organizes proper polar flagellum formation
eLife 13:RP93004.
https://doi.org/10.7554/eLife.93004.3
  2. Download BibTeX
  3. Download .RIS
7 figures, 1 table and 3 additional files

Figures

Figure 1 with 2 supplements
Download asset Open asset
FipA constitutes a new family of FlhF interaction partners.

Volcanoplots representing Log-ratios versus significance values of proteins enriched in (A) FlhF-sfGFP or (B) FipA-sfGFP purifications using shotgun proteomics and liquid chromatography-mass spectrometry; sfGFP was used as control. The full list of pulled-down proteins can be found in the Supplementary file 1a. (C) Organization of the flagellar/chemotaxis gene region encoding FlhF and FipA in V. parahaemolyticus. (D) Domain organization of FipA (TM, transmembrane region; DUF, domain of unknown function). (E) Bacterial two-hybrid confirming the interaction between FipA and FlhF from V. parahaemolyticus. The indicated proteins (FipA, FlhF) were fused N- or C-terminally to the T18- or T25-fragment of the Bordetella pertussis adenylate cyclase. In vivo interaction of the fusion proteins in Escherichia coli is indicated by blue color. The corresponding assay in P. putida and S. putrefaciens is displayed in Figure 1—figure supplement 2. (F) Dendrogram of γ-proteobacteria, indicating the presence of FlhF or FipA homologues and the corresponding flagellation pattern. An extended version and sources are available in Supplementary file 1b.

Figure 1—figure supplement 1
Download asset Open asset
Membrane topology of FipA.

(A) Topology analysis and (B) the corresponding model. A Pho/LacZα cassette was translationally fused to the N- or the C-terminus of FipA and the fusion is expressed in a suitable E. coli strain. Pho is only active in the periplasm, while LacZα can functionally complement β-galactosidase activity within the cytoplasm. The enzyme activities can then be tested using suitable color reactions. Expression of Pho-Lac-FipA resulted in blue colonies whereas expression of FipA-Pho-Lac resulted in red colonies, hence suggesting that the FipA N-terminus is positioned in the periplasm and the C-terminus in the cytoplasm (B). Deletion of the predicted membrane spanning domain in Pho-Lac-FipA (aa 6–28, Pho-Lac-FipAΔMD) resulted in red E. coli colonies (A). This suggests that in the absence of the membrane spanning domain the N-terminus of FipA resides in the cytoplasm, and thus further supports that FipA is a transmembrane protein anchored in the inner membrane via the 6–28 aa N-terminal membrane spanning domain and is oriented with the 1–5 aa N-terminal in the periplasm and the 29–163 aa C-terminal in the cytoplasm (B).

Figure 1—figure supplement 2
Download asset Open asset
FlhF interacts with FipA in a bacterial two-hybrid analysis (BACTH) in P. putida and S. putrefaciens.

FlhF and FipA were produced as N-terminal or as C-terminal fusions to the T18 and T25 fragments of the B. pertussis adenylate cyclase in the given combinations within a single strain. In vivo protein-protein interactions result in active adenylate cyclase activity and high cAMP levels, indicated by blue coloring of the colonies on X-Gal-containing agar.

Figure 2 with 1 supplement
Download asset Open asset
FipA is required for correct flagellum formation.

(A, C) Representative soft-agar swimming assay of V. parahaemolyticus (A) or P. putida (C) strains (left panels) and the corresponding quantification (right panels). For the latter, the halo diameter measurements were normalized to the halo of the wild type on each plate. Data presented are from six (A) or three (C) independent replicates, asterisks represent a p-value < 0.05 (according to ANOVA + Tukey tests). (B) Single-cell tracking of V. parahaemolyticus. Shown are representative swimming trajectories and quantification of swimming speed, total displacement and reversal rate. N indicates number of cells tracked among three biological replicates (ANOVA + Tukey test). (D) Representative electron micrographs of the indicated V. parahaemolyticus strains stained with uranyl acetate. (E) Quantification of flagellation pattern in the populations of the indicated V. parahaemolyticus strains. (F) Flagellum stain of indicated P. putida strains with Alexa Fluor 488-C5-maleimide and (G) quantification of the corresponding flagellation in the population. N indicates the number of cells counted among three biological replicates. For S. putrefaciens, see Figure 2—figure supplement 1.

Figure 2—figure supplement 1
Download asset Open asset
Deletions of or in FipA and FlhF affect S. putrefaciens flagellation.

(A) Upper panel: Spreading of the indicated strains in soft agar. fipA ΔTM indicates that the transmembrane region of FipA was deleted. The images shown were compiled from a single plate. Lower panel: the corresponding quantification given as diameter; three independent experiments were conducted. The error bar marks the standard deviation. (B) Left: Shown are fluorescent micrographs where the flagellar filament(s) of the indicated strains were fluorescently labeled by maleimide dye. The position of the cell bodies was outlined in the figure. The scale bare equals 5 µm. Right: The corresponding quantification of flagellation. The number of cells (n) for each experiment was >300 from three indepenedent experiments. The error bar between the different populations shows the standard deviation.

Figure 3 with 5 supplements
Download asset Open asset
Localization of FlhF depends on FipA and HubP.

(A) Representative micrographs of the indicated strains of V. parahaemoloyticus expressing FlhF-sfGFP from its native promoter. Upper panel shows the DIC image, the lower panel the corresponding fluorescence image. Fluorescent foci are highlighted by white arrows. Scale bar = 2 μm. For an enlargment see Figure 3—figure supplement 3. (B) Demographs displaying FlhF-sfGFP fluorescence intensity along the cell length within the experiments shown in (A). (C) Quantification of localization patterns and (D) foci fluorescence intensity of the fluorescence microscopy experiment presented in (A). The data was combined from the given number (N) of cells combined from three biological replicates. (E) Representative micrographs of the indicated P. putida strains expressing FlhF-sfGFP from its native promoter. The upper panels show the DIC and the lower panels the corresponding fluorescence images. Fluorescent foci are marked by small white arrows. The scale bar equals 5 µm. The low intensity of the foci did not allow a quantitative analysis of foci intensities or the generation of demographs. For an enlargement of the micrographs see Figure 3—figure supplement 4. (F) Quantification of FlhF-sfGFP localization patterns in the corresponding strains of P. putida from the experiments shown in (E). Corresponding data on the localization of FlhF in S. putrefaciens is displayed in Figure 3—figure supplement 5.

Figure 3—figure supplement 1
Download asset Open asset
Western analysis on the protein levels of FlhF and FipA fusions to fluorescent proteins.

Crude protein extracts from the corresponding (mutant) strains of V. parahaemolyticus (A, D), P. putida (B, E) and S. putrefaciens (C, F) were separated by SDS-PAGE, transferred to membranes and visualized by western blotting using antibodies against GFP (A, C–F) and mCherry (B). The same OD units from the culture were loaded for each sample. The corresponding strain background is indicated above the lanes.

Figure 3—figure supplement 1—source data 1

Scans of the original western blots for Figure 3—figure supplement 1.

https://cdn.elifesciences.org/articles/93004/elife-93004-fig3-figsupp1-data1-v1.zip
Figure 3—figure supplement 1—source data 2

Scans of the original western blots for Figure 3—figure supplement 1 with labels.

https://cdn.elifesciences.org/articles/93004/elife-93004-fig3-figsupp1-data2-v1.zip
Figure 3—figure supplement 2
Download asset Open asset
N-terminal tagging of PpFlhF with mCherry does not negatively affect spreading motility in soft agar.

The upper panel shows the spreading in soft agar, the lower panel shows the corresponding quantification. The images shown are from the same plate, three independent experiments were conducted. The corresponding standard error bar is shown.

Figure 3—figure supplement 3
Download asset Open asset
Localization of FlhF depends on FipA and HubP.

Shown are enlargments of Figure 3A, representative micrographs of the indicated strains of V. parahaemoloyticus expressing FlhF-sfGFP from its native promoter. The upper panel shows the DIC image, the lower panel the corresponding fluorescence image. Fluorescent foci are highlighted by white arrows. Scale bar = 2 μm.

Figure 3—figure supplement 4
Download asset Open asset
Localization of FlhF depends on FipA and HubP.

Shown are enlargments of Figure 3E, representative micrographs of the indicated strains of P. putida expressing FlhF-sfGFP from its native promoter. The upper panel shows the DIC image, the lower panel the corresponding fluorescence image. Fluorescent foci are highlighted by white arrows. Scale bar = 5 μm.

Figure 3—figure supplement 5
Download asset Open asset
SpFipA and SpHubP concertedly affect polar SpFlhF localization.

A) Fluorescence microscopy on the indicated (mutant) strains each bearing an flhF-mvenus hybrid gene replacing native flhF on the chromosome. The upper panel shows DIC micrographs, the lower panel the corresponding fluorescent images. The scale bar equals 5 µm. (B) Quantification of the FlhF-mVenus localization patterns, using the data from >300 cells (n) from three independent experiments, the corresponding standard error is shown as error bar.

Figure 4
Download asset Open asset
Activity of FipA depends on FlhF and on its transmembrane domain.

(A) Micrographs of E. coli cells expressing FipA-sfGFP from V. parahaemolyticus, and a truncated version lacking the transmembrane domain (ΔTM). The left panels display the DIC and the right panels the corresponding fluorescence images. The scale bar equals 5 μm. (B) Electron micrographs of V. parahaemolyticus wild-type and mutant cells lacking the transmembrane domain of fipA, respectively. The corresponding quantification of the flagellation pattern is shown to the left of the micrographs. Note that the data for the wild-type cells is the same as in Figure 2D and E. (C) Spreading behavior of the indicated P. putida strains (left) with the corresponding quantification (right). Loss of the FipA TM region phenocopies a complete fipA deletion.

Figure 5 with 2 supplements
Download asset Open asset
Conserved residues in the domain of unknown function of FipA are essential for interaction with FlhF.

(A) Weight-based consensus sequence of the conserved region of DUF2802 as obtained from 481 species. The residues targeted in the FipA orthologs of V. parahaemolyticus, P. putida and S. putrefaciens are indicated along with their appropriate residue position. (B, C) Bacterial two-hybrid assay of FipA variants of V. parahaemolyticus (B) or P. putida (C) with an alanine substitution in the conserved residues indicated in (A). The constructs were tested for self-interaction and interaction with FlhF. In vivo interaction of the fusions in E. coli is indicated by blue coloration of the colonies. (D) Quantification from single-cell tracking of swimming V. parahaemolyticus cells expressing FipA bearing the indicated substitution in the DUF2802 domain (see Figure 2B for wild-type behavior). Asterisks indicate a p-value <0.05 (ANOVA + Tukey test) (F) Localization of VpFlhF in the absence of FipA or in cells with substitutions in the DUF2802 domain. Left: Micrographs showing the localization of FipA-sfGFP in the indicated strains; the upper panels display the DIC and the lower panels the corresponding fluorescence images (for an enlargement see Figure 5—figure supplement 1). The scale bar equals 5 µm. Right: the corresponding quantification of the FlhF-sfGFP patterns in the indicated strains. (E) Soft-agar spreading assays of P. putida wild-type and indicated mutant strains, asterisks display a p-value of 0.05 (*) or 0.01 (**) (ANOVA). (G) Localization of P. putida FlhF in strains bearing substitutions in the DUF2802 interaction site. Left: micrographs displaying the localization of FlhF-mCherry in the indicated strains. Upper panels show the DIC and lower panels the corresponding fluorescence images. The scale bar equals 5 µm (for an enlargement see Figure 5—figure supplement 1). Right: Corresponding quantification of the FlhF localization pattern in the indicated strains. Data for S. putrefaciens is displayed in Figure 5—figure supplement 2.

Figure 5—figure supplement 1
Download asset Open asset
Conserved residues in the domain of unknown function of FipA are essential for interaction with FlhF in P. putida.

(A) Localization of VpFlhF in cells with substitutions in the DUF2802 domain. Micrographs are showing the localization of FipA-sfGFP in the indicated strains; the upper panels display the DIC and the lower panels the corresponding fluorescence images. The scale bar equals 5 µm. (B) The same analysis for P. putida FlhF-mCherry. The images are enlargements of Figure 5F (A) and Figure 5G (B).

Figure 5—figure supplement 2
Download asset Open asset
Targeted residue substitution in FipA affects FlhF positioning and function in S. putrefaciens.

(A) BACTH analysis (see, e.g. Figure 2) suggests that G106A and L125A in SpFipA does not disrupt but maybe weakens (G106A) the interaction between SpFipA and SpFlhF. (B) Spreading of the indicated S. putrefaciens strains in soft agar reveals a small but sigifnificant (asterisk = p < 0.05) and based on three independent experiments. (C) Left: micrographs showing DIC (upper panels) and fluorescent imaging on mVenus-tagged FlhF cells in mutant backgrounds bearing the given substutions in SpFipA with the corresponding quantification (n>300 cells, right). The in vivo analysis suggests that the residue substitutions in SpFipA give rise to phenotypes that are similar to that of a fipA deletion.

Figure 6 with 2 supplements
Download asset Open asset
The localization pattern of FipA.

(A, B) Localization pattern of fluorescently labeled FipA in V. parahaemolyticus and P. putida. (A) Representative micrographs of V. parahaemolyticus expressing FipA-sfGFP from its native promoter. Scale bar = 2 μm. The upper panel shows the DIC and the lower panel the corresponding fluorescence channel. To the right the localization was quantified accordingly. (B) The same analysis for P. putida. (C, D) Time lapse analysis of FipA-sfGFP localization over a cell cycle in V. parahaemolyticus (C) and P. putida (D). The numbers in the upper DIC micrographs show the minutes after start of the experiment. The scale bars equal 1 µm (C) and 5 µm (D).

Figure 6—figure supplement 1
Download asset Open asset
Production and function of FipA derivatives.

The three panels show western blotting analysis of PAGE protein separations from V. parahaemolyticus (A), P. putida (B) and S. putrefaciens (C) bearing FipA-sfGFP with substitutions in conserved residues as indicated, using antibodies raised against sfGFP. V. parahaemolyticus also includes a mutant deleted in flhF. The loaded samples are normalized by OD units. (D) The C-terminal fusion of sfGFP has only minor effects on FipA function in S. putrefaciens and P. putida. The upper panels show the spreading in soft agar (taken from the same soft agar plate), the lower the corresponding quantification. The error bars are the standard deviation from three independent experiments.

Figure 6—figure supplement 1—source data 1

Scans of the original western blots for Figure 6—figure supplement 1.

https://cdn.elifesciences.org/articles/93004/elife-93004-fig6-figsupp1-data1-v1.zip
Figure 6—figure supplement 1—source data 2

Scans of the original western blots for Figure 6—figure supplement 1 with labels.

https://cdn.elifesciences.org/articles/93004/elife-93004-fig6-figsupp1-data2-v1.zip
Figure 6—figure supplement 2
Download asset Open asset
The localization pattern of FipA.

Localization pattern of fluorescently labeled FipA in V. parahaemolyticus and P. putida. Left: Representative micrographs of V. parahaemolyticus expressing FipA-sfGFP from its native promoter. Scale bar = 2 μm. The upper panel shows the DIC and the lower panel the corresponding fluorescence channel. Right: The same analysis for P. putida. The images are enlargements of the micrographs in Figure 6A and B.

Figure 7 with 3 supplements
Download asset Open asset
Normal localization of FipA depends on interaction with FlhF.

(A, B) Localization pattern of V. parahaemolyticus FipA-sfGFP in the indicated wild-type and mutant strains. The upper panels display the DIC micrographs, the middle panel the corresponding fluorescence imaging (scale bar equals 5 µm), and the lower panel the corresponding demograph showing the fluorescence of FipA-sfGFP along the cell length. (C) Quantification of the cell localization pattern from the experiment shown in (A, B) as combined from three biological replicates. (D, E, F) The same analysis for the corresponding P. putida strains as indicated. The scale bar equals 5 µm. The data for S. putrefaciens is displayed in Figure 7—figure supplement 3.

Figure 7—figure supplement 1
Download asset Open asset
Normal localization of FipA depends on interaction with FlhF.

Localization pattern of V. parahaemolitycus FipA-sfGFP in the indicated wild-type and mutant strains. The upper panels display the DIC micrographs, the lower panel the corresponding fluorescence imaging (scale bar equals 5 µm). The images are enlargements of the micrographs in Figure 7A (upper) and 7B (lower).

Figure 7—figure supplement 2
Download asset Open asset
Normal localization of FipA depends on interaction with FlhF.

Localization pattern of P. putida FipA-sfGFP in the indicated wild-type and mutant strains. The upper panels display the DIC micrographs, the lower panel the corresponding fluorescence imaging (scale bar equals 5 µm). The images are enlargements of the micrographs in Figure 7D (upper) and 7E (lower).

Figure 7—figure supplement 3
Download asset Open asset
Localization of SpFipA in different strain backgrounds.

Left: Micrographs showing DIC (left) and fluorescence (right) microscopy on cells with FipA-sfGFP in different background strains as indicated. The scale bar equals 5 µm. The corresponding quantification (N>300, three independent experiments) is shown to the right. FipA loses its polar localization in a mutant lacking HubP and in a mutant with the L125A substitution in FipA.

Tables

Appendix 1—key resources table
Reagent type (species) or resourceDesignationSource or referenceIdentifiersAdditional information
Gene (Vibrio parahaemolyticus)fipAKEGGVP2224
Gene (Pseudomonas putida)fipAKEGGPP_4331
Gene (Shewanella putrefaciens)fipAKEGGSputcn32_2550
Gene (Vibrio parahaemolyticus)flhFKEGGVP2234
Gene (Pseudomonas putida)flhFKEGGPP_4343
Gene (Shewanella putrefaciens)flhFKEGGSputcn32_2561
Strain (Escherichia coli)SM10λpirSimon et al., 1983
Strain (Escherichia coli)DH5pirMiller and Mekalanos, 1988
Strain (Escherichia coli)BTH101Euromedex
Strain (Escherichia coli)WM3064Metcalf, University of Illinois, Urbana‐Champaign
Strain (Vibrio parahaemolyticus)RIMD 2210633Makino et al., 2003Wild type
Strain (Vibrio parahaemolyticus)Δvp2234 (ΔflhF), Δvpa1548 (ΔlafA)Arroyo-Pérez and Ringgaard, 2021EP12
Strain (Vibrio parahaemolyticus)Δvp2225 (ΔcheW)Ringgaard et al., 2014SR58
Strain (Vibrio parahaemolyticus)Δvpa1548 (ΔlafA)Arroyo-Pérez and Ringgaard, 2021JH2
Strain (Vibrio parahaemolyticus)Δvp2224 (ΔfipA), Δvpa1548 (ΔlafA)this studyEP15Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2234 (ΔflhF)Arroyo-Pérez and Ringgaard, 2021PM60
Strain (Vibrio parahaemolyticus)Δvp2224 (ΔfipA)this studySW01Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2191 (ΔhubP)Arroyo-Pérez and Ringgaard, 2021JH4
Strain (Vibrio parahaemolyticus)Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp)Arroyo-Pérez and Ringgaard, 2021PM69
Strain (Vibrio parahaemolyticus)Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), Δvp2224 (fipA)this studyPM77Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), Δvp2191 (hubP)Arroyo-Pérez and Ringgaard, 2021EP11
Strain (Vibrio parahaemolyticus)Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), Δvp2224 (fipA), Δvp2191 (hubP)this studyEP09Materials and Methods
Strain (Vibrio parahaemolyticus)vp2224 (fipA) L129Athis studyPM65Materials and Methods
Strain (Vibrio parahaemolyticus)vp2224 (fipA) G110Athis studyPM66Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), vp2224 (fipA) L129Athis studyEP16Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2234::vp2234-sfgfp (ΔflhF::flhF-sfgfp), vp2224 (fipA) G110Athis studyEP17Materials and Methods
Strain (Vibrio parahaemolyticus)vp2224 L129A, Δvpa1548(lafA)this studyEP13Materials and Methods
Strain (Vibrio parahaemolyticus)vp2224 G110A, Δvpa1548(lafA)this studyEP14Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2224::vp2224-sfgfp (ΔfipA::fipA-sfgfp)this studyPM64Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2224::vp2224-sfgfp (ΔfipA::fipA-sfgfp), Δvp2234 (flhF)this studyPM68Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2224::vp2224 L129A-sfgfp (ΔfipA L129A::fipA-sfgfp)this studyPM71Materials and Methods
Strain (Vibrio parahaemolyticus)Δvp2224::vp2224 G110A-sfgfp (ΔfipA G110A::fipA-sfgfp)this studyPM72Materials and Methods
Strain (Pseudomonas putida)KT2440Nelson et al., 2002Wild type
Strain (Pseudomonas putida)FliC S267CHintsche et al., 2017
Strain (Pseudomonas putida)FliC S267C ΔflhFthis studyMaterials and Methods
Strain (Pseudomonas putida)ΔfipAthis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C ΔfipAthis studyMaterials and Methods
Strain (Pseudomonas putida)FipA -DILEL-sfGFPthis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C ΔflhF FipA-DILEL-sfGFPthis studyMaterials and Methods
Strain (Pseudomonas putida)FlhF-GS-mCherrythis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C ΔfimV FipA -DILEL-sfGFPthis studyMaterials and Methods
Strain (Pseudomonas putida)ΔfipA FlhF-GS-mCherrythis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FipA G104Athis studyMaterials and Methods
Strain (Pseudomonas putida)FipA L123Athis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FipA L123Athis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FipA-DILEL-sfGFPthis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FipA L116Athis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FipA G104A-DILEL-sfGFPthis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FipA L123A-DILEL-sfGFPthis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FipA L116A-DILEL-sfGFPthis studyMaterials and Methods
Strain (Pseudomonas putida)FlhF-GS-mCherry ΔfimVthis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C ΔfipA FipA KIthis studyMaterials and Methods
Strain (Pseudomonas putida)FlhF-GS-mCherry ΔfimV ΔfipAthis studyMaterials and Methods
Strain (Pseudomonas putida)FlhF-GS-mCherry FipA L123Athis studyMaterials and Methods
Strain (Pseudomonas putida)FlhF-GS-mCherry FipA L116Athis studyMaterials and Methods
Strain (Pseudomonas putida)FlhF-GS-mCherry FipA G104Athis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FlhF D362A-GS-mCherrythis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FlhF-GS-mCherry FipA ΔTMDthis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FlhF-GS-mCherry FipA ΔTMDthis studyMaterials and Methods
Strain (Pseudomonas putida)FliC S267C FipA ΔTMD-DILEL-sfGFPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)CN-32Fredrickson et al., 1998Wild type
Strain (Shewanella putrefaciens)ΔflhFRossmann et al., 2015
Strain (Shewanella putrefaciens)CheA-mCherrythis studyMaterials and Methods
Strain (Shewanella putrefaciens)flgE1 T183CRossmann et al., 2019
Strain (Shewanella putrefaciens)flaB1 T166C flaA1 T174C ΔflagLKühn et al., 2017
Strain (Shewanella putrefaciens)ΔfipAthis studyMaterials and Methods
Strain (Shewanella putrefaciens)CheA-mCherry ΔfipAthis studyMaterials and Methods
Strain (Shewanella putrefaciens)flaB1 T166C flaA1 T174C ΔflagL ΔfipAthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FlhF-GS-mVenusthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA-DILEL-sfGFPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FlhF-GS-mVenus ΔfipAthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FlhF-GS-mVenus ΔflhGthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA-DILEL-sfGFP ΔflhFthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FlhF-GS-mVenus ΔhubPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FlhF-GS-mVenus ΔfipA ΔhubPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)flgE1 T183C ΔflagLHook et al., 2020
Strain (Shewanella putrefaciens)FipA-DILEL-sfGFP ΔhubPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)HubP-mCherry FlhF-GS-Venusthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FlhF-GS-mVenus ΔhubP ΔSputcn32_3157this studyMaterials and Methods
Strain (Shewanella putrefaciens)flaB1 T166C flaA1 T174C ΔflagL FipA-DILEL-sfGFPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)flaB1 T166C flaA1 T174C ΔflagL ΔflhFthis studyMaterials and Methods
Strain (Shewanella putrefaciens)ΔfipA fipA (Sputcn32_2550) KIthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA L118Athis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA G106Athis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA L118-DILEL-sfGFPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA G106A-DILEL-sfGFPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)flgE1 T183C ΔflagL FliM1-GS-sfGFPHook et al., 2020
Strain (Shewanella putrefaciens)FipA L125Athis studyMaterials and Methods
Strain (Shewanella putrefaciens)flaB1 T166C flaA1 T174C ΔflagL ΔfipA ΔhubPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA L125A-DILEL-sfGFPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FlhF-mCherry FipA-DILEL-sfGFPthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA L118A FlhF-GS-mVenusthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA G106A FlhF-GS-mVenusthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA L125A FlhF-GS-mVenusthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA ΔTMDthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FlhF-GS-mVenus FipA ΔTMDthis studyMaterials and Methods
Strain (Shewanella putrefaciens)FipA ΔTMD-DILEL-sfGFPthis studyMaterials and Methods
AntibodyJL-8 anti-GFP (mouse monoclonal)Takarabio632380WB (1:10,000)
AntibodyAmersham ECL mouse IgG (sheep, polyclonal)General ElectricNA931WB (1:5,000)
AntibodyAnti-GFP (mouse)Roche11814460001WB (1:5,000)
AntibodyAnti-mCherry (rabbit)Biovision5993–100WB (1:10,000)
AntibodyAnti-mouseSigmaA3562WB (1:5,000)
AntibodyAnti-rabbitSigmaA8025WB (1:20,000)
Recombinant DNA reagentpDM4Milton et al., 1996Suicide vector for
gene deletions
in Vibrio sp.
Recombinant DNA reagentpJH036Iyer et al., 2020pBAD33 derivative for
sfGFP C-terminal fusion
Recombinant DNA reagentpNPTS138-R6KTLassak et al., 2010Suicide vector for gene
deletions in P. putida and
S. Putrefaciens
Recombinant DNA reagentpKT25Karimova et al., 1998For bacterial two
hybrid assay
Recombinant DNA reagentpKNT25Karimova et al., 1998For bacterial two
hybrid assay
Recombinant DNA reagentpUT18Karimova et al., 1998For bacterial two
hybrid assay
Recombinant DNA reagentpUT18CKarimova et al., 1998For bacterial two
hybrid assay
Recombinant DNA reagentpJH003Heering and Ringgaard, 2016For deletion of
vpa1548(lafA)
Recombinant DNA reagentpSW022This workFor deletion of vp2224(fipA)
Recombinant DNA reagentpPM188fipArroyo-Pérez and Ringgaard, 2021For insertion of vp2234-
sfgfp (flhF-sfgfp),
replacing native flhF
Recombinant DNA reagentpPM178this workFor insertion of vp2224-
sfgfp (fipA-sfgfp),
replacing native fipA
Recombinant DNA reagentpPM179this workFor insertion of vp2224
(fipA) G110A point
mutation in the chromosome
in the native locus
Recombinant DNA reagentpPM180this workFor insertion of vp2224 (fipA)
L129A point mutation
in the chromosome in the native locus
Recombinant DNA reagentpPM191this workFor insertion of vp2224 (fipA)
G110A fused
to sfGFP in the chromosome in
the native locus
Recombinant DNA reagentpPM187this workFor insertion of vp2224 (fipA) L129A fused
to sfGFP in the chromosome
in the native locus
Recombinant DNA reagentpPM039Arroyo-Pérez and Ringgaard, 2021For deletion of vp2191 (hubP)
Recombinant DNA reagentpPM194this workFor overexpression of VP2224(FipA)
Δ7–27 -sfGFP
Recombinant DNA reagentpPM146this workFor overexpression of
VP2224(FipA)
Recombinant DNA reagentpPM159this workFor overexpression of
VP2224(FipA)-sfGFP
Recombinant DNA reagentpNPTS138-R6KT flhF KO (PP_4343)this studyFor deletion of the flhF gene
(PP_4343)
in P. putida KT2440;
Kanr
Recombinant DNA reagentpNPTS138-R6KT FlhF K235A (PP_4343)this studyFor in frame complementation of flhF
(PP_4343) with FlhF
K235A mutant in
P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FlhF-GS-mCherry (PP_4343)this studyFor in frame complementation of flhF (PP_4343)
with FlhF-GS-mCherry in
P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FlhF K235A-GS-mCherry (PP_4343)this studyFor in frame complementation
of flhF (PP_4343) with
FlhF K235A-GS-mCherry
mutant in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FlhF D301A-GS-mCherry (PP_4343)this studyFor in frame complementation of flhF
(PP_4343) with FlhF
D301A-GS-mCherry
mutant in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FlhF D362A-GS-mCherry (PP_4343)this studyFor in frame complementation
of flhF (PP_4343) with FlhF D362A-GS-mCherry
mutant in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT fipA KO (PP_4331)this studyFor deletion of the fipA gene (PP_4331) in
P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT fipA KI (PP_4331)this studyFor in frame complementation of fipA
(PP_4331) with wild
type fipA in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA ΔTMD (AS5-22) (PP_4331)this studyFor in frame complementation
of fipA (PP_4331) with FipA ΔTMD
mutant in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA G104A (PP_4331)this studyFor in frame complementation
of fipA
(PP_4331) with FipA G104A
mutant in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA L116A (PP_4331)this studyFor in frame complementation
of fipA (PP_4331) with FipA L116A mutant in
P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA L123A (PP_4331)this studyFor in frame complementation
of fipA (PP_4331) with FipA L123A mutant in
P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA-DILEL-sfGFP (PP_4331)this studyFor in frame complementation of fipA
(PP_4331) with FipA-DILEL-sfGFP in
P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA ΔTMD-DILEL-sfGFP (AS5-22) (PP_4331)this studyFor in frame complementation of fipA
(PP_4331) with FipA ΔTMD-DILEL-sfGFP
mutant in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA G104A-DILEL-sfGFP (PP_4331)this studyFor in frame complementation of fipA
(PP_4331) with FipA G104A-DILEL-sfGFP
mutant in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA L116A-DILEL-sfGFP (PP_4331)this studyFor in frame complementation of fipA
(PP_4331) with FipA L116A-DILEL-sfGFP mutant in
P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA L123A-DILEL-sfGFP (PP_4331)this studyFor in frame complementation of fipA
(PP_4331) with FipA L123A-DILEL-sfGFP
mutant in P. putida KT2440; Kanr
Recombinant DNA reagentpNPTS138-R6KT polar flagellar cluster KO (Sputcn32_2548–2608)this studyplasmid for deletion of the polar flagellar
gene cluster (Sputcn32_2548–2608) in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT lateral flagellar cluster KO (Sputcn32_3444–3485)Lassak et al., 2010plasmid for deletion of the lateral flagellar
gene cluster (Sputcn32_3444–3485) in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT flagL KO (Sputcn32_3455, Sputcn32_3456)Rossmann et al., 2015plasmid for deletion of the lateral flagellin
genes (Sputcn32_3455, Sputcn32_3456)
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT hubP KO (Sputcn32_2442)Rossmann et al., 2015plasmid for deletion of the hubP gene
(Sputcn32_2442) in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT flhF KO (Sputcn32_2561)Rossmann et al., 2015plasmid for deletion of the flhF gene
(Sputcn32_2561) in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT flhG KO (Sputcn32_2560)Schuhmacher et al., 2015aplasmid for deletion of the flhG gene
(Sputcn32_2560) in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FlhF-GS-Venus (Sputcn32_2561)this studyplasmid for in frame complementation
of flhF (Sputcn32_2561) with FlhF-GS-mVenus
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT fipA KO (Sputcn32_2550)this studyplasmid for deletion of the fipA gene
(Sputcn32_2550) in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT fipA KI (Sputcn32_2550)this studyplasmid for in frame complementation
of fipA (Sputcn32_2550) with wild type
fipA in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA ΔTMD (AS5-23) (Sputcn32_2550)this studyplasmid for in frame complementation
of fipA (Sputcn32_2550) with FipA ΔTMD mutant in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA G106A (Sputcn32_2550)this studyplasmid for in frame complementation
of fipA (Sputcn32_2550) with FipA G106A mutant
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA L118A (Sputcn32_2550)this studyplasmid for in frame complementation
of fipA (Sputcn32_2550) with FipA L118A mutant
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA L125A (Sputcn32_2550)this studyplasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA L125 mutant
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA-DILEL-sfGFP (Sputcn32_2550)this studyplasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA-DILEL-sfGFP
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA ΔTMD-DILEL-sfGFP (AS5-23) (Sputcn32_2550)this studyplasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA
ΔTMD-DILEL-sfGFP mutant in S. putrefaciens
CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA G106A-DILEL-sfGFP (Sputcn32_2550)this studyplasmid for in frame
complementation of fipA (Sputcn32_2550)
with FipA G106A-DILEL-sfGFP mutant in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA L116A-DILEL-sfGFP (Sputcn32_2550)this studyplasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA L116A-DILEL-sfGFP
mutant in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FipA L125A-DILEL-sfGFP (Sputcn32_2550)this studyplasmid for in frame complementation of fipA
(Sputcn32_2550) with FipA L125A mutant in
S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpNPTS138-R6KT FliM1-GS-sfGFP (Sputcn32_2569)Hook et al., 2020plasmid for in frame
complementation of fliM1
(Sputcn32_2569) with FliM1-GS-sfGFP
in S. putrefaciens CN-32; Kanr
Recombinant DNA reagentpSW74this studyT25-vp2224(fipA)Δ1–27
Recombinant DNA reagentpSW119this studyT18-vp2224(fipA)Δ1–27
Recombinant DNA reagentpPM118this studyvp2224(fipA)Δ1–27 T18
Recombinant DNA reagentpPM119this studyvp2224(fipA)Δ1–27 T25
Recombinant DNA reagentpPM124this studyvp2234(flhF)-T18
Recombinant DNA reagentpPM128this studyvp2234(flhF)-T25
Recombinant DNA reagentpPM132this studyT18-vp2234(flhF)
Recombinant DNA reagentpPM136this studyT25-vp2234(flhF)
Recombinant DNA reagentpPM160this studyT18-vp2224(fipA)
Δ1–27 G110A
Recombinant DNA reagentpPM161this studyT18-vp2224(fipA)
Δ1–27 E126A
Recombinant DNA reagentpPM162this studyT18-vp2224(fipA)
Δ1–27 L129A
Recombinant DNA reagentpKT25 FlhF (PP_4343)this studyplasmid for BACTH assay
carrying T25-FlhF
(PP_4343); Kanr
Recombinant DNA reagentpKNT25 FlhF (PP_4343)this studyplasmid for BACTH assay
carrying FlhF-T25
(PP_4343); Kanr
Recombinant DNA reagentpUT18 FlhF (PP_4343)this studyplasmid for BACTH assay
carrying FlhF-T18
(PP_4343);
Ampr
Recombinant DNA reagentpUT18C FlhF (PP_4343)this studyplasmid for BACTH assay
carrying T18-FlhF (PP_4343);
Ampr
Recombinant DNA reagentpKT25 FlhF K235A (PP_4343)this studyplasmid for BACTH assay
carrying T25-FlhF K235A
(PP_4343);
Kanr
Recombinant DNA reagentpKNT25 FlhF K235A (PP_4343)this studyplasmid for BACTH assay
carrying FlhF K235A -T25 (PP_4343);
Kanr
Recombinant DNA reagentpUT18 FlhF K235A (PP_4343)this studyplasmid for BACTH assay
carrying FlhF K235A -T18
(PP_4343); Ampr
Recombinant DNA reagentpUT18C FlhF K235A (PP_4343)this studyplasmid for BACTH assay
carrying T18-FlhF K235A
(PP_4343);
Ampr
Recombinant DNA reagentpKT25 FipA (PP_4331)this studyplasmid for BACTH assay
carrying T25-FipA (PP_4331);
Kanr
Recombinant DNA reagentpKNT25 FipA (PP_4331)this studyplasmid for BACTH assay
carrying FipA-T25 (PP_4331);
Kanr
Recombinant DNA reagentpUT18 FipA (PP_4331)this studyplasmid for BACTH assay
carrying FipA-T18 (PP_4331);
Ampr
Recombinant DNA reagentpUT18C FipA (PP_4331)this studyplasmid for BACTH assay
carrying T18-FipA (PP_4331);
Ampr
Recombinant DNA reagentpKT25 FipA G104A (PP_4331)this studyplasmid for BACTH assay
carrying T25-FipA G104A
(PP_4331); Kanr
Recombinant DNA reagentpKNT25 FipA G104A (PP_4331)this studyplasmid for BACTH assay
carrying FipA G104A -T25
(PP_4331); Kanr
Recombinant DNA reagentpUT18 FipA G104A (PP_4331)this studyplasmid for BACTH assay
carrying FipA G104A -T18
(PP_4331); Ampr
Recombinant DNA reagentpUT18C FipA G104A (PP_4331)this studyplasmid for BACTH assay
carrying T18-FipA G104A
(PP_4331); Ampr
Recombinant DNA reagentpKT25 FipA L116A (PP_4331)this studyplasmid for BACTH assay
carrying T25-FipA L116A
(PP_4331); Kanr
Recombinant DNA reagentpKNT25 FipA L116A (PP_4331)this studyplasmid for BACTH assay
carrying FipA L116A -T25
(PP_4331); Kanr
Recombinant DNA reagentpUT18 FipA L116A (PP_4331)this studyplasmid for BACTH assay
carrying FipA L116A -T18
(PP_4331); Ampr
Recombinant DNA reagentpUT18C FipA L116A (PP_4331)this studyplasmid for BACTH assay
carrying T18-FipA L116A
(PP_4331); Ampr
Recombinant DNA reagentpKT25 FipA L125A (PP_4331)this studyplasmid for BACTH assay
carrying T25-FipA L123A
(PP_4331); Kanr
Recombinant DNA reagentpKNT25 FipA L125A (PP_4331)this studyplasmid for BACTH assay
carrying FipA L123A -T25
(PP_4331); Kanr
Recombinant DNA reagentpUT18 FipA L125A (PP_4331)this studyplasmid for BACTH assay
carrying FipA L123A -T18
(PP_4331); Ampr
Recombinant DNA reagentpUT18C FipA L125A (PP_4331)this studyplasmid for BACTH assay
carrying T18-FipA L123A
(PP_4331); Ampr
Recombinant DNA reagentpKT25 FlhF (Sputcn32_2561)this studyplasmid for BACTH assay
carrying T25-FlhF
(Sputcn32_2561); Kanr
Recombinant DNA reagentpKNT25 FlhF (Sputcn32_2561)this studyplasmid for BACTH assay
carrying FlhF-T25
(Sputcn32_2561); Kanr
Recombinant DNA reagentpUT18 FlhF (Sputcn32_2561)this studyplasmid for BACTH assay
carrying FlhF-T18
(Sputcn32_2561); Ampr
Recombinant DNA reagentpUT18C FlhF (Sputcn32_2561)this studyplasmid for BACTH assay
carrying T18-FlhF
(Sputcn32_2561); Ampr
Recombinant DNA reagentpKT25 FipA (Sputcn32_2550)this studyplasmid for BACTH assay
carrying T25-FipA
(Sputcn32_2550); Kanr
Recombinant DNA reagentpKNT25 FipA (Sputcn32_2550)this studyplasmid for BACTH assay
carrying FipA-T25
(Sputcn32_2550); Kanr
Recombinant DNA reagentpUT18 FipA (Sputcn32_2550)this studyplasmid for BACTH assay
carrying FipA-T18
(Sputcn32_2550); Ampr
Recombinant DNA reagentpUT18C FipA (Sputcn32_2550)this studyplasmid for BACTH assay
carrying T18-FipA
(Sputcn32_2550); Ampr
Recombinant DNA reagentpKT25 FipA G106A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying T25-FipA G106A
(Sputcn32_2550); Kanr
Recombinant DNA reagentpKNT25 FipA G106A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying FipA G106A -T25
(Sputcn32_2550); Kanr
Recombinant DNA reagentpUT18 FipA G106A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying FipA G106A -T18
(Sputcn32_2550); Ampr
Recombinant DNA reagentpUT18C FipA G106A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying T18-FipA G106A
(Sputcn32_2550); Ampr
Recombinant DNA reagentpKT25 FipA L116A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying T25-FipA L116A
(Sputcn32_2550); Kanr
Recombinant DNA reagentpKNT25 FipA L116A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying FipA L116A -T25
(Sputcn32_2550); Kanr
Recombinant DNA reagentpUT18 FipA L116A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying FipA L116A -T18
(Sputcn32_2550); Ampr
Recombinant DNA reagentpUT18C FipA L116A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying T18-FipA L116A
(Sputcn32_2550); Ampr
Recombinant DNA reagentpKT25 FipA L125A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying T25-FipA L125A
(Sputcn32_2550); Kanr
Recombinant DNA reagentpKNT25 FipA L125A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying FipA L125A
-T25 (Sputcn32_2550); Kanr
Recombinant DNA reagentpUT18 FipA L125A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying FipA L125A -T18
(Sputcn32_2550); Ampr
Recombinant DNA reagentpUT18C FipA L125A (Sputcn32_2550)this studyplasmid for BACTH assay
carrying T18-FipA L125A
(Sputcn32_2550); Ampr
Sequence-based reagentVP2224-del-athis studyPCR primersCCCCC tctaga ACGTTGTCATGCTTGGTGAAAGCA
Sequence-based reagentVP2224-del-bthis studyPCR primersAGTCTCTTCAGCCATCGTCATTC
Sequence-based reagentVP2224-del-cthis studyPCR primersgaatgacgatggctgaagagact cgacgataaagagaataaaaagaagc
Sequence-based reagentVP2224-del-dthis studyPCR primersCCCCC tctaga ACGCGACGCTGCTGACCCGCAGAA
Sequence-based reagentVP2224-checkthis studyPCR primersacaaactccgtggggatgaatac
Sequence-based reagentvp2224 AA1-6/28-end w/o Stopthis studyPCR primersccccc ctcaga atg gctgaagagacttttctgcgc
Sequence-based reagentpUT18C/pKT25-vp2234-cwthis studyPCR primersccccc tctaga G aaaataaagcgattttttgccaaagac
Sequence-based reagentpUT18C/pKT25-vp2234-ccwthis studyPCR primersccccc ggtacc ctagagtccttcgttgtcactg
Sequence-based reagentvpa1548-del-dthis studyPCR primersCcccc ctcgag TTATGTGTTCCGCCTTCCTCTC
Sequence-based reagentvpa1548-del-chkthis studyPCR primersaagtagccacatcccaaacgc
Sequence-based reagentVP2191-del-dthis studyPCR primersccccc tctaga GACAATGCGCTGCACGGAAT
Sequence-based reagentVP2191-del-chkthis studyPCR primersgatggaaaacggctacacca
Sequence-based reagentdel vp2234(FlhF)-dthis studyPCR primersCCCCC tctaga GAATACATGCTACGAGCTCAAGG
Sequence-based reagentdel vp2234(FlhF)-chkthis studyPCR primersGTTTACGGCATGATTGATGGCG
Sequence-based reagentvp2224-Gly110Ala-cwthis studyPCR primersgagcaaccaaaatggtgcagttaGCGgctgatatcaacgagctaatcg
Sequence-based reagentvp2224-Gly110Ala-ccwthis studyPCR primersCGATTAGCTCGTTGATATCAGCcgcTAACTGCACCATTTTGGTTGCTC
Sequence-based reagentvp2224-Glu126Ala-cwthis studyPCR primersagagtgtgaactgccaaaagcaGCAgcagagttgatgctctctttgc
Sequence-based reagentvp2224-Glu126Ala-ccwthis studyPCR primersGCAAAGAGAGCATCAACTCTGctgCTGCTTTTGGCAGTTCACACTCT
Sequence-based reagentvp2224-Leu129Ala-cwthis studyPCR primerstgaactgccaaaagcagaagcagag GC gatgctctctttgcagaaaaaactg
Sequence-based reagentvp2224-Leu129Ala-ccwthis studyPCR primersCAG TTT TTT CTG CAA AGA GAG CAT CGC CTC TGC TTC TGC TTT TGG CAG TTC A
Sequence-based reagentC-term sfGFP-vp2224-athis studyPCR primersCCCCC actagt ATGGCTGAAGAGACTTTTTTATCTGTAC
Sequence-based reagentC-term sfGFP-vp2224-bthis studyPCR primersgagctcgaggatgtc TCGTCGACGCCCACGTGG
Sequence-based reagentC-term sfGFP-vp2224-cthis studyPCR primersgacatcctcgagctc atgagcaaaggagaagaacttttcac
Sequence-based reagentC-term sfGFP-vp2224-dthis studyPCR primerstta tttgtagagctcatccatgcc
Sequence-based reagentC-term sfGFP-vp2224-ethis studyPCR primersggcatggatgagctctacaaa taa AGAGAATAAAAAGAAGCTTCGG
Sequence-based reagentC-term sfGFP-vp2224-fthis studyPCR primersccccc gcatgc TTTGTTTGTCGATTGCTGTTAGTGG
Sequence-based reagentdel AA7-27 vp2224-bthis studyPCR primersAAAAGTCTCTTCAGCCATCGTCATTC
Sequence-based reagentdel AA7-27 vp2224-cthis studyPCR primersGAATGACGATGGCTGAAGAGACTTTT CTGCGCATTCGTGCTAGTTTGC
Sequence-based reagentvp2224-cw-pBADthis studyPCR primersCCCCC tctaga atggctgaagagacttttttatctg
Sequence-based reagentvp2224-ccw-pBADthis studyPCR primersCCCCC gcatgc ttatcgtcgacgcccacg
Sequence-based reagentvp2224 cw restore deletionthis studyPCR primersACCTATAATTGGCTGAATGACG ATGGCTGAAGAGACTTTTTTATCTGTAC
Sequence-based reagentdownstream vp2224 cwthis studyPCR primersAGAGAATAAAAAGAAGCTTCGGC
Sequence-based reagentpUT18/pKNT25- vp2224-cwthis studyPCR primersccccc TCTAGA atggctgaagagacttttttatctgtac
Sequence-based reagentpUT18/pKNT25- tr-vp2224-cwthis studyPCR primersccccc TCTAGA ATG cgcattcgtgctagtttgc
Sequence-based reagentpUT18/pKNT25-vp2222 -ccwthis studyPCR primersccccc GGTACC CG tcgtcgacgcccacgtg
Sequence-based reagentpUT18C/pKT25-vp2224-cwthis studyPCR primersccccc tctaga G gctgaagagacttttttatctgtac
Sequence-based reagentpUT18C/pKT25-vp2224-ccwthis studyPCR primersccccc ggtacc ttatcgtcgacgcccacgtg
Sequence-based reagenttr2224 put18C cwthis studyPCR primersccccc tctaga G ATG cgcattcgtgctagtttgcaaaa
Sequence-based reagentsfGFP-1-ccwthis studyPCR primersccccc tctaga tttgtagagctcatccatgccatg
Sequence-based reagentvp2224 C-term PhoA-LacZ cwthis studyPCR primersCCCCC tctaga g atggcccggacaccagaaatg
Sequence-based reagentend -LacZ w/o STOP ccwthis studyPCR primersgcgccattcgccattcaggctgc
Sequence-based reagentLacZ to vp2224 w/o ATGthis studyPCR primersCCT GAA TGG CGA ATG GCG C GCT GAA GAG ACT TTT TTA TCT GTA CC
Sequence-based reagentend vp2224 ccwthis studyPCR primersCCCCC aagctt ttatcgtcgacgcccacgtgg
Sequence-based reagentvp2224 ccw restore deletionthis studyPCR primersGCCGAAGCTTCTTTTTATTCTCT TTATCGTCGACGCCCACGTG
Sequence-based reagentM13this studyPCR primersTGTAAAACGACGGCCAGTCC
Sequence-based reagentM13rthis studyPCR primersCACACAGGAAACAGCTATGACC
Sequence-based reagentflhF1-flhG1 fwdthis studyPCR primersGCGCTGAGTGTGTTGATCCAAA
Sequence-based reagentEcoRV FliM1 N-term fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCTCATTGAAGATGCTCTCCTG
Sequence-based reagentEcoRV FliM1 N-term revthis studyPCR primersGCCAAGCTTCTCTGCAGGATAATAAAACTGCGGCCCACTTCC
Sequence-based reagentCheck-GFP FliM1-fwdthis studyPCR primersGCAGTTCAGATGAGTCATCCTC
Sequence-based reagentCheck-GFP FliM1 KO-revthis studyPCR primersGACATTTTGGCAGTTGATGCGAC
Sequence-based reagentOL FliM1 GFP revthis studyPCR primersGAAAAGTTCTTCTCCTTTGCTGCTGCCTAATTCAGATATATCTCTAGCTTTGCCTTTGC
Sequence-based reagentOL FliM1 GFP fwdthis studyPCR primersGGATGAGCTCTACAAAGGATCCTAAGGTGAAGCAAGATGAGCACAGAAGATA
Sequence-based reagentEcoRV FlhF C-term fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCAAGAAATGGTTGGACAGCCT
Sequence-based reagentEcoRV FlhF C-term revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCCACATCTAAAAATCGGTCGG
Sequence-based reagentCheck-FlhF-FLAG-fwdthis studyPCR primersGCATCAGTCAATGCAAGCAACC
Sequence-based reagentOL-FlhF-Venus revthis studyPCR primersCACGCTGCCCTCAAATGCACAGGCCATATTATCTG
Sequence-based reagentOL_Venus fwdthis studyPCR primersGCATTTGAGGGCAGCGTGAGCAAGGGCGAGGAGCTGTT
Sequence-based reagentOL_Venus revthis studyPCR primersGTCATAACTTTACTTGTACAGCTCGTCCATGCC
Sequence-based reagentOL-FlhF-Venus fwdthis studyPCR primersTACAAGTAAAGTTATGACCCTGGATCAAGCAAG
Sequence-based reagentFlhF-Ven Seq_Primerthis studyPCR primersGCTGAGTTAGTACGAGCACTAC
Sequence-based reagentFlhG-Ven Seq_Primerthis studyPCR primersCGATATTATTGTCCGTGGGCCT
sequence-based reagentFlhF-Ven Seq_Primer fwdthis studyPCR primersGCTGTTGTAGTTGTACTCCAGC
sequence-based reagentEcoRV FlhF C-term revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCCACATCTAAAAATCGGTCGG
sequence-based reagentEcoRV-2550-GFP-fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCCATCAATAACGGAAAAGGGG
sequence-based reagentOL-2550-GFP-revthis studyPCR primersGAAAAGTTCTTCTCCTTTGCTCAGTTCCAGAATATCTTTACGATGTAACCGGATCAATAATTCAGC
sequence-based reagentOL-2550-GFP-fwdthis studyPCR primersGGATGAGCTCTACAAAGGATCCTAACGAAGTGTAGGGGCTAAGACG
sequence-based reagentEcoRV-2550-GFP-revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCCTTTGTTTATATGCTCGACGG
sequence-based reagentCheck-2550-GFP-fwdthis studyPCR primersCGATGAAGAATGGGCTGAACTC
sequence-based reagentCheck-2550-GFP-revthis studyPCR primersCGAAGGATGCGAGAATGACGAA
sequence-based reagentOL-2069_FlhF-revthis studyPCR primersAATCTTCACTAGCATCCCCGTACATTGAACTC
sequence-based reagentOL-FlhF-Ven-fwdthis studyPCR primersGGGATGCTAGTGAAGATTAAACGATTTTTTGCCAAAGAC
sequence-based reagentOL-FlhF-Ven-revthis studyPCR primersAACATTAGCTTACTTGTACAGCTCGTCCATGC
sequence-based reagentOL-2068-fwdthis studyPCR primersTACAAGTAAGCTAATGTTTTAGGGTCTTACGCG
sequence-based reagentBACTH 2550 pkT25 fwdthis studyPCR primersCAGGGTCGACTCTAGAGGGCGATGAATTTTTGATCGCGG
sequence-based reagentBACTH 2550 pkT25 revthis studyPCR primersTTAGTTACTTAGGTACCCGGGGTTTACGATGTAACCGGATCAATAATTCAGC
sequence-based reagentBACTH 2550 fwdthis studyPCR primersCTGCAGGTCGACTCTAGAGGGCGATGAATTTTTGATCGCGG
Sequence-based reagentBACTH 2550 revthis studyPCR primersGAGCTCGGTACCCGGGGTTTACGATGTAACCGGATCAATAATTCAGC
Sequence-based reagentOL_FliM1 mCh revthis studyPCR primersTTTGTATAACTCATCCATACCA
Sequence-based reagentFlhF-Ven Seq_Primer revthis studyPCR primersGCTGGAGTACAACTACAACAGC
Sequence-based reagentOL-GFP-fwdthis studyPCR primersAGCAAAGGAGAAGAACTTTTC
Sequence-based reagentOL-GFP-revthis studyPCR primersGGATCCTTTGTAGAGCTCATCC
Sequence-based reagentOL -mCherry fwdthis studyPCR primersGTTTCCAAAGGGGAAGAGGACA
Sequence-based reagentpKT25-forthis studyPCR primersCACTGACGGCGGATATCGACATGTT
Sequence-based reagentpKT25-revthis studyPCR primersCCGCCGGACATCAGCGCCATTC
Sequence-based reagentpUT18-forthis studyPCR primersCCAGGCTTTACACTTTATGCTTCC
Sequence-based reagentpUT18-revthis studyPCR primersGACGCGCCTCGGTGCCCACTGC
Sequence-based reagentpKNT25-forthis studyPCR primersCCCAGGCTTTACACTTTATGCTTCC
Sequence-based reagentpKNT25-revthis studyPCR primersGTTTTTTTCCTTCGCCACGGCCTTG
Sequence-based reagentpUT18C-forthis studyPCR primersCGGCGTGCCGAGCGGACGTTCG
Sequence-based reagentpUT18C-revthis studyPCR primersTCAGCGGGTGTTGGCGGGTGTC
Sequence-based reagentFlhF Seq_Primer fwdthis studyPCR primersGCCCACTTTGGATCAACACACT
Sequence-based reagentFlhF Seq_Primer revthis studyPCR primersCGTGCTCACAAAACTCGATGAA
Sequence-based reagentEcoRV FliFG1 KO fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCCGAAAACTTGTGGCTGAAAA
Sequence-based reagentOL- FliFG1 KO revthis studyPCR primersATCGCCACCCCCGACAATCATTTCTGTGCTC
Sequence-based reagentOL- FliFG1 KO fwdthis studyPCR primersATTGTCGGGGGTGGCGATGAGTTCCTCTAAT
Sequence-based reagentEcoRV FliFG1 KO revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCAACCTAATAGTCACTGCTTG
Sequence-based reagentOL-fipA L118A revthis studyPCR primersAGCTTCAGCTTTGGGCGCTTCACA
Sequence-based reagentOL-fipA L118A fwdthis studyPCR primersATAAAAGAGTGTGAAGCGCCCAAA
Sequence-based reagentOL-fipA G106A revthis studyPCR primersTTCATCGACTCCCGCGGCAAGTCC
Sequence-based reagentOL-fipA G106A fwdthis studyPCR primersAAAATGGTCGGACTTGCCGCGGGA
Sequence-based reagentOL-PPfipA G104A revthis studyPCR primersCATCGATACTCGCAGCCATCCC
Sequence-based reagentOL-PPfipA G104A fwdthis studyPCR primersGCTGGTGGGGATGGCTGCGAGT
Sequence-based reagentOL-PPfipA L123A revthis studyPCR primersACACCTTGCTCATCGCCTCCGC
Sequence-based reagentOL-PPfipA L123A fwdthis studyPCR primersGGCCGAGGCGGAGGCGATGAGC
Sequence-based reagentEcoRV-flhF KO-fwdthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCATAGGCGTCGGTGATTGAGG
Sequence-based reagentOL-flhF KO-revthis studyPCR primersTAAGTGAAGGCATTTGAGTAGAGTTATGACCCTGG
Sequence-based reagentOL-flhF KO-fwdthis studyPCR primersCTCAAATGCCTTCACTATGCGTCCTCTACTGG
Sequence-based reagentEcoRV-flhF KO-revthis studyPCR primersGCGAATTCGTGGATCCAGATGCTAAGCATTCTCCTAAGCTTGTTG
Sequence-based reagentOL-fipA L125A revthis studyPCR primersTAACCGGATCAAGGCTTCAGCTTC
Sequence-based reagentOL-fipA L125A fwdthis studyPCR primersGCTGAAGCTGAAGCCTTGATCCGG
Sequence-based reagentEcoRV FlhF sub revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCTCGTCACATACAACGACTAG
Sequence-based reagentBACTH 2550 L125A pkT25 revthis studyPCR primersTTAGTTACTTAGGTACCCGGGGTTTACGATGTAACCGGATCAAGGCTTCAGC
Sequence-based reagentBACTH 2550 L125A revthis studyPCR primersGAGCTCGGTACCCGGGGTTTACGATGTAACCGGATCAAGGCTTCAGC
Sequence-based reagentOL-FipA L125A-GFP-revthis studyPCR primersGAAAAGTTCTTCTCCTTTGCTCAGTTCCAGAATATCTTTACGATGTAACCGGATCAAGGCTTCAGC
Sequence-based reagentBACTH FlhF pkT25 fwdthis studyPCR primersCAGGGTCGACTCTAGAGAAGATTAAACGATTTTTTGCCAAAGACA
Sequence-based reagentBACTH FlhF pkT25 revthis studyPCR primersTTAGTTACTTAGGTACCCGGGGCTCAAATGCACAGGCCATATTATCT
Sequence-based reagentBACTH FlhF fwdthis studyPCR primersCTGCAGGTCGACTCTAGAGAAGATTAAACGATTTTTTGCCAAAGACA
Sequence-based reagentBACTH FlhF revthis studyPCR primersGAGCTCGGTACCCGGGGCTCAAATGCACAGGCCATATTATCT
Sequence-based reagentBACTH FlhF GTG fwdthis studyPCR primersCTGCAGGTCGACTCTAGAGGTGAAGATTAAACGATTTTTTGCCAAAG
Sequence-based reagentEcoRV_FipA KO fwdthis studyPCR primersGCGAATTCGTGGATCCAGATTTTTAGGTATCATTAACTTACGTGGTAATGT
Sequence-based reagentOL-FipA KO revthis studyPCR primersACACTTCGCTATTTACGATGATCGCCCATTAAAAATCCTTATGCA
Sequence-based reagentOL-FipA KO fwdthis studyPCR primersAAGGATTTTTAATGGGCGATCATCGTAAATAGCGAAGTGTAGGG
Sequence-based reagentEcoRV-FipA KO revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGAACTGATCGCCTTTGTTTATATGC
Sequence-based reagentCheck-FipA KO fwdthis studyPCR primersAAGAAATGTCGCAGCCGTAGC
Sequence-based reagentCheck-FipA KO revthis studyPCR primersCCAGTTGCGACAATCTTCGGAG
Sequence-based reagentOL-PPfipA L116A revthis studyPCR primersCATCAACTCCGCCTCGGCCTGGGTCGCGCCGCAGCTCTGGGT
Sequence-based reagentOL-PPfipA L1164A fwdthis studyPCR primersGAGTTGACCCAGAGCTGCGGCGCGACCCAGGCCGAGGCG
Sequence-based reagentCheck-PP_4331 (FipA) fwdthis studyPCR primersGCTTACGAACAGAACGCAAGGC
Sequence-based reagentCheck-PP_4331 (FipA) revthis studyPCR primersGCAATACGTGATTTCGGTGCAG
Sequence-based reagentEcoRV-PP_4331 KO-fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCAGATGCACGCCAAACAGAAA
Sequence-based reagentPP_4331 KO-OL-revthis studyPCR primersTCAAGGAGCTAGGATCAACTCAGATGTTCTCCAGC
Sequence-based reagentPP_4331KO-OL-fwdthis studyPCR primersTTGATCCTAGCTCCTTGACGGGGTACCCTCG
Sequence-based reagentEcoRV-PP_4331 KO-revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCATGAATTGCCTGTACAACACCA
Sequence-based reagentCheck-PP_4331KO-fwdthis studyPCR primersGCGAAACGATCGATCAGGTCGA
Sequence-based reagentCheck-PP_4331KO-revthis studyPCR primersGCACCGTAATCGAACACATGTG
Sequence-based reagentEcoRV-PP_4331-GFP-fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCAGATGCACGCCAAACAGAAA
Sequence-based reagentPP_4331-GFP-OL-revthis studyPCR primersGAAAAGTTCTTCTCCTTTGCTCAGTTCCAGAATATCAGGAGCCCGGTACACCTTGCTC
Sequence-based reagentPP_43310-GFP-OL-fwdthis studyPCR primersGGATGAGCTCTACAAAGGATCCTGACGGGGTACCCTCGGCAGCA
Sequence-based reagentEcoRV-PP_4331-GFP-revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCATGAATTGCCTGTACAACACCA
Sequence-based reagentEcoRV-FlhF-mCh-fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCATGGACAGCTTCCGTATCGG
Sequence-based reagentFlhF-mCh-OL-revthis studyPCR primersCTCTTCCCCTTTGGAAACGCTGCCACCCGCTCGCCGTGGGTTGTGA
Sequence-based reagentFlhF-mCh-OL-fwdthis studyPCR primersATGGATGAGTTATACAAATGACCATGAAGCGTGTGCAAAG
Sequence-based reagentEcoRV-FlhF-mCh-revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCCAACACACGGAAACGGTTCA
Sequence-based reagentCheck-PP_4343 KO-fwdthis studyPCR primersGCCTGAAATCGAGCCGATCGAA
Sequence-based reagentCheck-PP_4343 KO-revthis studyPCR primersGCGTCGGTAATCGAGGTAGGTT
Sequence-based reagentBACTH PP FipA pkT25 fwdthis studyPCR primersCAGGGTCGACTCTAGAGATCCTAGAGGTTGCTGTCATCT
Sequence-based reagentBACTH PP FipA pkT25 revthis studyPCR primersTTAGTTACTTAGGTACCCGGGGAGGAGCCCGGTACACCTTGCTC
Sequence-based reagentBACTH PP FipA fwdthis studyPCR primersCTGCAGGTCGACTCTAGAGATCCTAGAGGTTGCTGTCATCT
Sequence-based reagentBACTH PP FipA revthis studyPCR primersGAGCTCGGTACCCGGGGAGGAGCCCGGTACACCTTGCTC
Sequence-based reagentBACTH PP FlhF pkT25 fwdthis studyPCR primersCAGGGTCGACTCTAGAGCAAGTTAAGCGATTTTTCGCCGC
Sequence-based reagentBACTH PP FlhF pkT25 revthis studyPCR primersTTAGTTACTTAGGTACCCGGGGACCCGCTCGCCGTGGGTTGTGA
Sequence-based reagentBACTH PP FlhF fwdthis studyPCR primersCTGCAGGTCGACTCTAGAGCAAGTTAAGCGATTTTTCGCCGC
Sequence-based reagentBACTH PP FlhF revthis studyPCR primersGAGCTCGGTACCCGGGGACCCGCTCGCCGTGGGTTGTGA
Sequence-based reagentEcoRV FlhF sub fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCATCAGTCAATGCAAGCAACC
Sequence-based reagentCheck-FlhF KI/O-fwdthis studyPCR primersGCCACTGGGTAGTGTCGTAAAA
Sequence-based reagentOL-FlhF D328A revthis studyPCR primersCCCCATACCAGCGGTGGCTATCAATAC
Sequence-based reagentOL-FlhF D328A fwdthis studyPCR primersAAGCTAGTATTGATAGCCACCGCTGGT
Sequence-based reagentEcoRV PPFlhF sub fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCATGTTCTGGCGTATCAGGAA
Sequence-based reagentOL-FlhF K235A revthis studyPCR primersGCGCGCGGCCAGCGCGGCCAGGGT
Sequence-based reagentOL-FlhF K235A fwdthis studyPCR primersGGCAAGACCACCACCCTGGCCGCGCTGGCCGCG
Sequence-based reagentEcoRV PPFlhF sub revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCATGCTACCCATGTCTGTTCT
Sequence-based reagentCheck-PP_4343 KI-fwdthis studyPCR primersGCTACCAGTGATTACCCTGGAG
Sequence-based reagentEcoRV PPFlhF sub 1 revthis studyPCR primersGCCAAGCTTCTCTGCAGGATGCGTCGGTAATCGAGGTAGGTT
Sequence-based reagentKT2440 FlhF Seq primer revthis studyPCR primersGCTGGTGAGCATGGACAGCTTC
Sequence-based reagentEcoRV-FipA dTM fwdthis studyPCR primersGCGAATTCGTGGATCCAGATGCCGTAGCTGCAAGTAAAGATG
Sequence-based reagentOL-FipA dTM revthis studyPCR primersCTGCTTTTGTTCATCGCCCATTAAAAATCCTTATGC
Sequence-based reagentOL-FipA dTM fwdthis studyPCR primersGGCGATGAACAAAAGCAGTTGAGTAAATTACGTAATAAAGTTG
Sequence-based reagentOL-PP_FipA dTM revthis studyPCR primersGCTGTAGTTCTCTAGGAT
CAACTCAGATGTTCTCC
Sequence-based reagentOL-PP_FipA dTM fwdthis studyPCR primersATCCTAGAGAACTACAGCAAGCGCCAGCGCG
Software, algorithmcellProfiles (R package)Cameron et al., 2014; Cameron, 2018https://github.com/ta-cameron/Cell-Profiles
Software, algorithmMicrobeJDucret et al., 2016

Additional files

Supplementary file 1

Supplementary tables.

(a) Enriched proteins in Co-IP FlhF-sfGFP vs. sfGFP. The genes with the largest enrichment in FlhF-sfGFP vs. sfGFP are shown. The corresponding protein designation is indicated if available. (b) Flagellation pattern and presence of FipA and FlhF in bacteria. (c) Bacterial strains used in this study. (d) Plasmids used in this study. (e) Oligonucleotides used in this study.

https://cdn.elifesciences.org/articles/93004/elife-93004-supp1-v1.docx
MDAR checklist
https://cdn.elifesciences.org/articles/93004/elife-93004-mdarchecklist1-v1.docx
Source data 1

Contains the data used for generation of the indicated figure panels.

https://cdn.elifesciences.org/articles/93004/elife-93004-data1-v1.xlsx

Download links

A two-part list of links to download the article, or parts of the article, in various formats.

Downloads (link to download the article as PDF)

Open citations (links to open the citations from this article in various online reference manager services)

Cite this article (links to download the citations from this article in formats compatible with various reference manager tools)

  1. Erick E Arroyo-Pérez
  2. John C Hook
  3. Alejandra Alvarado
  4. Stephan Wimmi
  5. Timo Glatter
  6. Kai Thormann
  7. Simon Ringgaard
(2024)
A conserved cell-pole determinant organizes proper polar flagellum formation
eLife 13:RP93004.
https://doi.org/10.7554/eLife.93004.3