2-oxoglutarate triggers assembly of active dodecameric Methanosarcina mazei glutamine synthetase
eLife Assessment
This study reveals a novel mechanism of glutamine synthetase (GS) regulation in Methanosarcina mazei, demonstrating that 2-oxoglutarate (2-OG) directly promotes GS activity by stabilizing its dodecameric assembly. Using mass photometry, activity assays, and cryo-electron microscopy, the authors show that GS transitions from a dimeric, inactive form at low 2-OG concentrations to a fully active dodecameric complex at saturating 2-OG levels, highlighting 2-OG as a key effector in C/N sensing. The findings are valuable, supported by solid data, and provide new insights into archaeal GS regulation, though further clarification of interactions with known partners like Glnk1 and sp26 is needed.
https://doi.org/10.7554/eLife.97484.3.sa0Valuable: Findings that have theoretical or practical implications for a subfield
- Landmark
- Fundamental
- Important
- Valuable
- Useful
Solid: Methods, data and analyses broadly support the claims with only minor weaknesses
- Exceptional
- Compelling
- Convincing
- Solid
- Incomplete
- Inadequate
During the peer-review process the editor and reviewers write an eLife Assessment that summarises the significance of the findings reported in the article (on a scale ranging from landmark to useful) and the strength of the evidence (on a scale ranging from exceptional to inadequate). Learn more about eLife Assessments
Abstract
Glutamine synthetases (GS) are central enzymes essential for the nitrogen metabolism across all domains of life. Consequently, they have been extensively studied for more than half a century. Based on the ATP-dependent ammonium assimilation generating glutamine, GS expression and activity are strictly regulated in all organisms. In the methanogenic archaeon Methanosarcina mazei, it has been shown that the metabolite 2-oxoglutarate (2-OG) directly induces the GS activity. Besides, modulation of the activity by interaction with small proteins (GlnK1 and sP26) has been reported. Here, we show that the strong activation of M. mazei GS (GlnA1) by 2-OG is based on the 2-OG dependent dodecamer assembly of GlnA1 by using mass photometry (MP) and single particle cryo-electron microscopy (cryo-EM) analysis of purified strep-tagged GlnA1. The dodecamer assembly from dimers occurred without any detectable intermediate oligomeric state and was not affected in the presence of GlnK1. The 2.39 Å cryo-EM structure of the dodecameric complex in the presence of 12.5 mM 2-OG demonstrated that 2-OG is binding between two monomers. Thereby, 2-OG appears to induce the dodecameric assembly in a cooperative way. Furthermore, the active site is primed by an allosteric interaction cascade caused by 2-OG-binding towards an adaption of an open active state conformation. In the presence of additional glutamine, strong feedback inhibition of GS activity was observed. Since glutamine dependent disassembly of the dodecamer was excluded by MP, feedback inhibition most likely relies on the binding of glutamine to the catalytic site. Based on our findings, we propose that under nitrogen limitation the induction of M. mazei GS into a catalytically active dodecamer is not affected by GlnK1 and crucially depends on the presence of 2-OG.
Introduction
Nitrogen is one of the key elements in life and it is essentially required in the form of ammonium for biomolecules such as proteins or nucleic acids. Two major pathways of ammonium assimilation in bacteria and archaea are known. Under nitrogen (N) sufficiency, glutamate dehydrogenase (GDH) is active and generates glutamate from 2-OG and ammonium (reviewed in van Heeswijk et al., 2013). Under N limitation however, low ammonium concentrations lead to an inactive GDH as a result of its low ammonium affinity, whereas the expression of GS is strongly induced in response to N limitation (Bolay et al., 2018; Gunka and Commichau, 2012; Stadtman, 2001). Consequently, under low ammonium conditions, GS together with glutamate synthase (GOGAT) are responsible for ammonium assimilation via the GS/GOGAT pathway, one of the major intersections in central carbon and N metabolism. Accordingly, GS present across all domains of life plays a central role in cellular N assimilation under low N availability. The enzyme, its structure, and regulation have been investigated in detail in different organisms for more than half a century (e.g. dos Santos Moreira et al., 2019; Stadtman, 2001; Woolfolk and Stadtman, 1967).
Most of the GS are grouped into three major classes based on their monomeric size and oligomerization properties (overview in dos Santos Moreira et al., 2019). GSI and GSIII, both found in bacteria and archaea, mostly form dodecamers, whereas GSII found in Eukaryotes form decamers of smaller subunits (dos Santos Moreira et al., 2019; He et al., 2009; Valentine et al., 1968; van Rooyen et al., 2011). The GSI class can be further grouped into Iα-type GS and Iβ-type GS based on their amino acid sequence and respective molecular mechanisms of activity regulation. Iß-type GS contain a conserved adenylylation site (Tyr397 residue near the active site), that allows for covalent modification of Iβ-type GS and leads to inactivation of the enzyme (Brown et al., 1994; Magasanik, 1993; Shapiro and Stadtman, 1970). Iα-type GS on the other hand are not covalently modified and mainly show feedback inhibition by end products of the glutamine metabolism, including glutamine (Fisher, 1999; Gunka and Commichau, 2012).
GS regulation on transcriptional level
Since in contrast to GDH, GS-catalyzed generation of glutamine requires ATP, most organisms strictly regulate the expression of GS in response to the nitrogen availability on the transcriptional level. In gram-negative bacteria, mainly transcriptional activation of the coding gene (glnA) under low nitrogen availability occurs via a transcriptional activator (e.g. NtrC in Escherichia coli Jiang et al., 1998). For several gram-positive bacteria however, the mechanism of regulation is a de-repression of glnA transcription under N limitation, which has also been shown for methanoarchaea (Cohen-Kupiec et al., 1999; Fedorova et al., 2013; Fisher, 1999; Fisher and Wray, 2008; Hauf et al., 2016; Weidenbach et al., 2010; Weidenbach et al., 2008). Whereas in gram positives the signal perception is complex and often also involves protein interactions of GS with transcriptional regulators (reviewed in Gunka and Commichau, 2012), signal perception and transduction in methanoarchaea occurs directly via the small effector molecule 2-OG, which increases under N limitation. It has been shown that binding of 2-OG to the global N repressor protein NrpR significantly changes the repressor conformation resulting in dissociation from its respective operator (Lie et al., 2007; Weidenbach et al., 2010; Wisedchaisri et al., 2010). In addition to expression regulation, the activity of GS is also strictly regulated in all organisms in response to changing N availabilities, however, the underlying molecular mechanism(s) of inhibition significantly differ for the various GS classes and in various organisms (Reitzer, 2003).
Regulation of GS activity: Highly diverse and often complex in various organisms
An extensive repertoire of cellular control mechanisms regulating GS activity in response to N availability has been observed in different organisms. Inhibitory mechanisms in response to an N upshift range from feedback inhibition by e.g. glutamine or other end products of the glutamine metabolism (e.g. E. coli (Stadtman, 2004), Bacillus subtilis (Deuel et al., 1970), yeast Legrain et al., 1982), proteolytic degradation (yeast, Legrain et al., 1982), covalent modification by adenylylation of the 1ß-type GS subunits (e.g. enterobacteriaceae), thiol-based GS regulation (e.g. in soybean nodules Masalkar and Roberts, 2015), inhibition by regulatory proteins (e.g. in gram-positive bacteria Travis et al., 2022), inhibition by interactions with small proteins (e.g. inhibitory factors in cyanobacteria García-Domínguez et al., 1999; Klähn et al., 2015, Klähn et al., 2018), to directly effecting the activity through the presence or absence of the small metabolite 2-OG, which has been shown for the first time for Methanosarcina mazei (Ehlers et al., 2005). Moreover, often several of the different regulatory mechanisms for GS activity are reported for one organism. For example, yeast GS (ScGS) is regulated via feedback inhibition by glutamine and additionally is susceptible to proteolytic degradation under N starvation. It was also found to assemble into nanotubes (He et al., 2009) and under advanced cellular starvation into inactive filaments (Petrovska et al., 2014). In E. coli, the activity of the Iß-type GS (EcGS) is controlled by cumulative feedback inhibition and covalent modification (reviewed in Reitzer, 2003). It has been shown that each of the 12 subunits can be modified by adenylylation (Tyr397) resulting in an inactivation of the respective subunit (Stadtman, 1990). Moreover, the adenlylylation of single subunits makes the other subunits more susceptible to cumulative feedback inhibition by various substances (Stadtman, 1990). These substances either bind the glutamine-binding pocket or have an allosteric binding site (Liaw et al., 1993; Woolfolk and Stadtman, 1967). The dodecameric structure of EcGS has been known for a long time (Almassy et al., 1986; Yamashita et al., 1989). However, when artificially exposed to divalent cations (Mn2+, Co2+), it randomly aggregates and produces long hexagonal tubes (paracrystalline aggregates) (Valentine et al., 1968). The detailed structural information on the mechanisms of this reversible GS-filament formation to an inactive form of EcGS, often associated with stress responses, has only recently been described by cryo-electron microscopy (cryo-EM) analysis (Huang et al., 2022). The B. subtilis GS has been shown to be feedback regulated. In addition, binding of the transcriptional repressor GlnR to the feedback inhibited complex not only activates the transcription repression function of GlnR (Fisher and Wray, 2008), but also stabilizes the inactive GS conformation potentially changing from a dodecamer into a tetradecameric structure (Travis et al., 2022).
In M. mazei, a mesophilic methanoarchaeon which is able to fix N2, regulation of the central N metabolism has been studied extensively on the transcriptional and post-transcriptional level (Jäger et al., 2009; Prasse and Schmitz, 2018; Veit et al., 2005). A central role of 2-OG for the perception of changes in N availabilities has been proposed, as has been demonstrated for cyanobacteria (Forchhammer, 1999; Herrero et al., 2001). The activity of M. mazei GS, encoded by glnA1, is regulated by several different mechanisms. GlnA1 is not covalently modified in response to N availability and thus represents an Iα-type-GS (Ehlers et al., 2005). It has been proposed, that GlnA1 is directly activated under N starvation by the high intracellular concentrations of the metabolite 2-OG (Ehlers et al., 2005). 2-OG represents the internal signal for N limitation, since the internal 2-OG level significantly increases due to missing consumption by GDH under N starvation (M. mazei contains the oxidative TCA part, anabolic). The increased cellular 2-OG concentration has been shown to be directly perceived by GlnA1, most likely by direct binding resulting in strong activation (Ehlers et al., 2005). Besides, we showed first evidence that two small proteins interact with M. mazei GlnA1, the PII-like protein GlnK1 and small protein sP26 comprising 23 amino acids (Ehlers et al., 2005; Gutt et al., 2021). The presence and potential interaction of both small proteins showed small effects on the GlnA1 activity. However, those small effects might be neglectable compared to the strong 2-OG stimulation, particularly taking into account that the indirect GS activity assay shows high deviations in the low activity range. Moreover, initial complex formation analysis by a pull-down approach indicated that in the absence of 2-OG, the GlnA1/GlnK1 complexes are more stable than in the presence of high 2-OG. This led to the conclusion that due to the shift to N sufficiency after a period of N limitation, GlnA1 activity is reduced due to the lower 2-OG concentration, but also due to a potential inhibitory protein interaction with GlnK1 (Ehlers et al., 2005). Very recently, the first structural analysis of M. mazei GlnA1 was reported, showing GS complexes with GlnK1 (Schumacher et al., 2023). Based on their findings, Schumacher et al. propose a regulation of GlnA1 activity by oligomeric modulation, with GlnK1 stabilizing the dodecameric structure and the formation of GlnA1 active sites. Since that work is entirely missing the effects of 2-OG on GlnA1 structure and activity, we here aimed to study the regulation of M. mazei GlnA1 in more detail by evaluating oligomerization and complex formation between GlnA1, GlnK1 and sP26 in dependence of 2-OG. This was achieved by employing mass photometry (MP), allowing the measurement of the molecular weight distribution of single complexes in solution, and by high resolution cryo-EM, whilst also performing activity assays.
Results
2-OG is responsible for GlnA1-dodecamer formation in M. mazei
The strep-tagged purified GlnA1 was analyzed by size exclusion chromatography (SEC) in the presence of 12.5 mM 2-OG, demonstrating that GS is exclusively present in a dodecameric structure, no other oligomers were detectable (Figure 1—figure supplement 2). To investigate the effects of 2-OG on M. mazei GlnA1 in more detail, we employed MP, a method that allows to measure the molecular weight distribution of particles in solution. Strep-tagged purified GlnA1 (after SEC) was dialyzed into a 2-OG free HEPES buffer (see Materials and Methods) and subsequently analyzed by MP, demonstrating that in the presence of low 2-OG concentrations (0.1 mM) all of the M. mazei GlnA1 was nearly exclusively present as dimers with no higher molecular weight complexes present. After the addition of 12.5 mM 2-OG, the size distribution shifted towards a higher molecular weight complex of 630–700 kDa (calculated based on the measured dimer size in each measurement; expected molecular weight of dodecamer: 634 kDa) (Figure 1A and B). This molecular weight corresponds to a fully assembled dodecamer species, the same oligomeric structure that is adapted in GS from other prokaryotes. Using 2-OG concentrations varying between 0.1 and 12.5 mM, complex analysis showed that up to 62% of all particles were assembled in a dodecamer. This allowed to determine the effective concentration of 2-OG for dodecamer assembly to be EC50=0.75 ± 0.01 mM 2-OG (based on two biological replicates, calculated with the percentage of dodecamer) as described in Materials and Methods, and further verified that no other intermediate oligomeric complexes were detectable during dodecameric assembly (Figure 1A, Figure 1—figure supplement 1A, B). Notably, GlnA1 did not reach 100% dodecamer assembly after removal and re-addition of 2-OG, although only dodecameric GlnA1 was used for dialysis (Figure 1—figure supplement 2B, C). We conclude that GlnA1 is rather unstable in the absence of 2-OG and some of the protein lost its ability to oligomerize after 2-OG was removed by dialysis.
GlnA1-dodecamer assembly is induced by 2-oxoglutarate (2-OG) without detectable oligomeric intermediates.
Oligomerization states of purified strep-tagged GlnA1 were assessed in dependence of 2-OG by mass photometry as described in MM using a Refeyn TwoMP mass photometer (Refeyn Ltd., Oxford, UK). Mass spectra are shown with relative counts (number of counts per peak in relation to the total number of counts) plotted against the molecular weight. (A) 75 nM GlnA1 were preincubated in the presence of varying 2-OG concentrations (0–25 mM) for ten min at room temperature and kept on ice until measurement. The percentage of monomer (▲), dimer (◼), and dodecamer (●) considering the total number of counts was plotted against the 2-OG concentration. One out of two independent biological replicates with each of three technical replicates is shown exemplarily and the EC50 for dodecamer assembly is indicated in green. Monomer and dimer-peaks were difficult to distinguish in the measurements for 0.39 and 0.78 mM 2-OG and the values are, therefore, shown without standard deviation and in white. (B) Exemplary mass spectra of GlnA1 oligomers in the presence of 0.1 and 12.5 mM 2-OG. The molecular masses shown above the peaks correspond to a Gaussian fit of the respective peak (Gaussian fit not shown). (C) Mass spectra of the three technical replicates (different green colors) of GlnA1-oligomers at 0.39, 0.78, and 1.56 mM 2-OG, excluding the presence of intermediates. (D) The specific activity of purified strep-tagged GlnA1 was determined as described in MM in the presence of varying 2-OG concentrations (0, 0.78, 1.56, 3.13, 6.25, 12.5, 25, and 47 mM). The EC50 for GlnA1-activity is shown in green and the standard deviation of four technical replicates is depicted.
Furthermore, 2-OG did not only cause dodecamer assembly but also higher enzyme activity. Activity measurements of Strep-GlnA1 in the presence of increasing 2-OG concentrations showed a strong increase from 0.0 U/mg in the absence of 2-OG up to 7.8 ± 1.7 U/mg in the presence of 12.5 mM 2-OG (six independent protein purifications). The EC50 for GlnA1 activity was determined to be 6.3 mM 2-OG (Figure 1D). Thus, we conclude that 2-OG first acts as a trigger for dodecameric assembly of M. mazei GlnA1 (with an EC50=0.75 mM 2-OG), setting it apart from other bacterial and eukaryotic enzyme variants. Moreover, most likely in addition to the dodecameric assembly, 2-OG is required for a further 2-OG-induced conformational switch of the active site, since saturated GlnA1 activities are not reached in the presence of 5 mM 2-OG, when most of the GlnA1 is in a dodecameric structure. For full activity, the presence of at least 12.5 mM 2-OG is required (EC50=6.3 mM 2-OG).
GlnK1 has no detectable effects on GS dodecamer assembly or activity under the tested conditions
Previous studies have shown protein interactions between M. mazei GlnA1 and GlnK1 as well as GlnK1 induced effects on GlnA1 activity (ratio GlnA1:GlnK1 1:1, (Ehlers et al., 2005) and 2:1.4 (Gutt et al., 2021) in activity assays). Consequently, we next tested the effects of GlnK1 on GlnA1 oligomerization in the presence of 2-OG. Performing the MP analysis under the tested conditions as before but in the presence of purified GlnK1, demonstrated that (i) in the absence of 2-OG varying ratios between GlnA1 and GlnK1 (20:1, 2:1, 2:10 calculated based on monomer mass) did not result in any dodecamer assembly of GlnA1 (Figure 2A and B), (ii) no difference in the GlnA1 dodecameric assembly in the presence of 2-OG was obtained in the presence of purified GlnK1 (ratio 2:1), (iii) nor was binding of GlnK1 to GlnA1 detected by a respective increase in the mass of the higher oligomeric complex (Figure 2B and C). Moreover, the presence of GlnK1 (ratio 2:1) neither had an influence on the 2-OG affinity (EC50 (- GlnK1)=1.06 mM 2-OG; EC50 (+ GlnK1)=1.02 mM 2-OG, EC50 calculated based on the dodecamer/dimer ratio), nor in any ratio on the specific activity of GlnA1 (Figure 2D and E: exemplarily showing 2:1; Figure 1—figure supplement 1C, D). Consequently, we conclude that under the conditions tested using purified proteins, GlnA1 dodecamer assembly occurs independently of GlnK1 and no binding of GlnK1 to the dodecameric GlnA1 occurs. However, we cannot exclude that cellular components/metabolites not present in these experiments are crucial for a GlnA1-GlnK1 interaction.
GlnA1-dodecamer assembly and activity are not influenced by GlnK1 under the conditions tested.
Purified strep-tagged GlnA1 and tag-less GlnK1 were incubated in the absence or presence of 2-oxoglutarate (2-OG) in varying concentrations for 10 min at RT. Oligomerization states were assessed by mass photometry. Mass spectra are shown with relative counts (see Figure 1). (A) The obtained ratio of GlnA1 dodecamer/dimer of three technical replicates are shown for varying ratios between GlnA1 and GlnK1 (20:1, 2:1, 2:10, ratios relating to monomers) in the absence of 2-OG. (B, C) Exemplary mass spectra of GlnA1 incubated in the absence and presence of GlnK1 (2:1) at 2-OG concentrations of 0 mM (B) and 12.5 mM (C). The molecular masses shown above the peaks correspond to a Gaussian fit of the respective peak (Gaussian fit not shown). (D) 200 nM GlnA1 (molarity calculated based on molecular mass of monomers) were preincubated with GlnK1 (in a 2:1 ratio) in the presence of varying 2-OG concentrations (0.19–12.5 mM) for ten min at RT. One biological replicate with three technical replicates was performed. The ratio of GlnA1 dodecamer/dimer was plotted against the 2-OG concentration and the EC50 is indicated in green (
, - GlnK1) and yellow (
, + GlnK1). (E) The specific activity of purified strep-tagged GlnA1 in the absence and presence of GlnK1 (ratio 2:1) was determined as described in MM in the presence of varying 2-OG concentrations (0, 0.78, 6.25, and 12.5 mM). The standard deviations of four technical replicates of one biological replicate are indicated.
Structural basis of oligomer formation by 2-OG
To now unravel the structural mechanism underlying M. mazei GlnA1 activation by 2-OG, we employed cryo-EM and single-particle analysis. Treating freshly purified Strep-GlnA1 with 12.5 mM 2-OG, effectively shifted the equilibrium towards fully assembled homo-oligomers as depicted in the MP experiments (Figure 1—figure supplement 2C). In the micrographs, fully assembled ring-shaped particles are visible. However, initial attempts to obtain a 3D reconstruction were hindered by the pronounced preferred orientation of particles within the ice, a challenge which has been overcome by introducing low concentrations of CHAPSO (0.7 mM). In our final dataset, all particles exhibited well-distributed oligomers in diverse orientations. Leveraging this dataset, we aligned the particles to a 2.39 Å resolution structure, revealing well-resolved side chains that facilitated seamless model building (Figure 3, Figure 3—figure supplement 1, Supplementary file 2). Consequently, we achieved a structure demonstrating excellent geometry and density fitting.
Structure of M.Mazei GlnA1 with 2-oxoglutarate (2-OG).
(A) Three-dimensional segmented cryo-electron microscopy (cryo-EM) density of the dodecameric complex colored by subunits. (B) Corresponding views of the GlnA1 atomic model in cartoon representation.
The detailed structural analysis uncovered that GlnA1 assembles into a dodecamer characterized by stacked hexamer rings. A single GlnA1 protomer is composed of 15 β-strands and 15 α-helices and is split into a larger C-domain and an N-domain by helix α3. The dodecameric arrangement is achieved through two distinct interfaces, the hexamer interfaces and inter-hexamer interfaces. Hexamer interfaces are situated between subunits within each ring, while inter-hexamer interfaces occur between subunits derived from adjacent rings (Figure 4A, B and C). The structures are highly similar to Gram-positive bacterial GS structures (PDB: 4lnn, Murray et al., 2013), with root mean squared deviations (rmsds) of 0.5–1.0 Å.
Hexameric interface, inter-hexameric interface, and 2-oxoglutarate (2-OG) binding site of dodecameric GlnA1.
(A) Surface representation of the M. mazei GlnA1 2-OG dodecamer with three GlnA1 protomers fitted in cartoon representation into the dodecamer as dimers of inter-hexameric (blue and ochre) and hexameric (blue and green) GlnA1. (B) Horizontal dimers and close-up of 2-OG binding site. Important residues are shown as atomic stick representation, primed labels indicate neighboring protomer. 2-OG and water molecules important for ligand binding fitted into density are shown in gray. Dotted lines represent polar interactions between 2-OG, waters, and residues. (C) Vertical dimers and close-up of dimerization site. C-terminal helices H14/15 and H14’/ H15’ of two neighboring protomers lead to tight interaction, mediated by hydrophobic and polar interactions. (D) Top-view of GlnA1 hexamer, 2-OG, and substrate binding sites are depicted for one horizontal dimer.
A closer inspection of the density reveals the density for the bound 2-OG at an allosteric site localized at the interface between two GlnA1 protomers in vicinity of the GlnA1 catalytic site (Figure 4B and D). Several residues are contributing to its binding. R172’ and S189’ coordinate the γ-Carboxy-group. Additionally, two tightly bound water molecules are detectable in the binding site. One is interacting with the γ-Carboxy group, while being stabilized by another water that is coordinated by S38 and R26. Latter arginine is coordinating the α-Keto-group and, together with R87 and R173’, the α-Carboxy group of 2-OG (Figure 4B). Notably, F24 stabilizes the 2-OG via stacking with its phenyl ring (Figure 5). This binding contribution from two GlnA1 protomers at the intersubunit junction enhances activation by boosting readiness and the rate of full complex assembly. It operates akin to molecular glue that facilitate the observed cooperative assembly.
Comparison of 2-oxoglutarate (2-OG) and substrate binding site of 2-OG bound, apo, and transition state (TS) structures (.Schumacher et al., 2023).
Atomic models in cartoon, important residues shown in stick representation. Colors: M. mazei GlnA1 2-OG - blue/green, M. mazei GlnA1 apo (PDB: 8tfb, Schumacher et al., 2023) - purple/ochre and M. mazei GlnA1 Met-Sox-P·ADP (PDB: 8tfk, Schumacher et al., 2023) transition state (GlnA1 TS) - red/yellow. (A) left: GlnA1 2-OG dimer in superposition with GlnA1 apo showing large-scale movements upon 2-OG binding. (A) right: Close-up of 2-OG binding site of GlnA1 2-OG in superposition with GlnA1 apo. Dramatic movement of Helix α3 (residue 167–181) and R87 loop show effect of 2-OG binding. (B) Close-up of substrate binding site of GlnA1 2-OG in superposition with GlnA1 apo and ADP ligand from GlnA1 TS. Helix α3 movement upon 2-OG binding leads to a cascade of conformational changes of the phenylalanines F184, F202, and F204 that lead to a priming of the active site for ATP binding. (C) Close-up of substrate binding site of GlnA1 2-OG in superposition with GlnA1 TS shows high similarity between 2-OG bound and transition state structure. (D) Close-up of substrate binding site of GlnA1 2-OG in superposition with GlnA1 apo and Met-Sox-P ligand from GlnA1 TS. Large structural changes of the D50-loop with ejection of the R66 key-residue are shown. Flipping of the loop allows R319 and D57 to move in further and catalyze phosphoryl-transfer and attack of NH4+, respectively. (E) Close-up of the substrate binding site of GlnA1 2-OG in superposition with GlnA1 TS reveals a strong similarity between 2-OG bound and transition state structure in the active site.
A comparison with the substrate-bound GlnA1 structure (PDB: 8tfk, Schumacher et al., 2023) revealed that the catalytically important residues in M. mazei are the aspartic acid (D57), that abstracts the proton from ammonium, and the catalytic glutamic acid, Glu307. The active site of M. mazei GlnA1 is formed at the interface between two subunits in the hexamer and formed by five key catalytic elements surrounding the active site: the E flap (residues 303–310), the Y loop (residues 369–377), the N loop (residues 235–247), the Y* loop (residues 152–161) and the D50'́ loop (residues 56–71). The latter one is the only one that originates from adjacent neighboring protomer (Figure 5C and E).
Superposition of our structure with the apo-M. mazei structure (PDB: 8tfb, Schumacher et al., 2023) reveals that 2-OG binding also triggers further movements that lead to structural changes in the substrate binding pocket (Figure 5A, B and D). R87' and its loop undergo a dramatic flip to coordinate 2-OG and D170 of helix α3 (residues 167–181) (Figure 5A). This, combined with the action of other coordinating residues, initiates a motion that is propagated through the entire protein. Notably, helix α3 shifts forward, causing F184 to flip over and facilitate a T-shaped aromatic interaction with F202. The resulting pull on F202 causes F204 to flip, allowing π-stacking with the purine moiety of ATP (Figure 5B). This series of structural changes primes the active site for ATP binding by already adopting the side chain conformations that are observed in analog (Met-Sox-P-ADP)-bound structure (transition state) (PDB: 8tfk, Schumacher et al., 2023), thus facilitating nucleotide binding (Figure 5C and E).
Additionally, the D50' loop adopts a position similar to the transition state in a catalytic competent conformation. This involved a remodeling of the loop, leading to the positioning of key catalytic residues in a catalytic competent configuration. Compared to the apo structure (Schumacher et al., 2023), R66 flips out of the catalytic pocket, now accommodating R319 which participates in phosphoryl transfer catalysis (Liaw and Eisenberg, 1994; Figure 5D). In addition, Asp 57' moves deeper into the binding site, facilitating the proton abstraction of NH4+ and preparing for its attack on the phosphorylated glutamate. Similar to the ATP/ADP binding site, these catalytic elements are primed to ideally stabilize the tetrahedral open active state. This is illustrated by the superposition of the inhibitor-bound, transition-state locked structure (Schumacher et al., 2023; Figure 5C and E).
Feedback inhibition by glutamine does not affect the dodecameric M. mazei GlnA1 structure
For bacteria it is known, that GS can be feedback-inhibited. Very recently, the first feedback inhibition of an archaeal GS by glutamine has been reported for Methermicoccus shengliensis GS (Müller et al., 2024). The specific arginine residue identified to be relevant for the feedback inhibition is R66. Consequently, we generated the respective M. mazei GlnA1 mutant protein changing the conserved arginine to alanine (R66A) (see also Figure 5D and E) and compared the purified strep-tagged mutant protein with the wildtype (wt) protein. In the presence of 12.5 mM 2-OG, the mutant protein showed the same specific activity as obtained for the wt. However, when supplementing 5 mM glutamine, exclusively the wt was strongly feedback inhibited, whereas the R66A mutant protein was not significantly affected (Figure 6A). In B. subtilis, R62 is responsible for feedback inhibition. The superposition of the apo-BsGS structure (PDB: 4lnn, Murray et al., 2013) with our 2-OG-bound GlnA1 reveals a similar positioning of the respective M. mazei R66 (Figure 6B) indicating a similar mechanism. Moreover, we can rule out an effect on the oligomeric structure of GlnA1 by MP analysis, clearly showing that glutamine does not induce disassembly of the dodecameric wt GlnA1 (Figure 6C). Instead, this effect can be explained with the role of R66 being an important residue to bind to glutamine in the product state of the enzyme.
Feedback inhibition of GlnA1 by glutamine.
(A) Specific activity of purified strep-tagged GlnA1 (wt) and the respective R66A-mutant protein was determined as described in Materials and methods in the presence of 12.5 mM 2-oxoglutarate (2-OG) and after additional supplementation of 5 mM glutamine. For wt and the R66A-mutant, one out of two biological independent replicates are exemplarily shown, the deviation indicates the average of four technical replicates. (B) Superposition glutamine synthetases (GS) structures without glutamine of M. mazei (blue, green) and B. subtilis (orange, pink; PDB: 4lnn, Murray et al., 2013): substrate binding-site including R’66 (R’62, respectively), which are responsible for feedback inhibition. (C) Exemplary mass spectra of Strep-GlnA1 with 12.5 mM 2-OG in presence and absence of 5 mM glutamine. The molecular masses shown above the peaks correspond to a Gaussian fit of the respective peak (Gaussian fit not shown).
Discussion
2-OG is crucially required for M. mazei GS assembly to an active dodecamer and induces the conformational shift towards an active open state
In M. mazei, increased 2-OG concentrations act as a central N starvation signal (Ehlers et al., 2005). Here, we demonstrated the importance of 2-OG as the major regulator of M. mazei GlnA1 activity by using independent methods, MP and cryo-EM, to detect and structurally characterize single complexes with high resolution and quantify different oligomeric states of GlnA1. We have found mainly dimeric GlnA1 (apo GlnA1) to be inactive and crucially require 2-OG to form an active dodecameric complex. Moreover, this dodecameric conformation is the only active state of GlnA1. In the first step, 2-OG assembles the dodecamer by binding at the interface of two subunits (Figure 4B) and functions as a molecular glue between neighboring subunits. The assembly upon 2-OG addition observed using MP appears to be cooperative, fast, and without any detectable intermediate states (Figure 1B and C). Only immediately after thawing a frozen purified GlnA, and in case no additional SEC was performed prior to MP analysis, samples showed additional octameric complexes in MP with low abundancy (Figure 1—figure supplement 3). However, octameric complexes were never observed in cryo-EM or detected by SEC analysis of frozen purified GlnA1 samples. Consequently, octamers are most likely broken or disassembled GlnA1-dodecamers or dead-ends in assembly with no physiological function, rather than an incomplete dodecamer during assembly. Thus, our findings are contrary to the assembly model proposed by Schumacher et al., 2023.
As a second step of activation, the allosteric binding of 2-OG causes a series of conformational changes in GlnA1 protomers, which prime the active site for the transition state and hence catalysis of the enzyme. This conformational change of the ATP-binding pocket of the dodecameric GlnA1 upon 2-OG binding goes hand in hand with the observed increased activity at higher 2-OG concentrations (Figure 1). Comparing our 2-OG-bound GlnA1 dodecameric structure and the dodecameric M. mazei GlnA1 transition state (PDB: 8tfk) and apo structures (PDB: 8ftb) reported by Schumacher et al., 2023, clearly demonstrates that 2-OG transfers GlnA1 into its open active state conformation (Figure 5). The conformation of our 2-OG-bound dodecamer resembled the transition state conformation (ADP-Met-Sox-bound complex) reported by Schumacher et al., even though in our case no ATP was added (Figure 5E). A reconfiguration of the active site upon 2-OG-binding has also been reported for GS in Methanothermococcus thermolithotrophicus (Müller et al., 2024). In this report, which does not delineate dodecamer assembly at all, it was demonstrated that binding of 2-OG in one protomer-protomer interface of a dodecameric GS causes a cooperative domino effect in the hexameric ring of M. thermolithotrophicus GS (Müller et al., 2024). A 2-OG bound protomer undergoes a conformational change and thereby induces the same shift in its neighboring protomer (Müller et al., 2024). This is comparable to our observed cooperativity of M. mazei dodecamer assembly at low 2-OG concentrations (EC50=0.75 mM, calculated based on the percentage of dodecamer). On the other hand, M. mazei GlnA1 reaches maximal activity only at much higher 2-OG concentrations (EC50=6.3 mM 2-OG) and likely requires a fully 2-OG-occupied dodecamer for maximal activity. The difference between the two EC50 values strongly points towards the dodecamer assembly being induced by only one 2-OG per hexameric ring, whilst the maximum activity requires one 2-OG in every 2-OG binding site (in agreement with roughly sixfold higher EC50). The here obtained high activities by 2-OG saturation (up to 9 U/mg), in comparison with previously described M. mazei GlnA1 activities in the absence of 2-OG in a significantly lower range (mU/mg) (Gutt et al., 2021; Schumacher et al., 2023), support our conclusion that 2-OG is substantial for the GlnA1 active state.
GlnA1 activity is further regulated by feedback inhibition, small proteins, and possibly filament formation
M. mazei GlnA1 belongs to the group of Iα-type GS, which are known to be feedback inhibited. We confirmed a strong feedback inhibition by a genetic approach and validated R66 to be the key residue for this inhibition (Figure 6) as suggested in Müller et al., 2024. The mechanism of feedback inhibition has been described in detail for B. subtilis GS (Murray et al., 2013). There, R62 plays the central role by binding glutamine and inducing a well-ordered inactive structure at the substrate-binding pocket upon glutamine-binding (Murray et al., 2013). The homologous M. mazei R66 likely conveys a similar way of inhibition to B. subtilis GS (Figure 6B, Figure 7—figure supplement 1).
Further regulations by the two small proteins sP26 and the PII-like protein GlnK1 have previously been reported for M. mazei (Ehlers et al., 2005; Gutt et al., 2021; Schumacher et al., 2023). Moreover, in previous reports, GlnK1 was shown to interact with GlnA1 in vivo after a nitrogen upshift by pull-down approaches (Ehlers et al., 2005), pointing towards an inhibitory function of GlnK1 under shifting conditions from N limitation to N sufficiency. However, in the present study, neither an interaction with GlnK1, nor GlnK1 effects on GlnA1 complex formation analyzed by MP, nor an effect of GlnK1 on GlnA1 activity was detectable under the conditions used at varying 2-OG concentrations (0.1–12.5 mM) and ratios of GlnK1 to GlnA1 (20:1, 2:1, 2:10) (Figure 2). Moreover, the addition of GlnK1 did not result in a change of the EC50 of 2-OG for the dodecamer GlnA1 assembly (Figure 2D). Similarly, we could not determine a cryo-EM structure including sP26 despite adding a large excess of the small protein either obtained by co-expression or by addition of a synthetic peptide. Because these attempts were unsuccessful, we speculate that yet unknown cellular factor(s) might be required for an interaction of GlnA1 with both small proteins, GlnK1 and sP26, which however is difficult to simulate under in vitro conditions with purified proteins. Taking this into account, we speculate about a potential function of the two small proteins beyond GlnA1 inactivation or activation. Since the GlnA1 reaction is coupled to the GOGAT reaction (GS/GOGAT system) and the products of the two reactions replenish the substrates for one other, it is tempting to speculate that GlnA1 and GOGAT experience metabolic coupling by sP26 and/or GlnK1, e.g., by being involved in recruiting or separating GOGAT from GlnA1.
Finally, higher oligomeric states of GS enzymes have been known for a long time for organisms like yeast and E. coli (He et al., 2009; Huang et al., 2022; Petrovska et al., 2014; Valentine et al., 1968). Interestingly, dependent on the ice thickness and on higher concentrated areas of the grids, we could also observe filament-like structures of M. mazei GlnA1 in cryo-EM and resolved their structure at a resolution of 6.9 Å (Figure 3—figure supplement 2). Such GlnA1 filaments are also detectable in the cryo-EM images of Schumacher et al., 2023, but were not reported. The filament interface is much alike the previously reported E. coli GS filament structures (Huang et al., 2022). The physiological relevance of filamentation in M. mazei however remains unresolved and raises the question, whether an additional rapid modulation of GlnA1 activity through higher oligomeric states exists. In yeast for example, GS filamentation was described as mostly depending on stress conditions (Petrovska et al., 2014).
M. mazei GlnA1 shows unique properties
Overall, we have confirmed 2-OG to be the central activator of GlnA1 in M. mazei, which assembles the active dodecamer and induces a conformational switch towards an active open state. Though 2-OG has previously been reported as an on-switch for (methano)archaeal GS activity (Ehlers et al., 2005; Müller et al., 2024; Pedro-Roig et al., 2013), the 2-OG-triggered dodecameric assembly is novel and described exclusively for M. mazei GlnA1. Neither in cyanobacteria, enterobacteria or Bacillus has 2-OG been reported as the sole direct activator of the enzyme, nor is complex (dis-)assembly a mode of regulating GS activity in any other of these model organisms. This is further supported by the absence of up to three of those four arginines, which are coordinating 2-OG in M. mazei GlnA1, in these organisms (Figure 7—figure supplement 1). The cyanobacterial, enterobacterial, and gram-positive GS are assumed to be present in the cell as active dodecamers (Almassy et al., 1986; Bolay et al., 2018; Deuel et al., 1970). These dodecamers are inactivated upon sudden N sufficiency through very different mechanisms all including additional proteins (see Figure 7). In Synechocystis, GS is blocked by small proteins, which are repressed under nitrogen limitation, one in a 2-OG-NtcA mediated way and the other one via a glutamine sensing riboswitch (Bolay et al., 2018; Klähn et al., 2018; Klähn et al., 2015). The enterobacterial GS experiences 2-OG-PII dependent gradual adenylylation of subunits, which abolishes the enzyme activity, and B. subtilis GS is feedback inhibited by glutamine and further inhibited by binding of the transcription factor GlnR (Almassy et al., 1986; Stadtman, 2001; Travis et al., 2022). Consequently, the GS regulation in M. mazei by a 2-OG triggered assembly is unique across all prokaryotic GS studied so far.
Model of the various molecular mechanisms of glutamine synthetase activity regulation.
Comparison of the regulation of glutamine synthetase activity in E. coli /Salmonella typhimurium, B. subtilis, Synechocystis,a and M. mazei. Glutamine synthetases (GS) are in general active in a dodecameric, unmodified complex under nitrogen limitation. Upon an ammonium upshift, GS are inactivated by feedback inhibition (BcGS, E. coli), covalent modification (adenylylation, EcGS) or binding of (small) inactivating proteins (Synechocystis, BsGS). M. mazei GS on the contrary is regulated via the assembly of the active dodecamer upon 2-oxoglutarate (2-OG)-binding and furthermore is strongly feedback inhibited by glutamine. (Bolay et al., 2018; Klähn et al., 2018; Klähn et al., 2015; Stadtman, 2001; Travis et al., 2022). Created with BioRender.com.
The direct 2-OG activation and glutamine feedback inhibition of M. mazei GS are two fast, reversible, and very direct ways of reacting towards the changing N status of the cell. We propose that the direct activation through 2-OG without any required additional protein, as it is the case for all other regulations, is a more simple and direct regulation of GS. Due to the evolutionary placement of methanoarchaea and haloarchaea, where a direct 2-OG regulation has been found exclusively, this may represent an ancient regulation.
Materials and methods
Strains and plasmids
Request a detailed protocolFor heterologous expression and purification of Strep-tagged GlnA1 (MM_0964), the plasmid pRS1841 was constructed. The glnA1-sequence along with the sP26-sequence (including start-codon: ATG) were codon-optimized for Escherichia coli expression and commercially synthesized by Eurofins Genomics on the same plasmid (pRS1728) (Ebersberg, Germany). Polymerase chain reaction (PCR) was performed using pRS1728 as template and the primers (Eurofins Genomics, Ebersberg, Germany) GlnAopt_NdeI_for (5’TTTCATATGGTTCAGATGAAAAAATG3’) and GlnA1opt_BamHI_rev (5’TTTGGATCCTTACAGCATGCTCAGATAACGG3’). The resulting GlnA1_opt PCR-product and vector pRS375 were restricted with NdeI and BamHI (NEB, Schwalbach, Germany); the resulting pRS375 vector fragment and the GlnA1 fragment were ligated resulting in pRS1841. For heterologous expression of Strep-GlnA1, pRS1841 was transformed in E. coli BL21 (DE3) cells (Thermo Fisher Scientific, Waltham, Massachusetts) following the method of Inoue (Inoue et al., 1990). For generating the Arg66Ala-mutant, a site-directed mutagenesis was performed. pRS1841 was PCR-amplified using primers sdm_GlnA_R66A_for (5’ATTGAAGAAAGCGATATGAAACTGGCGC3’) and sdm_GlnA_R66A_rev (5’CGCGGTAAAGCCCTGAATGCTGCTACC3’) by Phusion High-Fidelity polymerase (Thermo Fisher Scientific, Waltham, Massachusetts) followed by religation resulting in plasmid pRS1951. For heterologous expression, pRS1951 was transformed into E. coli BL21 (DE3).
In order to co-express sP26 along with Strep-GlnA1, the construct pRS1863 was generated. pRS1728 with the codon-optimized sP26-sequence and pET21a (Novagen, Darmstadt, Germany) were restricted with NdeI and NotI and the resulting untagged sP26_opt was ligated into the pET21a backbone yielding pRS1863. pRS1863 was co-transformed with pRS1841 into E. coli BL21 (DE3) cells (Thermo Fisher Scientific, Waltham, Massachusetts) selected for both Kanamycin (pRS1841 derived) and Ampicillin (pRS1863 derived) resistance.
The plasmid pRS1672 was constructed for producing untagged GlnK1. The GlnK1 gene was PCR-amplified using primers GlnK1_MM0732.for (5’ATGGTTGGCTATGAAATACGTAATTG3’) and GlnK1_MM0732.rev (5’TCAAATTGCCTCAGGTCCG3’) and cloned into pETSUMO by using the Champion pET SUMO Expression System (Thermo Fisher Scientific, Waltham, Massachusetts) according to the manufacturer’s protocol. pRS1672 was then transformed into E. coli DH5α (Hanahan, 1983) and BL21 (DE3) pRIL (Supplementary file 1).
Heterologous expression and protein purification: Strep-GlnA1 and GlnK1
Request a detailed protocolHeterologous expression of Strep-GlnA1-variants (pRS1841 and pRS1951) and Strep-GlnA1-sP26-coexpression (pRS1841 + pRS1863) were performed in 1 l Luria Bertani medium (LB, Carl Roth GmbH + Co. KG, Karlsruhe, Germany). E. coli BL21 (DE3) containing pRS1841, pRS1841 and pRS1863 or pRS1951 was grown to an optical turbidity at 600 nm (T600) of 0.6–0.8, induced with 25 µM isopropylβ-d-1-thiogalactopyranoside (IPTG, Carl Roth GmbH + Co. KG, Karlsruhe, Germany) and further incubated overnight at 18 °C and 120 rpm. The cells were harvested (6371 × g, 20 min, 4 °C) and resuspended in 6 ml W-buffer (100 mM TRIS/HCl, 150 mM NaCl, 2.5 mM EDTA, (chemicals from Carl Roth GmbH + Co. KG, Karlsruhe, Germany), 12.5 mM 2-oxoglutarate (2-OG, Sigma-Aldrich, St. Louis, Missouri), pH 8.0). After the addition of DNase I (Sigma-Aldrich, St. Louis, Missouri), cell disruption was performed twice using a French Pressure Cell at 4.135×106 N/m2 (Sim-Aminco Spectronic Instruments, Dallas, Texas) followed by centrifugation of the cell lysate for 30 min (13,804 × g, 4 °C). The supernatant was incubated with 1 ml equilibrated (W-buffer) Strep-Tactin sepharose matrix (IBA, Gottingen, Germany) at 4 °C for 1 h at 20 rpm. Strep-tagged GlnA1 was eluted from the gravity flow column by adding an E-buffer (W-buffer +2.5 mM desthiobiotine (IBA, Gottingen, Germany)). Strep-GlnA1 was always purified and stored in the presence of 12.5 mM 2-OG, either in E-buffer or 50 mM HEPES, pH 7.0 at 4 °C for a few days or with 5% glycerol at –80 °C (chemicals from Carl Roth GmbH + Co. KG, Karlsruhe, Germany).
His6-SUMO-GlnK1 was expressed similarly using E. coli BL21 (DE3) pRIL +pRS1672. Expression was induced with 100 µM IPTG, incubated at 37 °C, 180 rpm for 2 hr, and harvested. The pellet was resuspended in phosphate buffer (50 mM phosphate, 300 mM NaCl, pH 8 (chemicals from Carl Roth GmbH + Co. KG, Karlsruhe, Germany)) and the cell extract was prepared as described above. His-tag-affinity chromatography-purification was performed with a Ni-NTA agarose (Qiagen, Hilden, Germany) gravity flow column, the protein was purified by stepwise-elution with 100 and 250 mM imidazole (SERVA, Heidelberg, Deutschland) in phosphate buffer. SUMO-protease (Thermo Fisher Scientific, Waltham, Massachusetts) was used according to the manufacturer’s protocol to cleave the His6-SUMO-GlnK1 and obtain untagged GlnK1 by passing through the Ni-NTA-column after the cleavage. Elution fractions of protein purifications were analyzed on 12% SDS-PAGE gels and the protein concentrations were determined by Bradford (Bio-Rad Laboratories, Hercules, California) or Qubit protein assay (Thermo Fisher Scientific, Waltham, Massachusetts).
Determination of glutamine synthetase activity
Request a detailed protocolThe glutamine synthetase activity was determined by performing a coupled optical assay (Shapiro and Stadtman, 1970). The assay was performed as described in Gutt et al., 2021 with modifications. First, a substrate mix containing 257 mM KCl, 143 mM NH4Cl, 143 mM MgCl2 (chemicals from Carl Roth GmbH + Co. KG, Karlsruhe, Germany), and 86 mM sodium-glutamate (Sigma-Aldrich, St. Louis, Missouri) was prepared. The assay was performed in a final volume of 1 ml including 350 µl of the substrate mix, 10 µl of lactic dehydrogenase and pyruvate kinase mix (Sigma-Aldrich, St. Louis, Missouri), 50 mM HEPES (final concentration, Carl Roth GmbH +Co. KG, Karlsruhe, Germany), the respective amount of 2-OG (Sigma-Aldrich, St. Louis, Missouri), 1 mM phosphoenolpyruvate (PEP, Sigma-Aldrich, St. Louis, Missouri), 0.42 mM nicotinamide adenine dinucleotide (NADH) and 10 or 20 µg of Strep-GlnA1. After preincubation at room temperature in a volume of 950 µl for 5 min, the assay mixture was transferred to a cuvette, the time course measurement at 340 nm was started and the enzyme reaction induced by adding 3.6 mM ATP (pH adjusted to 7.0, Roche, Basel, Switzerland) (Figure 1—figure supplement 4). Biological replicates were independent protein expressions and purifications and the assays were performed with four technical replicates per condition, including two concentrations of GnA1 (2x10 µg and 2×20 µg of Strep-GlnA1, present in 100 µl were added). Strep-GlnA1 was stored in E-buffer (described above) or 50 mM HEPES containing 12.5 mM 2-OG which was dialyzed against 50 mM HEPES pH 7.0 using Amicon Ultra cartridges with 30 kDa filters (MilliporeSigma, Burlington, Massachusetts) for the enzyme assays in the absence of 2-OG.
Mass photometry
Request a detailed protocolThe molecular weight of protein complexes was analyzed by mass photometry (MP) using a Refeyn twoMP mass photometer with the AcquireMP software (Refeyn Ltd., Oxford, UK). All measurements were performed in 50 mM HEPES, 150 mM NaCl pH 7.0 (MP-buffer, chemicals from Carl Roth GmbH + Co. KG, Karlsruhe, Germany) on 1.5 H, 24×60 mm microscope coverslips with Culture Well Reusable Gaskets (GRACE BIO-LABS, Bend, Oregon). Strep-GlnA1 and untagged GlnK1 were prepared as described above. Prior to MP experiments, a size exclusion chromatography (SEC) was performed with GlnA1 in the presence of 12.5 mM 2-OG on a Superose 6 Increase 10/300 GL column (Cytiva, Marlborough, Massachusetts) with a flow rate of 0.5 ml/min. Only the dodecameric fraction was used for MP experiments and dialyzed against MP buffer using Amicon Ultra cartridges with 30 kDa filters (MilliporeSigma, Burlington, Massachusetts) beforehand. The Gel Filtration HMW Calibration Kit (Cytiva, Marlborough, Massachusetts) was used as a standard in SEC. 75–200 nM monomeric Strep-GlnA1 were used in the MP measurements, GlnK1 was added accordingly in the desired ratio calculated based on monomers. Biological replicates were independent protein expressions and purifications and technical replicates were the repetition of the measurement with the same protein in a fresh mix. The analysis of the acquired data was performed with the DiscoverMP software by applying a pre-measured standard (Refeyn Ltd., Oxford, UK). Counts were visualized in mass histograms as relative counts, which were calculated for the Gaussian fits of the measured peaks. For the determination of EC50-values and creating sigmoidal fitted curves, RStudio (RStudio Team (2020). RStudio: Integrated Development for R. RStudio, PBC, Boston, MA URL) was used.
Cryo-electron sample preparation and data collection
Request a detailed protocolPurified GS at a concentration of 1.5 mg/mL was rapidly applied to glow-discharged Quantifoil grids, blotted with force 4 for 3.5 s, and vitrified by directly plunging in liquid ethane (cooled by liquid nitrogen) using Vitrobot Mark IV (Thermo Fisher Scientific, Waltham, Massachusetts) at 100% humidity and 4 °C. To overcome the preferred orientation bias, 0.7 mM CHAPSO was added to prevent water-air interface interactions, consequently the concentration of the protein was increased to 6 mg/ml. We added purified commercially synthesized sP26 (Davids Biotechnologie, Regensburg, Germany) to all samples, but the peptide did not stably bind under the observed conditions. Data was acquired with EPU in EER-format on an FEI Titan Krios G4 (Cryo-EM Platform, Helmholtz Munich) equipped with a Falcon IVi detector (Thermo Fisher Scientific, Waltham, Massachusetts) with a total electron dose of ~55 electrons per Å2 and a pixel size of 0.76 Å. Micrographs were recorded in a defocus range of –0.25 to –2.0 μm. For details see Supplementary file 2.
Cryo-EM - Image processing, classification, and refinement
Request a detailed protocolAll data was processed using Cryosparc (Punjani et al., 2017). Micrographs were processed on the fly (motion correction, CTF estimation). Using blob picker, 878,308 particles were picked, 2D-classified, and used for ab initio reconstruction. Iterative rounds of ab initio and heterogenous refinement were used to clean the particle stacks. The final refinements yielded models with an estimated resolution of 2.39 Å sets at the 0.143 cutoff (Figure 3—figure supplement 1).
An initial model was generated from the protein sequences using alphaFold (Jumper et al., 2021), and thereupon fitted as rigid bodies into the density using UCSF Chimera (Pettersen et al., 2021). The model was manually rebuilt using Coot (Emsley et al., 2010). The final model was subjected to real-space refinements in PHENIX (Liebschner et al., 2019). Illustrations of the models were prepared using UCSF ChimeraX (Pettersen et al., 2021). The structure is accessible under PDB: 8s59. For details see Supplementary file 2.
Data availability
Diffraction data have been deposited in PDB under the accession code 8S59.
-
RCSB Protein Data BankID 8S59. Cryo-EM structure of the active dodecameric Methanosarcina mazei glutamine synthetase.
-
Worldwide Protein Data BankB. subtilis glutamine synthetase structures reveal large active site conformational changes and basis for isoenzyme specific regulation: structure of apo form of GS.https://doi.org/10.2210/pdb4LNN/pdb
-
Worldwide Protein Data BankCryo-EM structure of the Methanosarcina mazei glutamine synthetase (GS) with Met-Sox-P and ADP.https://doi.org/10.2210/pdb8TFK/pdb
-
Worldwide Protein Data BankCryo-EM structure of the Methanosarcina mazei apo glutamin synthetase structure: dodecameric form.https://doi.org/10.2210/pdb8TFB/pdb
References
-
Evolutionary relationships of bacterial and archaeal glutamine synthetase genesJournal of Molecular Evolution 38:566–576.https://doi.org/10.1007/BF00175876
-
Function and regulation of glnA in the methanogenic archaeon Methanococcus maripaludisJournal of Bacteriology 181:256–261.https://doi.org/10.1128/JB.181.1.256-261.1999
-
Bacillus subtilis Glutamine SynthetaseJournal of Biological Chemistry 245:5195–5205.https://doi.org/10.1016/S0021-9258(18)62741-3
-
Glutamine synthetase structure‐catalysis relationship—Recent advances and applicationsWIREs Computational Molecular Science 9:e1399.https://doi.org/10.1002/wcms.1399
-
Features and development of CootActa Crystallographica. Section D, Biological Crystallography 66:486–501.https://doi.org/10.1107/S0907444910007493
-
Regulation of nitrogen metabolism in Bacillus subtilis: vive la différence!Molecular Microbiology 32:223–232.https://doi.org/10.1046/j.1365-2958.1999.01333.x
-
BookThe PII protein in synechococcus PCC 7942 senses and signals 2-oxoglutarate under ATP-replete conditionsIn: Peschek GA, Löffelhardt W, Schmetterer G, editors. The Phototrophic Prokaryotes. Boston, MA: Springer US. pp. 549–553.https://doi.org/10.1007/978-1-4615-4827-0_63
-
Studies on transformation of Escherichia coli with plasmidsJournal of Molecular Biology 166:557–580.https://doi.org/10.1016/s0022-2836(83)80284-8
-
The molecular basis of TnrA control by glutamine synthetase in Bacillus subtilisThe Journal of Biological Chemistry 291:3483–3495.https://doi.org/10.1074/jbc.M115.680991
-
Nitrogen control in cyanobacteriaJournal of Bacteriology 183:411–425.https://doi.org/10.1128/JB.183.2.411-425.2001
-
A glutamine riboswitch is A key element for the regulation of glutamine synthetase in cyanobacteriaNucleic Acids Research 46:10082–10094.https://doi.org/10.1093/nar/gky709
-
Regulation of glutamine synthetase from Saccharomyces cerevisiae by repression, inactivation and proteolysisEuropean Journal of Biochemistry 123:611–616.https://doi.org/10.1111/j.1432-1033.1982.tb06576.x
-
Diverse homologues of the archaeal repressor NrpR function similarly in nitrogen regulationFEMS Microbiology Letters 271:281–288.https://doi.org/10.1111/j.1574-6968.2007.00726.x
-
Macromolecular structure determination using X-rays, neutrons and electrons: recent developments in PhenixActa Crystallographica. Section D, Structural Biology 75:861–877.https://doi.org/10.1107/S2059798319011471
-
The regulation of nitrogen utilization in enteric bacteriaJournal of Cellular Biochemistry 51:34–40.https://doi.org/10.1002/jcb.240510108
-
Small RNAs involved in regulation of nitrogen metabolismMicrobiology Spectrum 6:182018.https://doi.org/10.1128/microbiolspec.rwr-0018-2018
-
Nitrogen assimilation and global regulation in Escherichia coliAnnual Review of Microbiology 57:155–176.https://doi.org/10.1146/annurev.micro.57.030502.090820
-
Book[130] glutamine synthetase (Escherichia coli)In: Shapiro BM, Stadtman ER, editors. Methods in Enzymology. Elsevier. pp. 910–922.https://doi.org/10.1016/0076-6879(71)17305-3
-
Book[60] discovery of glutamine synthetase cascadIn: Deutscher MP, editors. Methods in Enzymology, Guide to Protein Purification. Academic Press. pp. 793–809.https://doi.org/10.1016/0076-6879(90)82062-7
-
The story of glutamine synthetase regulationThe Journal of Biological Chemistry 276:44357–44364.https://doi.org/10.1074/jbc.R100055200
-
Nitrogen assimilation in Escherichia coli: putting molecular data into a systems perspectiveMicrobiology and Molecular Biology Reviews 77:628–695.https://doi.org/10.1128/MMBR.00025-13
-
Insights into the NrpR regulon in Methanosarcina mazei Gö1Archives of Microbiology 190:319–332.https://doi.org/10.1007/s00203-008-0369-3
-
Regulation of glutamine synthetase. 3. Cumulative feedback inhibition of glutamine synthetase from Escherichia coliArchives of Biochemistry and Biophysics 118:736–755.https://doi.org/10.1016/0003-9861(67)90412-2
-
Refined atomic model of glutamine synthetase at 3.5 A resolutionThe Journal of Biological Chemistry 264:17681–17690.https://doi.org/10.2210/pdb2gls/pdb
Article and author information
Author details
Funding
Deutsche Forschungsgemeinschaft (Schm1052/20-2)
- Ruth Anne Schmitz
Deutsche Forschungsgemeinschaft (SCHU 3364/1-1)
- Jan Schuller
European Research Council
https://doi.org/10.3030/101075992- Jan Schuller
The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.
Acknowledgements
We thank the members of our laboratories for useful discussions on the experiments, as well as Claudia Kiessling for technical assistance. This work was supported by the German Research Council (DFG) priority program (SPP) 2002 ‘Small proteins in Prokaryotes, an unexplored world’ [Schm1052/20-2]. We acknowledge the contribution of the CryoEM Facility of the Philipps University of Marburg. JMS acknowledges the DFG for an Emmy Noether grant (SCHU 3364/1–1) co-funded by the European Union (ERC, TwoCO2One, 101075992). Views and opinions expressed are, however, those of the author(s) only and do not necessarily reflect those of the European Union or the European Research Council. Neither the European Union nor the granting authority can be held responsible for them. We thank Sandra Schuller for useful discussions and help in preparing manuscript figures. GKAH was supported by the Max Planck Society. We acknowledge financial support by Land Schleswig-Holstein within the funding program Open Access Publikationsfonds.
Version history
- Sent for peer review:
- Preprint posted:
- Reviewed Preprint version 1:
- Reviewed Preprint version 2:
- Version of Record published:
Cite all versions
You can cite all versions using the DOI https://doi.org/10.7554/eLife.97484. This DOI represents all versions, and will always resolve to the latest one.
Copyright
© 2024, Herdering, Reif-Trauttmansdorff et al.
This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.
Metrics
-
- 1,267
- views
-
- 89
- downloads
-
- 5
- citations
Views, downloads and citations are aggregated across all versions of this paper published by eLife.
Citations by DOI
-
- 5
- citations for umbrella DOI https://doi.org/10.7554/eLife.97484